Name: identification of protein complexes in escherichia coli using sequential peptide affinity purification in combination with tandem mass spectrometry
Uploaded: 2012-11-12T13:00:00
Description: Watch this Scientific Journal Video about Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry at JoVE.co

This work was supported by funds from the Canadian Foundation for Innovation, Genome Canada, the Ontario Genomics Institute, the Ontario Ministry of Innovation, and the Canadian Institutes of Health Research grant to J.G. and A.E. The Red-expressing E. coli strain DY330 was a kind gift from Donald L. Court (National Cancer Institute, Frederick, MD).

1. Construction of Gene-specific SPA-tagging in E. coli DY330 Strain
<ol>
 <li>The plasmid pJL148 encompassing the SPA-tag DNA sequence and the kanamycin antibiotic resistance marker cassette (KanR) are used as a template in polymerase chain reaction (PCR) amplification7. A 45 nt gene-specific forward primer, located immediately upstream of the target gene stop codon in frame with a 27 bp (5'- AGCTGGAGGATCCATGGAAAAGAGAAG -3') tag specific forward primer, and a 45 nt gene-specific reverse ...

<ol>
	<li>Butland, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interaction+network+containing+conserved+and+essential+protein+complexes+in+Escherichia+coli.">Interaction network containing conserved and essential protein complexes in Escherichia coli.</a> Nature. 433, 531-537 (2005).</li><li>Hu, P., Janga, S. C., Babu, M., Diaz-Mejia, J. J., Butland, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+functional+atlas+of+Escherichia+coli+encompassing+previously+uncharacterized+proteins.">Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins.</a> PLoS Biol. 7, e1000096 (2009).</li><li>Krogan, N. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+landscape+of+protein+complexes+in+the+yeast+Saccharomyces+cerevisiae.">Global landscape of protein complexes in the yeast Saccharomyces cerevisiae.</a> Nature. 440, 637-643 (2006).</li><li>Mak, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+lentiviral+functional+proteomics+approach+identifies+chromatin+remodeling+complexes+important+for+the+induction+of+pluripotency.">A lentiviral functional proteomics approach identifies chromatin remodeling complexes important for the induction of pluripotency.</a> Mol. Cell Proteomics. 9, 811-823 (2010).</li><li>Polanowska, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tandem+immunoaffinity+purification+of+protein+complexes+from+Caenorhabditis+elegans.">Tandem immunoaffinity purification of protein complexes from Caenorhabditis elegans.</a> Biotechniques. 36, 778-782 (2004).</li><li>Veraksa, A., Bauer, A., Artavanis-Tsakonas, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analyzing+protein+complexes+in+Drosophila+with+tandem+affinity+purification-mass+spectrometry.">Analyzing protein complexes in Drosophila with tandem affinity purification-mass spectrometry.</a> Dev. Dyn. 232, 827-834 (2005).</li><li>Zeghouf, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+Peptide+Affinity+(SPA)+system+for+the+identification+of+mammalian+and+bacterial+protein+complexes.">Sequential Peptide Affinity (SPA) system for the identification of mammalian and bacterial protein complexes.</a> J. Proteome Res. 3, 463-468 (2004).</li><li>Puig, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+tandem+affinity+purification+(TAP)+method:+a+general+procedure+of+protein+complex+purification.">The tandem affinity purification (TAP) method: a general procedure of protein complex purification.</a> Methods. 24, 218-229 (2001).</li><li>Rigaut, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+generic+protein+purification+method+for+protein+complex+characterization+and+proteome+exploration.">A generic protein purification method for protein complex characterization and proteome exploration.</a> Nat. Biotechnol. 17, 1030-1032 (1999).</li><li>Yu, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+recombination+system+for+chromosome+engineering+in+Escherichia+coli.">An efficient recombination system for chromosome engineering in Escherichia coli.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 5978-5983 (2000).</li><li>Kislinger, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PRISM,+a+generic+large+scale+proteomic+investigation+strategy+for+mammals.">PRISM, a generic large scale proteomic investigation strategy for mammals.</a> Mol. Cell Proteomics. 2, 96-106 (2003).</li><li>Vlasblom, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GenePro:+a+Cytoscape+plug-in+for+advanced+visualization+and+analysis+of+interaction+networks.">GenePro: a Cytoscape plug-in for advanced visualization and analysis of interaction networks.</a> Bioinformatics. 22, 2178-219 (2006).</li><li>de Berardinis, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1.">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174 (2008).</li><li>Babu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+peptide+affinity+purification+system+for+the+systematic+isolation+and+identification+of+protein+complexes+from+Escherichia+coli.">Sequential peptide affinity purification system for the systematic isolation and identification of protein complexes from Escherichia coli.</a> Methods Mol. Biol. 564, 373-400 (2009).</li></ol>

A key aspect of the SPA-based APMS approach described here is that tagging is performed within the natural chromosomal context, thereby ensuring normal gene regulation is maintained (i.e. native bait promoter preserved, hence expression levels is not perturbed) and native stably-associated protein complexes are recovered at near-endogenous levels. Operon polarity issues are also avoided by including an outwardly oriented promoter in the selectable marker. This SPA-tagging approach is effective enough to purify t...

<table border="1">
	<tbody>
		<tr>
			<td>Materials</td>
			<td>Vendor</td>
			<td>and Catalog Numbers</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>I. Antibiotics</td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>Bioshop</td>
			<td>#KAN201</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Bioshop</td>
			<td>#AMP201</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>2. Terrific-Broth medium</td>
		</tr>
		<tr>
			<td>Bio-Tryptone</td>
			<td>Bioshop</td>
			<td>#TRP 402</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>Bioshop</td>
			<td>#YEX 555</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Bioshop</td>
			<td>#GLY 002</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>K2HPO4</td>
			<td>Bioshop</td>
			<td>#PPM 302</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>KH2PO4</td>
			<td>Bioshop</td>
			<td>#PPM 303</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>3. Bacterial Strain and Plasmid</td>
		</tr>
		<tr>
			<td>DY330</td>
			<td>&nbsp;</td>
			<td>Yu et al. (2000)10</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>pJL148</td>
			<td>&nbsp;</td>
			<td>Zeghouf et al. (2004)7</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>4. PCR and Electrophoresis Reagents</td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>10 X PCR buffer</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>10 mM dNTPs</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>25 mM MgCl2</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Bioshop</td>
			<td># AGA002</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Loading dye</td>
			<td>NEB</td>
			<td>#B7021S</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Bioshop</td>
			<td># ETB444</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>10X TBE buffer</td>
			<td>Thermo Scientific</td>
			<td>#28355</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Tris Base</td>
			<td>Bioshop</td>
			<td>#TRS001</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Boric acid</td>
			<td>Bioshop</td>
			<td>#BOR001</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>0.5 M EDTA (pH 8.0)</td>
			<td>Sigma</td>
			<td># E6768</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>DNA ladder</td>
			<td>NEB</td>
			<td>#N3232L</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>5. Plasmid isolation and Clean-up Kits</td>
		</tr>
		<tr>
			<td>Plasmid Midi kit</td>
			<td>Qiagen</td>
			<td>#12143</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>QIAquick PCR purification kit</td>
			<td>Qiagen</td>
			<td>#28104</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>6. PCR and Transformation Equipments</td>
		</tr>
		<tr>
			<td>Thermal cycler</td>
			<td>BioRad</td>
			<td>iCycler</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Agarose gel electrophoresis</td>
			<td>BioRad</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Electroporator</td>
			<td>Bio-Rad</td>
			<td>GenePulser II</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>0.2 cm electroporation cuvette</td>
			<td>Bio-Rad</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>42 &deg;C water bath shaker</td>
			<td>&nbsp;</td>
			<td>Innova 3100</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Beckman Coulter TJ-25 centrifuge</td>
			<td>Beckman Coulter</td>
			<td>TS-5.1-500</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>32 &deg;C Shaker</td>
			<td>New Brunswick Scientific, USA</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>32 &deg;C large Shaker</td>
			<td>New Brunswick Scientific, USA</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>32 &deg;C plate incubator</td>
			<td>Fisher Scientific</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>7. Electrophoresis and Western blotting</td>
		</tr>
		<tr>
			<td>Acrylamide monomer, N,N'- methylenebis-acrylamide</td>
			<td>Bio-Rad</td>
			<td>#161-0125</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Ammonium persulfate</td>
			<td>Bioshop</td>
			<td># AMP001</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>n-butanol</td>
			<td>Sigma</td>
			<td># B7906</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>TEMED</td>
			<td>Bioshop</td>
			<td>#TEM001</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Whatman No. 1 filter paper</td>
			<td>Fischer Scientific</td>
			<td>#09-806A</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Mini protean 3 cell</td>
			<td>Bio-Rad</td>
			<td>#165-3301</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>iBlot gel transfer device</td>
			<td>Invitrogen</td>
			<td>#IB1001</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Nitrocellulose membranes</td>
			<td>Bio-Rad</td>
			<td>#162-0115</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Monoclonal Anti-Flag M2 antibody</td>
			<td>Sigma</td>
			<td>#F3165</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Horseradish peroxidase</td>
			<td>Amersham</td>
			<td>#NA931V</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Pre-stained protein molecular weight standards</td>
			<td>Bio-Rad</td>
			<td>#161-0363</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Chemiluminescence reagent</td>
			<td>PIERCE</td>
			<td>#1856136</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Autoradiography film</td>
			<td>Clonex Corp</td>
			<td>#CLEC810</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Quick Draw blotting paper</td>
			<td>Sigma</td>
			<td>#P7796</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>C2 platform rocking shaker</td>
			<td>New Brunswick Scientific, USA</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>8. Sonication Equipment and Reagents</td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Branson Ultrasonic</td>
			<td>#23395</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Bioshop</td>
			<td>#SOD001</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Protease inhibitors</td>
			<td>Roche</td>
			<td>#800-363-5887</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>0.5 mM TCEP-HCl</td>
			<td>Thermo Scientific</td>
			<td>#20490</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>9. Affinity Purification Reagents and Equipment</td>
		</tr>
		<tr>
			<td>0.8 x 4 cm Bio-Rad polypropylene column</td>
			<td>Bio-Rad</td>
			<td>#732-6008</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Benzonase nuclease</td>
			<td>Novagen</td>
			<td>#70746</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Anti-FLAG M2 agarose beads</td>
			<td>Sigma</td>
			<td>#A2220</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Calmodulin-sepharose beads</td>
			<td>GE Healthcare</td>
			<td>#17-0529-01</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>TEV protease</td>
			<td>Invitrogen</td>
			<td>#12575-015</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma</td>
			<td>#T9284</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>CaCl2</td>
			<td>Sigma</td>
			<td>#C2661</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>EGTA</td>
			<td>Sigma</td>
			<td>#E3889</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>LabQuake Shaker</td>
			<td>Thermolyne</td>
			<td>#59558</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>10. Silver Staining Reagents</td>
		</tr>
		<tr>
			<td>Methanol</td>
			<td>Bioshop</td>
			<td>#MET302</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Acetic acid</td>
			<td>Bioshop</td>
			<td>t#ACE222</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Sodium-thiosulfate</td>
			<td>Sigma</td>
			<td>#S-7143</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Silver nitrate</td>
			<td>Fischer Scientific</td>
			<td>#S181-100</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Formaldehyde</td>
			<td>Bioshop</td>
			<td>#FOR201</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Sodium carbonate</td>
			<td>Bioshop</td>
			<td>#SOC512</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>11. Reagents and Equipment for Protein Identification </td>
		</tr>
		<tr>
			<td>Trypsin Gold, Mass Spectrometry Grade</td>
			<td>Promega</td>
			<td># V5280</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>50 mM NH4HCO3</td>
			<td>Bioshop</td>
			<td>#AMC555</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>1 mM CaCl2</td>
			<td>Bioshop</td>
			<td>#CCL302</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Acetonitrile</td>
			<td>Sigma</td>
			<td>#A998-4</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Formic acid</td>
			<td>Sigma</td>
			<td>#F0507</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>HPLC grade water</td>
			<td>Sigma</td>
			<td>#95304</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Iodoacetamide</td>
			<td>Sigma</td>
			<td>#16125</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Millipore Zip-Tip</td>
			<td>Millipore</td>
			<td># ZTC18M960</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>~10 cm of 3 &mu;m Luna-C18 resin</td>
			<td>Phenomenex</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Proxeon nano HPLC pump</td>
			<td>Thermo Fisher Scientific</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>LTQ Orbitrap Velos mass spectrometer</td>
			<td>&nbsp;</td>
			<td>Thermo Fisher Scientific</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>12. Labware</td>
		</tr>
		<tr>
			<td>4 liter conical flasks</td>
			<td>VWR</td>
			<td>#89000-372</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>50 ml polypropylene falcon tubes</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>1.5 ml micro-centrifuge tubes</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>250 ml conical flaks</td>
			<td>VWR</td>
			<td>#29140-045</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>15 ml sterile culture tubes</td>
			<td>Thermo Scientific</td>
			<td>#366052</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Cryogenic vials</td>
			<td>VWR</td>
			<td>#479-3221</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>-80 &deg;C freezer</td>
			<td>Fisher Scientific</td>
			<td>#13-990-14</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Speed vacuum system</td>
			<td>Thermo Scientific</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>
			Buffers and Solutions
			1. 1 liter Terrific Broth (TB) media
			11 g Bio-Tryptone 
			22 g Yeast Extract 
			2% Glycerol 
			50 ml potassium salt stock solution
			2. Potassium Salt Stock Solution
			1.5 M K2HPO4 
			0.35 M KH2PO4
			3. Sonication Buffer
			20 mM Tris-HCl (pH 7.9) 
			150 mM NaCl 
			0.2 mM EDTA 
			10% Glycerol 
			Before use add protease inhibitor (PI) and 0.1-0.5 mM TCEP
			4. AFC buffer
			30 mM Tris-HCl (pH 7.9) 
			150 mM NaCl 
			0.1% detergent 
			Before use add PI and 0.1-0.5 mM TCEP
			5. TEV cleavage buffer
			30 mM Tris-HCl (pH 7.9) 
			150 mM NaCl 
			0.2 mM EDTA 
			0.1% detergent 
			Before use add PI and 0.1-0.5 mM TCEP
			6. Calmodulin binding buffer
			30 mM Tris-HCl (pH 7.9) 
			150 mM NaCl 
			2 mM CaCl2 
			0.1% detergent 
			Before use add PI and 0.1-0.5 mM TCEP
			7. Calmodulin wash buffer
			30 mM Tris-HCl pH 7.9 
			150 mM NaCl 
			2 mM CaCl2 
			0.1-0.5 mM TCEP
			8. Calmodulin elution buffer
			30 mM Tris-HCl (pH 7.9) 
			100 mM NaCl 
			10 mM EGTA 
			0.1-0.5 mM TCEP
			9. Developing solution (1L)
			37% Formaldehyde 
			30 g sodium carbonate 
			1000 ml distilled water
			10. Digestion buffer
			50 mM NH4HCO3 
			1 mM CaCl2
			11. Wetting and Equilibration solution
			70% acetonitrile (ACN) in 0.1% formic acid
			12. Washing solution
			100% H2O in 0.1% formic acid</td>
		</tr>
	</tbody>
</table>

identification of protein complexes in escherichia coli using sequential peptide affinity purification in combination with tandem mass spectrometry

Since most cellular processes are mediated by macromolecular assemblies, the systematic identification of protein-protein interactions (PPI) and the identification of the subunit composition of multi-protein complexes can provide insight into gene function and enhance understanding of biological systems1, 2. Physical interactions can be mapped with high confidence vialarge-scale isolation and characterization of endogenous protein complexes under near-physiological conditions based on affinity purification of chromosomally-tagged proteins in combination with mass spectrometry (APMS). This approach has been successfully applied in evolutionarily diverse organisms, including yeast, flies, worms, mammalian cells, and bacteria1-6. In particular, we have generated a carboxy-terminal Sequential Peptide Affinity (SPA) dual tagging system for affinity-purifying native protein complexes from cultured gram-negative Escherichia coli, using genetically-tractable host laboratory strains that are well-suited for genome-wide investigations of the fundamental biology and conserved processes of prokaryotes1, 2, 7. Our SPA-tagging system is analogous to the tandem affinity purification method developed originally for yeast8, 9, and consists of a calmodulin binding peptide (CBP) followed by the cleavage site for the highly specific tobacco etch virus (TEV) protease and three copies of the FLAG epitope (3X FLAG), allowing for two consecutive rounds of affinity enrichment. After cassette amplification, sequence-specific linear PCR products encoding the SPA-tag and a selectable marker are integrated and expressed in frame as carboxy-terminal fusions in a DY330 background that is induced to transiently express a highly efficient heterologous bacteriophage lambda recombination system10. Subsequent dual-step purification using calmodulin and anti-FLAG affinity beads enables the highly selective and efficient recovery of even low abundance protein complexes from large-scale cultures. Tandem mass spectrometry is then used to identify the stably co-purifying proteins with high sensitivity (low nanogram detection limits).
Here, we describe detailed step-by-step procedures we commonly use for systematic protein tagging, purification and mass spectrometry-based analysis of soluble protein complexes from E. coli, which can be scaled up and potentially tailored to other bacterial species, including certain opportunistic pathogens that are amenable to recombineering. The resulting physical interactions can often reveal interesting unexpected components and connections suggesting novel mechanistic links. Integration of the PPI data with alternate molecular association data such as genetic (gene-gene) interactions and genomic-context (GC) predictions can facilitate elucidation of the global molecular organization of multi-protein complexes within biological pathways. The networks generated for E. coli can be used to gain insight into the functional architecture of orthologous gene products in other microbes for which functional annotations are currently lacking.

Once tagged bait proteins, which are expressed at endogenous levels are affinity-purified from logarithmic phase cultures the samples were run on a silver-stain gel to visualize the individual polypeptide components of the isolated stable complexes. We also subjected a second portion of the affinity-purified protein samples to gel-free tandem mass spectrometry (LCMS) to identify the corresponding polypeptide sequences. The effectiveness of this APMS procedure is shown with a representative SDS-PAGE analysis of the compon...

Watch this Scientific Journal Video about Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry at JoVE.co

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

Affinity purification of tagged proteins in combination with mass spectrometry (APMS) is a powerful method for the systematic mapping of protein interaction networks and for investigating the mechanistic basis of biological processes. Here, we describe an optimized sequential peptide affinity (SPA) APMS procedure developed for the bacterium Escherichia coli that can be used to isolate and characterize stable multi-protein complexes to near homogeneity even starting from low copy numbers per cell.

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

Since most cellular processes are mediated by macromolecular assemblies, the systematic identification of protein-protein interactions (PPI) and the ...

Research

JoVE Journal

Biology

Identification of protein complexes with quantitative proteomics in S. cerevisiae

Lipids are the building blocks of cellular membranes that function as barriers and in compartmentalization of cellular processes, and recently, as ...

Staining of Proteins in Gels with Coomassie G-250 without Organic Solvent and Acetic Acid

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents ...

Purification of the M. magneticum Strain AMB-1 Magnetosome Associated Protein MamA&Delta;41

Magnetotactic bacteria comprise a diverse group of aquatic microorganisms that are able to orientate themselves along geomagnetic fields. This behavior is ...

Analyzing Large Protein Complexes by Structural Mass Spectrometry

Living cells control and regulate their biological processes through the coordinated action of a large number of proteins that assemble themselves into an ...

Quantification of Proteins Using Peptide Immunoaffinity Enrichment Coupled with Mass Spectrometry

There is a great need for quantitative assays in measuring proteins. Traditional sandwich immunoassays, largely considered the gold standard in ...

Identification of Protein Interacting Partners Using Tandem Affinity Purification

A critical and often limiting step in understanding the function of host and viral proteins is the identification of interacting cellular or viral protein ...

A Protocol for the Identification of Protein-protein Interactions Based on 15N Metabolic Labeling, Immunoprecipitation, Quantitative Mass Spectrometry and Affinity Modulation

A Protocol for the Identification of Protein-protein Interactions Based on 15N Metabolic Labeling, Immunoprecipitation, Quantitative Mass Spectrometry and Affinity Modulation

Protein-protein interactions are fundamental for many biological processes in the cell. Therefore, their characterization plays an important role in ...

Identifying Protein-protein Interaction in Drosophila Adult Heads by Tandem Affinity Purification (TAP)

Identifying Protein-protein Interaction in Drosophila Adult Heads by Tandem Affinity Purification TAP

Genetic screens conducted using Drosophila melanogaster (fruit fly) have made numerous milestone discoveries in the advance of biological sciences. ...

Identification of Post-translational Modifications of Plant Protein Complexes

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to ...

Non-chromatographic Purification of Recombinant Elastin-like Polypeptides and their Fusions with Peptides and Proteins from Escherichia coli

Non-chromatographic Purification of Recombinant Elastin-like Polypeptides and their Fusions with Peptides and Proteins from Escherichia coli

Elastin-like polypeptides are repetitive biopolymers that exhibit a lower critical solution temperature phase transition behavior, existing as soluble ...