Quantifying Yersinia pseudotuberculosis Type III Secretion System Activity Following Iron Starvation and Anaerobic Growth

Summary

Bacteria colonize host tissues that vary in oxygen and iron bioavailability, yet most approaches to studying bacteria use aerated, rich media. This protocol describes culturing the human pathogen Yersinia pseudotuberculosis under varying iron concentrations and oxygen tension, and quantifying activity of the Yersinia type III secretion system, which is an important virulence factor.

Abstract

A key virulence mechanism for many Gram-negative pathogens is the type III secretion system (T3SS), a needle-like appendage that translocates cytotoxic or immunomodulatory effector proteins into host cells. The T3SS is a target for antimicrobial discovery campaigns since it is accessible extracellularly and largely absent from non-pathogenic bacteria. Recent studies demonstrated that the T3SS of Yersinia and Salmonella are regulated by factors responsive to iron and oxygen, which are important niche-specific signals encountered during mammalian infection. Described here is a method for iron starvation of Yersinia pseudotuberculosis, with subsequent optional supplementation of inorganic iron. To assess the impact of oxygen availability, this iron starvation process is demonstrated under both aerobic and anaerobic conditions. Finally, incubating the cultures at the mammalian host temperature of 37 °C induces T3SS expression and allows quantification of Yersinia T3SS activity by visualizing effector proteins released into the supernatant. The steps detailed here offer an advantage over the use of iron chelators in the absence of iron starvation, which is insufficient for inducing robust iron starvation, presumably due to efficient Yersinia iron uptake and scavenging systems. Likewise, acid-washing laboratory glassware is detailed to ensure the removal of residual iron, which is essential for inducing robust iron starvation. Additionally, using a chelating agent is described to remove residual iron from media, and culturing the bacteria for several generations in the absence of iron to deplete bacterial iron stores. By incorporating standard protocols of trichloroacetic acid-induced protein precipitation, SDS-PAGE, and silver staining, this procedure demonstrates accessible ways to measure T3SS activity. While this procedure is optimized for Y. pseudotuberculosis, it offers a framework for studies in pathogens with similar robust iron uptake systems. In the age of antibiotic resistance, these methods can be expanded to assess the efficacy of antimicrobial compounds targeting the T3SS under host-relevant conditions.

Introduction

Many clinically relevant Gram-negative pathogens like Yersinia, Vibrio, Escherichia, Pseudomonas, and Shigella encode the type III secretion system (T3SS) to inject effector proteins into host cells¹. In many bacterial species, the T3SS is under strict regulatory control². For example, translocation of Yersinia T3SS effector proteins into target host cells is critical to subvert host defense mechanisms and enable bacterial colonization of host tissues. However, Yersinia T3SS activity is metabolically burdensome and can trigger recognition by host immune receptors....

Protocol

The details of the reagents, media composition, primer sequences, and equipment are listed in the Table of Materials. Figure 1 illustrates the overall experimental workflow.

1. Preparation of acid washed glassware and chelated M9 media

NOTE: Before starting, refer to the material section for the exact reagents and recipes that will be used. M9 media was first used for Yersinia T3SS assays in Chen.......

Discussion

The T3SS is an important virulence factor in many pathogenic bacteria; therefore, developing laboratory techniques to study its regulation is important for understanding pathogenesis and developing potential therapeutics¹. Iron and oxygen are known to be important host cues sensed by bacterial pathogens to regulate T3SS expression⁵; therefore, this method presents a strategy for culturing Y. pseudotuberculosis under either anaerobic or aerobic conditions, with iron.......

Materials

Name	Company	Catalog Number	Comments
10 mL Luer-Lok Tip syringe	BD	301029
10x SDS Running Buffer	Home made		0.25 M Tris base, 1.92 M Glycine, 1% SDS in 1 L volume
12.5% SDS-Page Gel	Home made
15 mL culture tubes	Falcon	352059	For initial overnight
15 mL Falcon tubes	Falcom	352196	For supernatant collection
250 mL culture flask	Belco	251000250
500 mL Filter System	Corning	431097
6 N Hydrochloric acid solution	Fisher Scientific	7732185
Acetone	Fisher Chemical	A949-4	4 L
Bio Rad ChemiDoc MP Imaging System	Bio Rad	Model Number: Universal Hood III
Borosilicate glass culture tubes	Fisherbrand	14-961-34	For anaerobic culturing
Chelex 100 Resin	Bio Rad	142-1253
Chelex M9 +0.9% Glucose media	Home made		6 g/L Na2HPO4, 3 g/L KH2PO4, 0.5 g/L NaCl, 1 g/L NH4Cl, 1% casamino acids, 0.9% dextrose, 0.0005% thiamine, 5 g/L Chelex 100 Resin. Stir media for 18 h at room temp, filter using 500 mL Corning filtration unit, then add MgSO4 for 1 mM MgSO4 final solution
Final Sample Buffer (FSB)	Home made		0.1 M Tris-HCl, 4% SDS, 20% glycerol, 0.2% of Bromophenol Blue
FSB:DTT solution	Home made		FSB+0.2M DTT
Image Lab Software	Bio Rad	https://www.bio-rad.com/en-us/product/image-lab-software?ID=KRE6P5E8Z	Software
Isotemp Heat Block	Fisher Scientific	88860021
LB Agar Plates	Home made		10 g Tryptone, 5 g Yeast extract, 10 g NaCl, 15 g Agar in 1 L total volume. Autoclaved
M9+0.2% Glucose Media	Home made		6 g/L Na2HPO4, 3 g/L KH2PO4, 0.5 g/L NaCl, 1 g/L NH4Cl, 1 mM MgSO4, 1 mg/L FeSO47H2O, 1% casamino acids, 0.2% dextrose, 0.0005% thiamine
Millex-GP PES 0.22um filter attachment for syringe	Millipore	SLGPR33RS	For FeSO47H2O filtration
Millex-GV PVDF 0.22um filter attachment for syringe	Millipore	SLGVR33RS	For supernatant filtration
Precision Plus Protein Unstained Standard	Bio Rad	1610363
SDS-PAGE Gel Apparatus	Bio Rad	Model Number: Mini PROTEAN Tetra Cell
SilverXpress Silver Staining Kit	Invitrogen	LC6100
The BellyDancer Shaker	IBI Scientific	BDRAA1155
Trichloroacetic acid solution 6.1N	Sigma Aldrich	T0699
Vinyl Anaerobic Chamber	Coy Lab Products		https://coylab.com/products/anaerobic-chambers/vinyl-anaerobic-chambers/#details
qPCR Primer sequences
yfeA forward - CAC AGT CAG CAG ACC TTA TCT T
yfeA reverse - GGC AGA CGG GAC ATC TTT AAT A
bfd forward - ccagcatcagccccatacag
bfd reverse - tggcttgtcggatgcacttc
yopE forward - CCATAAACCGGTGGTGAC
yopE reverse - CTTGGCATTGAGTGATACTG