Name: studying cell cycle-regulated gene expression by two complementary cell synchronization protocols
Uploaded: 2017-06-06T15:45:00
Description: Watch this Scientific Journal Video about Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols at JoVE.com

We thank members of the Zubiaga and the Altmeyer laboratories for helpful discussions and for technical support. This work was supported by grants from the Spanish Ministry (SAF2015-67562-R, MINECO/FEDER, UE), the Basque Government (IT634-13 and KK-2015/89), and the University of the Basque Country UPV/EHU (UFI11/20).

1. Cellular Synchronization, Release and Monitoring of Cell Cycle Progression
<ol>
	<li>Thymidine- and nocodazole-based (Thy-Noc) synchronization and release of U2OS cells from Mitosis
	<ol>
		<li>Prepare required cell culture medium. U2OS cells are routinely grown in DMEM-Glutamine medium complemented with 10% (vol/vol) FBS (optional: 1% penicillin/streptomycin). Perform all the medium preparation and manipulation under sterile conditions and warm up complemented medium (from now on referred to as &#3...

<ol>
	<li>Beato, M., S&#225;nchez-Aguilera, A., Piris, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+cycle+deregulation+in+B-cell+lymphomas.">Cell cycle deregulation in B-cell lymphomas.</a> Blood. 101 (4), 1220-1235 (2003).</li><li>Chen, H. Z., Tsai, S. Y., Leone, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+roles+of+E2Fs+in+cancer:+an+exit+from+cell+cycle+control.">Emerging roles of E2Fs in cancer: an exit from cell cycle control.</a> Nat Rev Cancer. 9 (11), 785-797 (2009).</li><li>Cho, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+regulation+and+function+during+the+human+cell+cycle.">Transcriptional regulation and function during the human cell cycle.</a> Nat Genet. 27 (1), 48-54 (2001).</li><li>Pe&#241;a-Diaz, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+profiling+during+the+cell+cycle+shows+that+a+subset+of+Polycomb-targeted+genes+is+upregulated+during+DNA+replication.">Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication.</a> Nucleic Acids Res. 41 (5), 2846-2856 (2013).</li><li>Grant, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+cell+cycle-regulated+genes+periodically+expressed+in+U2OS+cells+and+their+regulation+by+FOXM1+and+E2F+transcription+factors.">Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors.</a> Mol Biol Cell. 24 (23), 3634-3650 (2013).</li><li>Minderman, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+irinotecan-induced+changes+in+expression+profiles+of+cell+cycle+and+apoptosis-associated+genes+in+acute+myeloid+leukemia+cells.">In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells.</a> Mol Cancer Ther. 4 (6), 885-900 (2005).</li><li>McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Persistent+DNA+damage+caused+by+low+levels+of+mitomycin+C+induces+irreversible+cell+senescence.">Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence.</a> Cell Cycle. 11 (16), 3132-3140 (2012).</li><li>Infante, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2F2+represses+cell+cycle+regulators+to+maintain+quiescence.">E2F2 represses cell cycle regulators to maintain quiescence.</a> Cell Cycle. 7 (24), 3915-3927 (2008).</li><li>Cecchini, M. J., Amiri, M., Dick, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+cycle+position+in+mammalian+cells.">Analysis of cell cycle position in mammalian cells.</a> J Vis Exp. (59), (2012).</li><li>Schorl, C., Sedivy, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+cycle+phases+and+progression+in+cultured+mammalian+cells.">Analysis of cell cycle phases and progression in cultured mammalian cells.</a> Methods. 41 (2), 143-150 (2007).</li><li>Lalande, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reversible+arrest+point+in+the+late+G1+phase+of+the+mammalian+cell+cycle.">A reversible arrest point in the late G1 phase of the mammalian cell cycle.</a> Exp Cell Res. 186 (2), 332-339 (1990).</li><li>Park, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mimosine+arrests+the+cell+cycle+prior+to+the+onset+of+DNA+replication+by+preventing+the+binding+of+human+Ctf4/And-1+to+chromatin+via+Hif-1&#945;+activation+in+HeLa+cells.">Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1&#945; activation in HeLa cells.</a> Cell Cycle. 11 (4), 761-766 (2012).</li><li>Ikegami, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aphidicolin+prevents+mitotic+cell+division+by+interfering+with+the+activity+of+DNA+polymerase-alpha.">Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha.</a> Nature. 275 (5679), 458-460 (1978).</li><li>Baranovskiy, A. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+inhibition+of+DNA+replication+by+aphidicolin.">Structural basis for inhibition of DNA replication by aphidicolin.</a> Nucleic Acids Res. 42 (22), 14013-14021 (2014).</li><li>Adams, R. L., Lindsay, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hydroxyurea+reversal+of+inhibition+and+use+as+a+cell-synchronizing+agent.">Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent.</a> J Biol Chem. 242 (6), 1314-1317 (1967).</li><li>Mitxelena, J., Apraiz, A., Vallejo-Rodr&#237;guez, J., Malumbres, M., Zubiaga, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2F7+regulates+transcription+and+maturation+of+multiple+microRNAs+to+restrain+cell+proliferation.">E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation.</a> Nucleic Acids Res. , (2016).</li><li>Bootsma, D., Budke, L., Vos, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+synchronous+division+of+tissue+culture+cells+initiated+by+excess+thymidinE.">Studies on synchronous division of tissue culture cells initiated by excess thymidinE.</a> Exp Cell Res. 33, 301-309 (1964).</li><li>Galgano, P. J., Schildkraut, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=G1/S+Phase+Synchronization+using+Double+Thymidine+Synchronization.">G1/S Phase Synchronization using Double Thymidine Synchronization.</a> CSH Protoc. (2), (2006).</li><li>Edwin Taylor, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetics+of+inhibition+and+the+binding+of+h3-colchicine.">Kinetics of inhibition and the binding of h3-colchicine.</a> J Cell Biol. 25, 145-160 (1965).</li><li>Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+large+numbers+of+mitotic+mammalian+cells+by+use+of+the+reversible+microtubule+inhibitor+nocodazole.+Nocodazole+accumulated+mitotic+cells.">Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells.</a> Exp Cell Res. 126 (2), 397-405 (1980).</li><li>Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enrichment+of+cell+populations+in+metaphase,+anaphase,+and+telophase+by+synchronization+using+nocodazole+and+blebbistatin:+a+novel+method+suitable+for+examining+dynamic+changes+in+proteins+during+mitotic+progression.">Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression.</a> Eur J Cell Biol. 91 (5), 413-419 (2012).</li><li>Nolan, T., Hands, R. E., Bustin, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+mRNA+using+real-time+RT-PCR.">Quantification of mRNA using real-time RT-PCR.</a> Nat Protoc. 1 (3), 1559-1582 (2006).</li><li>Thornton, B., Basu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+(qPCR)+primer+design+using+free+online+software.">Real-time PCR (qPCR) primer design using free online software.</a> Biochem Mol Biol Educ. 39 (2), 145-154 (2011).</li><li>Abbas, T., Dutta, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p21+in+cancer:+intricate+networks+and+multiple+activities.">p21 in cancer: intricate networks and multiple activities.</a> Nat Rev Cancer. 9 (6), 400-414 (2009).</li><li>Kung, A. L., Sherwood, S. W., Schimke, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-specific+differences+in+the+control+of+cell+cycle+progression+in+the+absence+of+mitosis.">Cell line-specific differences in the control of cell cycle progression in the absence of mitosis.</a> Proc Natl Acad Sci U S A. 87 (24), 9553-9557 (1990).</li><li>Borel, F., Lacroix, F. B., Margolis, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prolonged+arrest+of+mammalian+cells+at+the+G1/S+boundary+results+in+permanent+S+phase+stasis.">Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis.</a> J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).</li><li>Knehr, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+critical+appraisal+of+synchronization+methods+applied+to+achieve+maximal+enrichment+of+HeLa+cells+in+specific+cell+cycle+phases).">A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases).</a> Exp Cell Res. 217 (2), 546-553 (1995).</li><li>Zhu, W., Giangrande, P. H., Nevins, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2Fs+link+the+control+of+G1/S+and+G2/M+transcription.">E2Fs link the control of G1/S and G2/M transcription.</a> EMBO J. 23 (23), 4615-4626 (2004).</li><li>Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+control+of+S+phase+of+the+cell+cycle+by+ubiquitin-conjugating+enzyme+H7.">Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7.</a> Mol Biol Cell. 20 (1), 1-9 (2009).</li><li>Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bora+and+Aurora-A+continue+to+activate+Plk1+in+mitosis.">Bora and Aurora-A continue to activate Plk1 in mitosis.</a> J Cell Sci. 127, 801-811 (2014).</li><li>Thomas, D. B., Lingwood, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+model+of+cell+cycle+control:+effects+of+thymidine+on+synchronous+cell+cultures.">A model of cell cycle control: effects of thymidine on synchronous cell cultures.</a> Cell. 5 (1), 37-42 (1975).</li><li>Whitfield, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+genes+periodically+expressed+in+the+human+cell+cycle+and+their+expression+in+tumors.">Identification of genes periodically expressed in the human cell cycle and their expression in tumors.</a> Mol Biol Cell. 13 (6), 1977-2000 (2002).</li><li>Lim, S., Cdks Kaldis, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cyclins+and+CKIs:+roles+beyond+cell+cycle+regulation.">cyclins and CKIs: roles beyond cell cycle regulation.</a> Development. 140 (15), 3079-3093 (2013).</li><li>Tapia, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+mitosis-specific+antibodies,+MPM-2+and+phospho-histone+H3+(Ser28),+allow+rapid+and+precise+determination+of+mitotic+activity.">Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity.</a> Am J Surg Pathol. 30 (1), 83-89 (2006).</li><li>Andreassen, P. R., Martineau, S. N., Margolis, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+induction+of+mitotic+checkpoint+override+in+mammalian+cells+results+in+aneuploidy+following+a+transient+tetraploid+state.">Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state.</a> Mutat Res. 372 (2), 181-194 (1996).</li><li>Wei, F., Xie, Y., He, L., Tao, L., Tang, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERK1+and+ERK2+kinases+activate+hydroxyurea-induced+S-phase+checkpoint+in+MCF7+cells+by+mediating+ATR+activation.">ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation.</a> Cell Signal. 23 (1), 259-268 (2011).</li><li>Kubota, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+prereplication+complex+is+blocked+by+mimosine+through+reactive+oxygen+species-activated+ataxia+telangiectasia+mutated+(ATM)+protein+without+DNA+damage.">Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage.</a> J Biol Chem. 289 (9), 5730-5746 (2014).</li><li>Hartwell, L. H., Weinert, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Checkpoints:+controls+that+ensure+the+order+of+cell+cycle+events.">Checkpoints: controls that ensure the order of cell cycle events.</a> Science. 246 (4930), 629-634 (1989).</li><li>St-Denis, N. A., Derksen, D. R., Litchfield, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+regulation+of+mitotic+progression+through+temporal+phosphorylation+and+dephosphorylation+of+CK2alpha.">Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha.</a> Mol Cell Biol. 29 (8), 2068-2081 (2009).</li><li>Min, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RAD51C-deficient+cancer+cells+are+highly+sensitive+to+the+PARP+inhibitor+olaparib.">RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib.</a> Mol Cancer Ther. 12 (6), 865-877 (2013).</li></ol>

Analysis of fine-tune regulated genes involved in transient and specific roles in the cell cycle requires a uniform cell population. Many researchers routinely use long-established tumor cell lines for these purposes, and a variety of methods have been developed to obtain synchronous (or partially synchronous) cell populations, with the aim to accumulate as many cells as possible in defined cell cycle phases. Moreover, strong efforts have been undertaken to improve and optimize well-established synchronization approaches...

Transition through all the phases of the cell cycle is coupled to a tightly regulated gene expression program. This coordinated &#34;on and off&#34; of gene transcription throughout the cell cycle is believed to be under the control of complex transcriptional regulatory systems, regulating not just the timing but also the levels of gene expression. Deregulation of key cell cycle components is known to contribute to the development of several diseases and is a well- established hallmark of tumorigenesis1,2. Genome-wide transcriptomic analyses carried out in yeast and mammalian cells have revealed that a large number of genes exhibit periodic gene expression patterns in the cell cycle, suggesting that transcriptional fluctuation during the cell cycle is a reflection of the temporal requirement of a given gene product in a precise phase3,4,5.
A major task in the study of cell cycle-regulated gene expression is the synchronization of cells into specific cell cycle phases. Cell synchronization helps to interpret association of a gene expression pattern to a particular cell cycle phase transition, and it has led to a better understanding of the regulation and function of numerous genes. Cell synchronization is also important for studying the mechanism of action of anticancer drugs, as chemotherapeutic agents are known to affect both gene expression as well as cell cycle kinetics6,7. Nevertheless, it is often difficult to determine whether gene expression differences resulting from treatment with these agents are a direct response to the treatment or are merely the consequence of changes in cell cycle profiles. To distinguish between these possibilities, gene expression should be analyzed in cells that have been synchronized prior to addition of the chemotherapeutic drug.
With the exception of some primary cells such as freshly isolated lymphoid cells -which constitute a homogeneous cell population synchronized in G08-, in vitro established cell lines grow asynchronously in culture. Under regular growth conditions, these asynchronously cycling cells are found in all phases of the cell cycle but, preferentially in G19. Therefore, this context does not provide an optimal scenario for functional or gene expression analyses in a specific cell cycle phase (e.g. G1, S etc.). Non-transformed immortalized cell lines (e.g. fibroblasts) can be synchronized with so-called physiological methods10. These methods are based on the retained primary cell features of non-transformed cells, such as cell-contact inhibition and growth factor dependency in order to continue cycling. Removal of serum in combination with contact inhibition renders non-transformed cells arrested at G0/G1. However, synchronized cell cycle entry and progression often requires subculture, which also involves artificial detachment of the cells and re-plating10. Most importantly, this method is not suitable for synchronization of transformed cell lines, the vast majority of established cell lines presently in use, characterized for lacking cell contact-mediated growth inhibition or response to growth factor withdrawal. Thus, it is clear that alternative methods are required for efficient cell synchronization in specific phases of the cell cycle. In general terms, the most frequently used synchronization methods are based on transient chemical or pharmacological inhibition of one defined point of the cell cycle, typically DNA synthesis or mitotic spindle formation. Inhibition of DNA synthesis synchronizes cells by arresting them in late G1 or early S phase. This can be achieved by the addition of compounds such as mimosine, an inhibitor of nucleotide biosynthesis11,12, aphidicolin, an inhibitor of DNA polymerases13,14, hydroxyurea, an inhibitor of ribonucleotide reductase15,16 or by excess amounts of thymidine17,18. On the other hand, inhibitors of microtubule polymerization, such as colchicine or nocodazole, are able to block mitotic spindle formation leading to cell synchronization at early M phase19,20,21.
In this work we describe a method involving two complementary synchronization protocols based on transient chemical inhibition for studying the expression of cell cycle-regulated genes at the mRNA level. This method is fundamental for defining the role of cell cycle genes in specific cell cycle processes. Furthermore, it provides a general frame for studying the impact of anticancer treatments in order to accurately detect drug responsive genes and to minimize misinterpretations derived from perturbations in cell cycle progression generated by these drugs.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>DMEM, high glucose, GutaMAX supplement</td>
			<td>Thermo Fisher Scientific</td>
			<td>61965-059</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS, qualified, E.U.-approved, South America origin</td>
			<td>Thermo Fisher Scientific</td>
			<td>10270-106</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin (10,000 U/mL)</td>
			<td>Thermo Fisher Scientific</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>0.25% Trypsin-EDTA (1X), phenol red</td>
			<td>Thermo Fisher Scientific</td>
			<td>25200-072</td>
			<td></td>
		</tr>
		<tr>
			<td>Thymidine</td>
			<td>SIGMA</td>
			<td>T1895-5G</td>
			<td>Freshly prepared. Slight warming might help dissolve thymidine.</td>
		</tr>
		<tr>
			<td>Nocodazole</td>
			<td>SIGMA</td>
			<td>M-1404</td>
			<td>Stock solution in DMSO stored at -20 &#186;C in small aliquots</td>
		</tr>
		<tr>
			<td>Hydroxyurea</td>
			<td>SIGMA</td>
			<td>H8627</td>
			<td>Freshly prepared</td>
		</tr>
		<tr>
			<td>Mitomycin C from Streptomyces caespitosus</td>
			<td>SIGMA</td>
			<td>M4287</td>
			<td>1.5mM stock solution in sterile H2O protected from light and stored at 4&#186;C</td>
		</tr>
		<tr>
			<td>Dimethyl sulfoxide</td>
			<td>SIGMA</td>
			<td>D2650</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium iodide</td>
			<td>SIGMA</td>
			<td>P4170</td>
			<td>Stock solution in sterile PBS at 5 mg/ml, stored at 4&#186; C protected from light.</td>
		</tr>
		<tr>
			<td>PBS pH 7.6</td>
			<td></td>
			<td></td>
			<td>Home made</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>PANREAC</td>
			<td>A3678,2500</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>SIGMA</td>
			<td>C2432</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Citrate</td>
			<td>PANREAC</td>
			<td>131655</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>SIGMA</td>
			<td>T8787</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAse A</td>
			<td>Thermo Fisher Scientific</td>
			<td>EN0531</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>LifeTechnologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>QIAGEN</td>
			<td>74106</td>
			<td></td>
		</tr>
		<tr>
			<td>High-Capacity cDNA Reverse Transcription Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>4368814</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-Cyclin E1 antibody</td>
			<td>Cell Signaling</td>
			<td>4129</td>
			<td>1:1000 dilution in 5% milk, o/n, 4 &#186;C</td>
		</tr>
		<tr>
			<td>Anti-Cyclin B1 antibody</td>
			<td>Cell Signaling</td>
			<td>4135</td>
			<td>1:1000 dilution in 5% milk, o/n, 4 &#186;C</td>
		</tr>
		<tr>
			<td>Anti-&#946;-actin</td>
			<td>SIGMA</td>
			<td>A-5441</td>
			<td>1:3000 dilution in 5 % milk, 1 hr, RT</td>
		</tr>
		<tr>
			<td>Anti-pH3 (Ser 10) antiboty</td>
			<td>Millipore</td>
			<td>06-570</td>
			<td>Specified in the protocol</td>
		</tr>
		<tr>
			<td>Secondary anti-rabbit AlexaFluor 488 antibody</td>
			<td>Invitrogen</td>
			<td>R37116</td>
			<td>Specified in the protocol</td>
		</tr>
		<tr>
			<td>Secondary anti-mouse-HRP antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-3697</td>
			<td>1:3000 dilution in 5 % milk, 1 hr, RT</td>
		</tr>
		<tr>
			<td>Forward E2F1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; TGACATCACCAACGTCCTTGA</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse E2F1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; CTGTGCGAGGTCCTGGGTC</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward E2F7 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; GGAAAGGCAACAGCAAACTCT</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse E2F7 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; TGGGAGAGCACCAAGAGTAGAAGA</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward p21Cip1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; AGCAGAGGAAGACCATGTGGAC</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse p21Cip1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; TTTCGACCCTGAGAGTCTCCAG</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward TBP antibody (human) reference gene&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse TBP antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward Oxa1L antibody (human) reference gene&#160;&#160; CACTTGCCAGAGATCCAGAAG&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse Oxa1L &#160;antibody (human)&#160;&#160;&#160; CACAGGGAGAATGAGAGGTTTATAG&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Power SYBRGreen PCR Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>4368702</td>
			<td></td>
		</tr>
		<tr>
			<td>FACS Tubes&#160;</td>
			<td>Sarstedt</td>
			<td>551578</td>
			<td></td>
		</tr>
		<tr>
			<td>MicroAmp Optical 96-Well Reaction Plate</td>
			<td>Thermo Fisher Scientific</td>
			<td>N8010560</td>
			<td></td>
		</tr>
		<tr>
			<td>Corning 100mm TC-Treated Culture Dish</td>
			<td>Corning</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Corning Costar cell culture plates 6 well</td>
			<td>Corning</td>
			<td>3506</td>
			<td></td>
		</tr>
		<tr>
			<td>Refrigerated Bench-Top Microcentrifuge</td>
			<td>Eppendorf</td>
			<td>5415 R</td>
			<td></td>
		</tr>
		<tr>
			<td>Refrigerated Bench-Top Centrifuge Jouan CR3.12</td>
			<td>Jouan</td>
			<td>743205604</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop Lite Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>ND-LITE-PR</td>
			<td></td>
		</tr>
		<tr>
			<td>BD FACSCalibur Flow Cytometer</td>
			<td>BD Bioscience</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>QuantStudio 3 Real-Time PCR System</td>
			<td>Thermo Fisher Scientific</td>
			<td>A28567</td>
			<td></td>
		</tr>
	</tbody>
</table>

studying cell cycle-regulated gene expression by two complementary cell synchronization protocols

The gene expression program of the cell cycle represents a critical step for understanding cell cycle-dependent processes and their role in diseases such as cancer. Cell cycle-regulated gene expression analysis depends on cell synchronization into specific phases. Here we describe a method utilizing two complementary synchronization protocols that is commonly used for studying periodic variation of gene expression during the cell cycle. Both procedures are based on transiently blocking the cell cycle in one defined point. The synchronization protocol by hydroxyurea (HU) treatment leads to cellular arrest in late G1/early S phase, and release from HU-mediated arrest provides a cellular population uniformly progressing through S and G2/M. The synchronization protocol by thymidine and nocodazole (Thy-Noc) treatment blocks cells in early mitosis, and release from Thy-Noc mediated arrest provides a synchronized cellular population suitable for G1 phase and S phase-entry studies. Application of both procedures requires monitoring of the cell cycle distribution profiles, which is typically performed after propidium iodide (PI) staining of the cells and flow cytometry-mediated analysis of DNA content. We show that the combined use of two synchronization protocols is a robust approach to clearly determine the transcriptional profiles of genes that are differentially regulated in the cell cycle (i.e. E2F1 and E2F7), and consequently to have a better understanding of their role in cell cycle processes. Furthermore, we show that this approach is useful for the study of mechanisms underlying drug-based therapies (i.e. mitomycin C, an anticancer agent), because it allows to discriminate genes that are responsive to the genotoxic agent from those solely affected by cell cycle perturbations imposed by the agent.

Schematic representation of Thy-Noc and HU-based protocols for cell synchronization.
Figure 1 summarizes the steps required for U2OS cell synchronization and subsequent sample collection in order to verify progression through the cell cycle and to perform gene expression analyses.
Phospho-H3 and PI staining are good evaluation parameters to select synchroniz...

Watch this Scientific Journal Video about Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols at JoVE.com

Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols

We report two cell synchronization protocols that provide a context for studying events related to specific phases of the cell cycle. We show that this approach is useful for analyzing the regulation of specific genes in an unperturbed cell cycle or upon exposure to agents affecting the cell cycle.

The gene expression program of the cell cycle represents a critical step for understanding cell cycle-dependent processes and their role in diseases such ...

The overall goal of this protocol is to provide a context for the analysis of gene expression in a cell-cycle specific manner. This method can help answer key questions in the cancer field related to cell-cycle dependent transcriptional events that underlie malignant transformation as well as anti-cancer treatment. The main advantage of this protocol is that it establishes with accuracy cell-cycle phase specific gene expression patterns both in number two conditions and after exposure to chemotherapy.U2OS cells are used for this experiment, and should be seeded in 100 millimeter dishes in the evening around seven p.m. so that subsequent steps can be carried out during working hours. Let cells attach by incubating the dishes at 37 degrees celsius in a humidified atmosphere with 5%CO2 for 24 hours.On the following day examine the cells to confirm that they are at 50%confluency. For the Thymidine block, add 100 microliters of a freshly prepared 200 millimolar thymidine stock to each 100 millimeter culture dish. Incubate the cells with Thymidine at 37 degrees celsius in a humidified atmosphere with 5%CO2 for 20 hours.On the following day, at about three p.m. release cells from the Thymidine block by removing Thymidine containing growth medium. Wash cells twice with pre-warmed 1X PBS.And then add 10 milliliters of complete medium to each 100 millimeter dish. Incubate cells at 37 degrees celsius for five hours. For mitotic cell arrest add nocodazole to a final concentration of 50 nanograms per milliliter.Incubate cells with nocodazole for no longer than 10 to 11 hours. On the following morning, between six and seven a.m. check the cells under the microscope to confirm that they are indeed blocked in G2-M, indicated by their rounded appearance.Detach mitotic cells by shaking each plate, and gently pipetting nocodazole containing growth medium with detached cells from each 100 millimeter plate. Combine mitotic cells from all dishes into a 50 millileter sterile tube. Centrifuge 300 times g for five minutes at four degrees celsius.Wash cells twice by adding cold 1X PBS, followed by centrifugation. After removing the PBS from the second wash, re-suspend mitotic cells in complete culture medium. Save two milliliters for RNA extraction, and two milliliters for FACS analysis for the zero hour time point.Re-plate remaining mitotic cells for subsequent time points in six well plates. To begin this procedure, seed 0.25 times 10 to the sixth U2OS cells per well in six well plates. On the cover of each six well plate write the experimental condition for each well.For example, untreated or treated with different concentration of drug and time points. Let cells attach by incubating the six well plates overnight. On the following morning examine the cells to confirm that they are at 50%confluency.Remove complete medium from the wells, and add two milliliters of pre-warmed, FBS free DMEM-Glutamine medium per well. Incubate the cells for an additional 24 hours. To arrest cells with hydroxyurea, remove medium from the wells, and replace with freshly prepared four micromolar hydroxyurea containing complete medium.Incubate cells in hydroxyurea containing medium for 24 hours. Prior to releasing cells from hydroxyurea mediated arrest, check the cells to confirm that they are arrested. Remove hydroxyurea containing medium from wells, and rinse wells twice with pre-warmed 1X PBS.After removing the PBS from the second wash, add two milliliters of complete medium per well. Keep the plates in the incubator until sample collection. Samples from both synchronization protocols are collected in the same way for FACS analysis and for RNA extraction.For FACS analysis, rinse each well with two milliliters of pre-warmed 1X PBS, and then add 0.3 milliliters of pre-warmed Trypsin-EDTA solution to detach the cells. After five minutes, inactivate Trypsin-EDTA by adding one milliliter of complete medium. Collect each sample in a separate 15 milliliter tube.Centrifuge cells at 300 times G at room temperature for five minutes. Discard the supernatant, wash with 1X PBS and spin again. Remove the PBS and save the cellular pellet.In order to fix cells, re-suspend each cellular pellet in one milliliter of chilled 70%ethanol by gently vortexing. Place the cells on ice for approximately 15 minutes prior to propidium iodide staining and FACS analysis. For RNA extraction remove the medium and rinse each well with two milliliters of pre-warmed 1X PBS.Take the plate to a safety cabinet, and add one milliliter of suitable RNA isolation reagent per well. Pipet up and down to pipet and lyse the cells and then transfer each cell lysate to a 1.5 milliliter microcentrifuge tube. Incubate at room temperature for five minutes.Start the RNA extraction procedure by retrieving from the freezer the microcentrifuge tubes with samples in RNA isolation reagent, and thawing them at room temperature inside a safety cabinet for chemicals. Add 400 microliters of chloroform to each sample and shake vigorously without vortexing until completely mixed. Incubate the samples at room temperature for five minutes.Centrifuge the tubes for 15 minutes in a bench top microcentrifuge. Transfer the aqueous phase of each sample to a new 1.5 milliter microcentrifuge tube. Add one volume of 100%ethanol slowly, drop by drop, to the aqueous phase while mixing.Do not centrifuge. Transfer up to 700 microliters of each sample including any precipitate that may have formed into a spin column in a two milliliter collection tube provided by a commercial RNA mini-prep kit, and close the lid. Centrifuge for 15 seconds.Discard the flow-through. If starting from more than 700 microliters per sample, transfer the remaining sample into the spin column, and centrifuge again. After washing the RNA per the manufacturer's instructions, elute each sample by pipetting 30 to 40 microliters of nuclease free water into the spin column, and centrifuging at room temperature for one minute.Determine RNA concentration and purity of samples by absorbance measurements. Store the RNA samples at minus 80 degrees celsius until use for gene expression analysis. Treatment by the Thymidine-Nocodazole protocol arrests U2OS cells in m-phase entry, and provides a cell population that progresses synchronously through G1 and into S phase as shown by flow cytometry analysis.Treatment by the Hydroxyurea protocol arrests cells at the G1/S boundary. Upon release, cells transition synchronously through S and G2 phases. The Thymidine-Nocodazole protocol is most suitable for analysing mRNA profiles of genes with peak expression during G1 phase.As shown for E2F1 expression. By contrast, the Hydroxyurea protocol works better for the analysis of genes with preferential expression in S or G2, as illustrated for E2F7 expression. The cell-cycle is typically perturbed by anti-tumor drugs, shown is a mitomycin C imposed permanent G2 phase arrest in hydroxyurea synchronized cells.Cell sychronization helps discriminate genes that are responsive to the anti-tumor agent from those that are solely affected by cell-cycle perturbations imposed by the agent, for example, a reduction in E2F1 mRNA levels after mitomycin C treatment is likely an indirect affect of the drug on cell-cycle dynamics. By contrast, the peak of p21-Cip1 mRNA expression after mitomycin C treatment is directly the result of a transcriptional program triggered by this drug. Following this procedure genome wide transcriptomic as well as proteomic analysis can be performed, in order to unravel global gene expression changes affecting a specific cell-cycle phases.Either in number two conditions or upon anti-tumor treatments. After watching this video, you should have a good understanding of the procedures that are required to perform gene expression analysis in synchronized cell cultures. Don't forget that working with propidium iodide or RNA isolation reagents can be extremely hazardous and precautions such as gloves and safety cabinet for chemicals should always be taken while performing this procedure.

studying-cell-cycle-regulated-gene-expression-two-complementary-cell

Research

Education

JoVE Journal

JoVE Core

Biology

Genetics

Cellular Processes

Cell Cycle and Division

SCIENTISTS IN ACTION

Parallel Measurement of Circadian Clock Gene Expression and Hormone Secretion in Human Primary Cell Cultures

Circadian clocks are functional in all light-sensitive organisms, allowing for an adaptation to the external world by anticipating daily environmental changes. Considerable progress in our understanding of the tight connection between the circadian clock and most aspects of physiology has been made in the field over the last decade. However, unraveling the molecular basis that underlies the function of the circadian oscillator in humans stays of highest technical challenge. Here, we provide a detailed description of an experimental approach for long-term (2-5 days) bioluminescence recording and outflow medium collection in cultured human primary cells. For this purpose, we have transduced primary cells with a lentiviral luciferase reporter that is under control of a core clock gene promoter, which allows for the parallel assessment of hormone secretion and circadian bioluminescence. Furthermore, we describe the conditions for disrupting the circadian clock in primary human cells by transfecting siRNA targeting CLOCK. Our results on the circadian regulation of insulin secretion by human pancreatic islets, and myokine secretion by human skeletal muscle cells, are presented here to illustrate the application of this methodology. These settings can be used to study the molecular makeup of human peripheral clocks and to analyze their functional impact on primary cells under physiological or pathophysiological conditions.

Here, we describe settings to monitor in parallel circadian bioluminescence and the secretory activity of human islet cells and primary myotubes. For this, we employed lentiviral gene delivery of a luciferase core clock reporter, followed by in vitro synchronization and collection of outflow medium by continuous cell perifusion.

Circadian clocks are functional in all light-sensitive organisms, allowing for an adaptation to the external world by anticipating daily environmental ...

Single-cell Gene Expression Using Multiplex RT-qPCR to Characterize Heterogeneity of Rare Lymphoid Populations

Gene expression heterogeneity is an interesting feature to investigate in lymphoid populations. Gene expression in these cells varies during cell activation, stress, or stimulation. Single-cell multiplex gene expression enables the simultaneous assessment of tens of genes1,2,3. At the single-cell level, multiplex gene expression determines population heterogeneity4,5. It allows for the distinction of population heterogeneity by determining both the probable mix of diverse precursor stages among mature cells and also the diversity of cell responses to stimuli.
Innate lymphoid cells (ILC) have been recently described as a population of innate effectors of the immune response6,7. In this protocol, cell heterogeneity of the ILC hepatic compartment is investigated during homeostasis.
Currently, the most widely used technique to assess gene expression is RT-qPCR. This method measures gene expression only one gene at a time. Additionally, this method cannot estimate heterogeneity of gene expression, since multiple cells are needed for one test. This leads to the measurement of the average gene expression of the population. When assessing large numbers of genes, RT-qPCR becomes a time-, reagent-, and sample-consuming method. Hence, the trade-offs limit the number of genes or cell populations that can be evaluated, increasing the risk of missing the global picture.
This manuscript describes how single-cell multiplex RT-qPCR can be used to overcome these limitations. This technique has benefited from recent microfluidics technological advances1,2. Reactions occurring in multiplex RT-qPCR chips do not exceed the nanoliter-level. Hence, single-cell gene expression, as well as simultaneous multiple gene expression, can be performed in a reagent-, sample-, and cost-effective manner. It is possible to test cell gene signature heterogeneity at the clonal level between cell subsets within a population at different developmental stages or under different conditions4,5. Working on rare populations with large numbers of conditions at the single-cell level is no longer a restriction.

This protocol describes how to assess the expression of a large array of genes at the clonal level. Single-cell RT-qPCR produces highly reliable results with a strong sensitivity for hundreds of samples and genes.

Gene expression heterogeneity is an interesting feature to investigate in lymphoid populations. Gene expression in these cells varies during cell ...

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative without tools to study gene function. The development and sharing of detailed protocols for the establishment of new model systems in laboratories, and for tools to carry out functional studies, is thus crucial for leveraging the power of genomics. Coleoptera (beetles) are the largest clade of insects and occupy virtually all types of habitats on the planet. In addition to providing ideal models for fundamental research, studies of beetles can have impacts on pest control as they are often pests of households, agriculture, and food industries. Detailed protocols for rearing and maintenance of D. maculatus laboratory colonies and for carrying out dsRNA-mediated interference in D. maculatus are presented. Both embryonic and parental RNAi procedures-including apparatus set up, preparation, injection, and post-injection recovery-are described. Methods are also presented for analyzing embryonic phenotypes, including viability, patterning defects in hatched larvae, and cuticle preparations for unhatched larvae. These assays, together with in situ hybridization and immunostaining for molecular markers, make D. maculatus an accessible model system for basic and applied research. They further provide useful information for establishing procedures in other emerging insect model systems.

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Here, we present protocols for rearing an intermediate-germ beetle, Dermestes maculatus (D. maculatus) in the lab. We also share protocols for embryonic and parental RNAi and methods for analyzing embryonic phenotypes to study gene function in this species.

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative ...

Single-cell Gene Expression Profiling Using FACS and qPCR with Internal Standards

Gene expression measurements from bulk populations of cells can obscure the considerable transcriptomic variation of individual cells within those populations. Single-cell gene expression measurements can help assess the role of noise in gene expression, identify correlations in the expression of pairs of genes, and reveal subpopulations of cells that respond differently to a stimulus. Here, we describe a procedure to measure the expression of up to 96 genes in single mammalian cells isolated from a population growing in tissue culture. Cells are sorted into lysis buffer by fluorescence-activated cell sorting (FACS), and the mRNA species of interest are reverse-transcribed and amplified. Gene expression is then measured using a microfluidic real-time PCR machine, which performs up to 96 qPCR assays on up to 96 samples at a time. We also describe the generation and use of PCR amplicon standards to enable the estimation of the absolute number of each transcript. Compared with other methods of measuring gene expression in single cells, this approach allows for the quantification of more distinct transcripts than RNA FISH at a lower cost than RNA-Seq.

We describe a method to sort single mammalian cells and to quantify the expression of up to 96 target genes of interest in each cell. This method includes the use of internal qPCR standards to enable the estimation of absolute transcript counts.

Gene expression measurements from bulk populations of cells can obscure the considerable transcriptomic variation of individual cells within those ...

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide RNA (sgRNA) that confers specificity, the Cas9 protein cleaves both DNA strands at the targeted locus. The DNA break can trigger either non-homologous end joining (NHEJ) or homology directed repair (HDR). NHEJ can introduce small deletions or insertions which lead to frame-shift mutations, while HDR allows for larger and more precise perturbations. Here, we present protocols for generating knockout cell lines by coupling established CRISPR/Cas9 methods with two options for downstream selection/screening. The NHEJ approach uses a single sgRNA cut site and selection-independent screening, where protein production is assessed by dot immunoblot in a high-throughput manner. The HDR approach uses two sgRNA cut sites that span the gene of interest. Together with a provided HDR template, this method can achieve deletion of tens of kb, aided by the inserted selectable resistance marker. The appropriate applications and advantages of each method are discussed.

Recent advances in the ability to genetically manipulate somatic cell lines hold great potential for basic and applied research. Here, we present two approaches for CRISPR/Cas9 generated knockout production and screening in mammalian cell lines, with and without the use of selectable markers.

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV integration sites can be used as functional markers of active regulatory elements. Here, we present a retroviral scanning tool, which allows the genome-wide identification of cell-specific enhancers and promoters. Briefly, the target cell population is transduced with an mLV-derived vector and genomic DNA is digested with a frequently cutting restriction enzyme. After ligation of genomic fragments with a compatible DNA linker, linker-mediated polymerase chain reaction (LM-PCR) allows the amplification of the virus-host genome junctions. Massive sequencing of the amplicons is used to define the mLV integration profile genome-wide. Finally, clusters of recurrent integrations are defined to identify cell-specific regulatory regions, responsible for the activation of cell-type specific transcriptional programs.
The retroviral scanning tool allows the genome-wide identification of cell-specific promoters and enhancers in prospectively isolated target cell populations. Notably, retroviral scanning represents an instrumental technique for the retrospective identification of rare populations (e.g. somatic stem cells) that lack robust markers for prospective isolation.

Here, we describe a protocol for genome-wide mapping of the integration sites of Moloney murine leukemia virus-based retroviral vectors in human cells.

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

Quantification of Information Encoded by Gene Expression Levels During Lifespan Modulation Under Broad-range Dietary Restriction in C. elegans

Sensory systems allow animals to detect, process, and respond to their environment. Food abundance is an environmental cue that has profound effects on animal physiology and behavior. Recently, we showed that modulation of longevity in the nematode Caenorhabditis elegans by food abundance is more complex than previously recognized. The responsiveness of the lifespan to changes in food level is determined by specific genes that act by controlling information processing within a neural circuit. Our framework combines genetic analysis, high-throughput quantitative imaging and information theory. Here, we describe how these techniques can be used to characterize any gene that has a physiological relevance to broad-range dietary restriction. Specifically, this workflow is designed to reveal how a gene of interest regulates lifespan under broad-range dietary restriction; then to establish how the expression of the gene varies with food level; and finally, to provide an unbiased quantification of the amount of information conveyed by gene expression about food abundance in the environment. When several genes are examined simultaneously under the context of a neural circuit, this workflow can uncover the coding strategy employed by the circuit.

Quantification of Information Encoded by Gene Expression Levels During Lifespan Modulation Under Broad-range Dietary Restriction in C. elegans

Here, we present a framework to relate broad-range dietary restriction to gene expression and lifespan. We describe protocols for broad-range dietary restriction and for quantitative imaging of gene expression under this paradigm. We further outline computational analyses to reveal underlying information processing features of the genetic circuits involved in food-sensing.

Sensory systems allow animals to detect, process, and respond to their environment. Food abundance is an environmental cue that has profound effects on ...

An Optogenetic Method to Control and Analyze Gene Expression Patterns in Cell-to-cell Interactions

Cells should respond properly to temporally changing environments, which are influenced by various factors from surrounding cells. The Notch signaling pathway is one of such essential molecular machinery for cell-to-cell communications, which plays key roles in normal development of embryos. This pathway involves a cell-to-cell transfer of oscillatory information with ultradian rhythms, but despite the progress in molecular biology techniques, it has been challenging to elucidate the impact of multicellular interactions on oscillatory gene dynamics. Here, we present a protocol that permits optogenetic control and live monitoring of gene expression patterns in a precise temporal manner. This method successfully revealed that intracellular and intercellular periodic inputs of Notch signaling entrain intrinsic oscillations by frequency tuning and phase shifting at the single-cell resolution. This approach is applicable to the analysis of the dynamic features of various signaling pathways, providing a unique platform to test a functional significance of dynamic gene expression programs in multicellular systems.

Here, we present a protocol to analyze cell-to-cell transfer of oscillatory information by optogenetic control and live monitoring of gene expression. This approach provides a unique platform to test a functional significance of dynamic gene expression programs in multicellular systems.

Cells should respond properly to temporally changing environments, which are influenced by various factors from surrounding cells. The Notch signaling ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to abiotic stresses and diseases. As the plant microbiome can be highly complex, low-cost, high-throughput methods such as amplicon-based sequencing of the 16S rRNA gene are often preferred for characterizing its microbial composition and diversity. However, the selection of appropriate methodology when conducting such experiments is critical for reducing biases that can make analysis and comparisons between samples and studies difficult. This protocol describes in detail a standardized methodology for the collection and extraction of DNA from soil, rhizosphere, and root samples. Additionally, we highlight a well-established 16S rRNA amplicon sequencing pipeline that allows for the exploration of the composition of bacterial communities in these samples, and can easily be adapted for other marker genes. This pipeline has been validated for a variety of plant species, including sorghum, maize, wheat, strawberry, and agave, and can help overcome issues associated with the contamination from plant organelles.

Here, we describe a protocol to obtain amplicon sequence data of soil, rhizosphere, and root endosphere microbiomes. This information can be used to investigate the composition and diversity of plant-associated microbial communities, and is suitable for the use with a wide range of plant species.

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...