This work was made possible by grants to JK from the Ontario Centres of Excellence and the Ontario Research Fund.
We would like to thank Siddika Pardhan and Dr. Peter Ferguson for technical assistance during filming.

NOTE: The following protocol was designed for use with adherent cells. Modifications are required to apply the method to non-adherent cells grown in suspension. The CAM experiments described in the protocol are designed for use with cells that express a fluorescent marker (e.g., GFP, RFP, etc.). Nine day old chicken embryos are required on day 2 of the experimental protocol for the CAM experiments.
1. Preparation and Transfection of Tumor Cells with Antisense Oligonucleotides (ASOs)
<ol>
	<li>Aspirate medium from T75 flask(s) containing cells of interest, wash with 1XPBS, and add 2 ml of 0.25% trypsin/EDTA. Add 10 ml of complete growth medium to each flask and transfer the cells in solution to a 50 ml tube. Count the cells and adjust the volume so that the final concentration is 1.0x105 cells per ml.</li>
	<li>Label two groups of T25 flasks: one group will contain eight flasks, labeled 1-8, and will be used for the real-time metabolism measurementexperiment; and the second group will also contain 8 flasks and will be used for the chicken embryo CAMexperiment. Add 2 ml of cells in solution to each flask and place in the incubator (37 &#176;C, 5% CO2 O/N).</li>
	<li>The next morning (Day 0, Time 0), label three 5 ml tubes as follows: control (non-targeting ASO or siRNA), &#39;target of interest&#39; (i.e., targeting ASO or siRNA), and Lipofectamine 2000 (or a similar transfection reagent). Dilute the stock ASO solutions to the appropriate concentration with serum free medium in the appropriate tube.
	<ol>
		<li>Add the required amount of transfection reagent to the appropriate tube and incubate in serum-free medium for 5 min. Add the transfection reagent solution to the ASO tubes and incubate for 20 min.</li>
	</ol>
	</li>
	<li>Add 250 &#181;l of control ASO transfection reagent solution to each of flasks 1-4 in each group, and 250 &#181;l of &#39;target of interest&#39; ASO transfection reagent solution to each of flasks 5-8 in each group. Incubate for 4 hr (37 &#7506;C, 5% CO2).
	<ol>
		<li>During incubation, carry out the steps described in section 2.1. After the incubation, add 3 ml of complete medium to each flask in the CAM experiment group and return to the incubator O/N (37 &#7506;C, 5% CO2). Process the metabolismexperiment group according to the description in section 2.2. Process the CAM experiment set according to the description in section 4.</li>
	</ol>
	</li>
</ol>
2. Biosensor Chip Preparation and Cell Seeding
<ol>
	<li>In a sterile environment, carefully wash six biosensor chips with 400 &#181;l of PBS. Sterilize the chips with 400 &#181;l of 70% ethanol for 20 min. Wash three times with 400 &#181;l of PBS.
	<ol>
		<li>Place the chips inside sterile tissue culture dishes to prevent contamination. Place three chips in a dish labeled &#39;control&#39;, and three in a dish labeled &#39;target of interest&#39;.</li>
	</ol>
	</li>
	<li>Label two 50 ml tubes as &#39;control&#39; and &#39;target of interest&#39;. Wash cells with PBS and add an appropriate volume of 0.25% Trypsin/EDTA. Wait until the monolayer detaches and collect the cells from each flask. Deposit the solution into the appropriate tube.
	<ol>
		<li>Count the cells and adjust the volume so that the final concentration is 6.0x105 cells/ml. Centrifuge and resuspend the cells if the initial concentration is too low.</li>
	</ol>
	</li>
	<li>Add 250 &#181;l of the cell solution to each biosensor chip in the appropriate group (for a total of 1.25x105 cells per chip). Perform this task one group at a time to minimize the risk of confusing the chips. Place the sterile dishes containing the chips inside a humidity chamber to prevent evaporation, and place the humidity chamber in the incubator O/N (37 &#7506;C, 5% CO2).</li>
	<li>The next morning (Day 1), carefully aspirate the medium from each chip and replace it with 250 &#181;l of growth medium supplemented with 0.2% fetal bovine serum (FBS) and 1x penicillin and streptomycin (P/S). Incubate for 4 hr (37 &#7506;C, 5% CO2).</li>
</ol>
3. Metabolism Measurement System Preparation and Solution Preparation
<ol>
	<li>During the incubation, prepare the requisite drug solutions and the metabolism measurement system for the upcoming assay. 
	NOTE: The metabolism measurement system contains a total of six modules. Each module accommodates one chip per experiment.
	<ol>
		<li>Subdivide the assay into the following experimental groups: one chip from each of the &#39;control&#39; and &#39;target of interest&#39; groups to receive vehicle for the duration of the assay; two chips from each group to receive drug treatment for a defined period of time during the assay, followed by vehicle during the washout period.</li>
		<li>For drug sensitization studies, modify the length, timing, and concentration of drug treatment to suit the particular drug in question. 
		NOTE: For cisplatin, the following steps were determined empirically with A549 cells, and may vary depending on cell line. Perform all stages with the default flow rate of 4 &#181;l/min. 
		6 hr of growth medium + 0.2% FBS and 1x P/S 
		24 hr of 6 &#181;M cisplatin in medium + 0.2% FBS 1x P/S 
		24 hr of growth medium + 0.2% FBS and 1x P/S 
		18 hr of growth medium + 0.2% FBS and 1x P/S 
		4 hr of 0.1% Triton-X 
		NOTE: Deviations from these steps will require calculation to determine the required volume of medium and drug solutions based on the desired flow rate and duration of experiment. The following sections are based on the steps described above.</li>
	</ol>
	</li>
	<li>Label and fill fourteen 50 ml tubes with 50 ml of growth medium + 0.2% FBS and 1x P/S. Place six in one metabolism measurement system tube rack, six in another, and the remaining two in a third tube rack that also contains tubes with cisplatin. Seal the first two racks with an air permeable membrane to prevent evaporation.</li>
	<li>Prepare a solution of 6 &#181;M cisplatin (of the appropriate volume) in medium + 0.2% FBS with 1x P/S. Dispense the required volume of cisplatin solution into four labeled 50 ml tubes.
	<ol>
		<li>Place the tubes in the remaining four slots in the third metabolism measurement tube rack. Ensure that the tubes are placed in the appropriate slots that correspond to the desired biomodules. Seal the tubes with an air permeable membrane.</li>
	</ol>
	</li>
	<li>Prepare and label six 50 ml tubes and fill them with 20 ml each of 0.1% Triton-X solution in medium. The Triton-X solution will lyse any remaining cells and provide a &#39;zero&#39; value for each chip. Place the tubes in a fourth metabolism measurement unit tube rack and seal with an air permable membrane to prevent excessive evaporation.</li>
	<li>Load the chips into the biomodules and initiate the experiment.</li>
</ol>
4. CAM Experiment Drug Treatment and Injection
NOTE: The steps and procedure for preparing chicken embryos for a CAM experiment are described elsewhere19
<ol>
	<li>Begin processing the CAM experiment 48 hr post-transfection (Day 2). Sub-divide the &#39;control&#39; and &#39;target of interest&#39; groups into two flasks for vehicle, and two for cisplatin. Aspirate the medium from the flasks and replenish with either 3 ml of fresh medium, or 6 &#181;M cisplatin. Incubate for 6 hr (37 &#7506;C, 5% CO2).</li>
	<li>Aspirate the medium, then wash and trypsinize the cells; collect the trypsinized cells in solution into four appropriately labeled 15 ml tubes.
	<ol>
		<li>Centrifuge and wash the cells three times with PBS. Re-suspend the cell pellet in 5 ml of PBS and count the cells.</li>
		<li>Adjust the volume so that the final cell concentration is 1.0x106 cells/ml. Transfer the cell solution into labeled 5 ml tubes for injection, and place on ice. Invert the tubes gently prior to injection to ensure that the cells are well mixed.</li>
	</ol>
	</li>
	<li>Set aside a total of 24 chicken embryos (9 days old) for injection (6 per group). Perform the injection using a glass needle attached to a flexible tube connected to a 1 ml syringe. The individual performing the injection should be blinded to the treatment group.
	<ol>
		<li>Using a stereo microscope, inject 1.0x105 cells in a volume of 100 &#181;l into the venous circulation of the CAM. Use a slow, pulsating technique to inject the full volume of cells. Gently dab the injection site with a soft wipe to stem the flow of blood and absorb any spillage. Label each embryo container appropriately following each injection.</li>
	</ol>
	</li>
	<li>Confirm the presence and distribution of fluorescent cells in the vasculature of the CAM following injection by visualizing them using a fluorescent microscope. Take note of any embryos in which the number of tumor cells appears low, or the distribution is poor.</li>
	<li>Place the chicken embryos in a humidity chamber and store them in an incubator (37 &#176;C, 60% humidity). Wait 7-9 days before enumerating metastatic foci.</li>
</ol>
5. Metastatic Focus Enumeration
<ol>
	<li>During the 7-9 day incubation period, monitor the embryos and discard any dead ones. Ensure that the humidity chamber remains moist at all times during the incubation period.</li>
	<li>Using a fluorescent stereo microscope at 20X magnification, scan the entire upper surface of the embryo CAM in a regular, grid-like pattern.</li>
	<li>Count the number of metastatic foci in each field of view, then tally the number for a final total per embryo. Doing so for the six embryos in each group will provide an average number of metastatic foci per treatment.</li>
</ol>

<ol>
	<li>Bouwman, P., Jonkers, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+deregulated+DNA+damage+signalling+on+cancer+chemotherapy+response+and+resistance.">The effects of deregulated DNA damage signalling on cancer chemotherapy response and resistance.</a> Nat Rev Cancer. 12, 587-598 (2012).</li><li>Bozic, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+dynamics+of+cancer+in+response+to+targeted+combination+therapy.">Evolutionary dynamics of cancer in response to targeted combination therapy.</a> Elife. 2, e00747 (2013).</li><li>Diaz, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+evolution+of+acquired+resistance+to+targeted+EGFR+blockade+in+colorectal+cancers.">The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers.</a> Nature. 486, 537-540 (2012).</li><li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+BRCA2+and+Thymidylate+Synthase+Creates+Multidrug+Sensitive+Tumor+Cells+via+the+Induction+of+Combined+'Complementary+Lethality'.">Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined 'Complementary Lethality'.</a> Mol Ther Nucleic Acids. 2, e78 (2013).</li><li>Lord, C. J., Ashworth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA+damage+response+and+cancer+therapy.">The DNA damage response and cancer therapy.</a> Nature. 481, 287-294 (2012).</li><li>Helleday, T., Petermann, E., Lundin, C., Hodgson, B., Sharma, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+repair+pathways+as+targets+for+cancer+therapy.">DNA repair pathways as targets for cancer therapy.</a> Nat Rev Cancer. 8, 193-204 (2008).</li><li>Shaheen, M., Allen, C., Nickoloff, J. A., Hromas, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+lethality:+exploiting+the+addiction+of+cancer+to+DNA+repair.">Synthetic lethality: exploiting the addiction of cancer to DNA repair.</a> Blood. 117, 6074-6082 (2011).</li><li>Green, S., Benedetti, J., Smith, A., Crowley, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Clinical trials in oncology. 28, (2012).</li><li>Begley, C. G., Ellis, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drug+development:+Raise+standards+for+preclinical+cancer+research.">Drug development: Raise standards for preclinical cancer research.</a> Nature. 483, 531-533 (2012).</li><li>Galluzzi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+definitions+of+cell+death+subroutines:+recommendations+of+the+Nomenclature+Committee+on+Cell+Death+2012.">Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012.</a> Cell Death Differ. 19, 531-533 (2012).</li><li>Ruggeri, B. A., Camp, F., Miknyoczki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+disease:+pre-clinical+animal+models+of+cancer+and+their+applications+and+utility+in+drug+discovery.">Animal models of disease: pre-clinical animal models of cancer and their applications and utility in drug discovery.</a> Biochem Pharmacol. 87, 150-161 (2014).</li><li>Kwon, M. C., Berns, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+for+lung+cancer.">Mouse models for lung cancer.</a> Mol Oncol. 7, 165-177 (2013).</li><li>Young, M., Ordonez, L., Clarke, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+are+the+best+routes+to+effectively+model+human+colorectal+cancer.">What are the best routes to effectively model human colorectal cancer.</a> Mol Oncol. 7, 178-189 (2013).</li><li>Sharma, S. V., Haber, D. A., Settleman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-based+platforms+to+evaluate+the+therapeutic+efficacy+of+candidate+anticancer+agents.">Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents.</a> Nat Rev Cancer. 10, 241-253 (2010).</li><li>Garnett, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+genomic+markers+of+drug+sensitivity+in+cancer+cells.">Systematic identification of genomic markers of drug sensitivity in cancer cells.</a> Nature. 483, 570-575 (2012).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+monitoring+of+cisplatin-induced+cell+death.">Real-time monitoring of cisplatin-induced cell death.</a> PLoS One. 6, e19714 (2011).</li><li>Cvetkovic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KISS1R+induces+invasiveness+of+estrogen+receptor-negative+human+mammary+epithelial+and+breast+cancer+cells.">KISS1R induces invasiveness of estrogen receptor-negative human mammary epithelial and breast cancer cells.</a> Endocrinology. 154, 1999-2014 (2013).</li><li>Leong, H. S., Chambers, A. F., Lewis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessing+cancer+cell+migration+and+metastatic+growth+in+vivo+in+the+chick+embryo+using+fluorescence+intravital+imaging.">Assessing cancer cell migration and metastatic growth in vivo in the chick embryo using fluorescence intravital imaging.</a> Methods Mol Biol. 872, 1-14 (2012).</li><li>Hung, Y. P., Albeck, J. G., Tantama, M., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+cytosolic+NADH-NAD(+)+redox+state+with+a+genetically+encoded+fluorescent+biosensor.">Imaging cytosolic NADH-NAD(+) redox state with a genetically encoded fluorescent biosensor.</a> Cell Metab. 14, 545-554 (2011).</li><li>Tantama, M., Hung, Y. P., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+intracellular+pH+in+live+cells+with+a+genetically+encoded+red+fluorescent+protein+sensor.">Imaging intracellular pH in live cells with a genetically encoded red fluorescent protein sensor.</a> J Am Chem Soc. 133, 10034-10037 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BRCA2+inhibition+enhances+cisplatin-mediated+alterations+in+tumor+cell+proliferation,+metabolism,+and+metastasis.">BRCA2 inhibition enhances cisplatin-mediated alterations in tumor cell proliferation, metabolism, and metastasis.</a> Mol. Onc. 8 (8), 1429-1440 (2014).</li></ol>

The authors have nothing to disclose.

Due to the inherent cost and risk associated with clinical trials, there is a need to develop better and more rigorous pre-clinical testing methodology to adequately evaluate novel anti-cancer treatment regimens. Current commonly-used techniques all exhibit weaknesses that may limit their capacity to discriminate between potentially promising therapeutic targets/agents, and those that may be less effective. We devised a protocol to evaluate new anti-cancer approaches that addresses many of the shortcomings of traditional...

Acquired resistance to targeted and/or cytotoxic cancer treatment is an important clinical problem that can lead to treatment failure, relapse, and increased patient mortality1. Given the high level of heterogeneity in most tumors, it is a mathematical certainty that a tumor of sufficiently high cell number will contain a subset of cells resistant to single or combined therapies targeting molecular pathways on which those cells depend for survival2,3. Such tumor cells can be positively selected for during treatment, leading to disease recurrence. Development of novel therapies that simultaneously target different cancer cell survival mechanisms, either before or after treatment-mediated selection, is thus clinically important.
A high level of genome instability and mutation in tumor genomes is a fundamental characteristic that distinguishes cancer cells from non-tumor host cells4. Consequently, a useful strategy to increase the effectiveness of DNA-damaging chemotherapy and to prevent the development of resistance is to actively inhibit DNA repair in tumor cells5. This is an active field of investigation and a variety of novel DNA repair targets are being explored in a pre-clinical setting. A number of small molecule or antisense-based inhibitors of these targets have been developed and are undergoing testing6-8. The objective is to identify the most promising pre-clinical candidates and evaluate their safety and efficacy in clinical trials.
The high cost of clinical trials and the risk of failure (for a variety of reasons including sub-optimal pre-clinical evaluation) are formidable obstacles to progress in development of new therapies9. The use of appropriate and rigorous pre-clinical models to adequately evaluate new therapeutic targets and candidate drugs may decrease the high failure rate of clinical trials10.
Some commonly-used pre-clinical methods to evaluate the effectiveness of novel anti-cancer regimens are: a) measurement of capacity to reduce tumor cell proliferation in vitro (cell proliferation assays), b) therapy-induced reduction in capacity of tumor cells to form tissue culture colonies (colony formation assays), c) therapy-induced reduction in tumor cell metabolic activity in vitro (redox-dye conversion) , d) therapy-induced induction of in vitro tumor cell death (apoptotic, necrotic, autophagic, associated with mitosis and others)11, and e) in vivo therapy-induced reduction of growth or ablation of human and mouse xenografts12-14. 
A major weakness of the listed in vitro methods is that none of them provide continuous real-time evaluation of the effect of candidate therapies. Rather, they provide information only at selected, widely-separated time points during the course of treatment. Such measurements have diminished capacity to accurately reflect the magnitude and timing of tumor cell responses. In vivo mouse xenograft models are also limited by high cost, length of time to complete, and risk of sub-optimal dosing and treatment timing (scheduling). In addition, there is evidence that rodent xenograft models are limited predictors of clinical efficacy in humans, compared to in vitro assessment of responses of primary human tumor cells and established human tumor cell lines to candidate therapeutic interventions15,16. 
We devised a novel combination protocol to evaluate new drug combinations pre-clinically, in a manner that addresses the weaknesses of the more common procedures listed above. In place of proliferation, colony formation, or redox-dye conversion assays, we utilized a metabolism measurement unit to analyze cell adhesion, respiration, and acidification in real time during the entire treatment period17. Simultaneously, we investigated the effects of treatment combination in vivo by using a chicken embryo chorioallantoic membrane (CAM) model of invasion and metastasis18,19. We used these methods to evaluate the ability of an antisense oligonucleotide (ASO) targeting BRCA2 to potentiate the effectiveness of the commonly used chemotherapeutic drug cisplatin.

<table><tbody><tr><td>A549 cells</td><td>ATCC</td><td>CCL-185</td><td>http://www.atcc.org/products/all/CCL-185.aspx</td></tr><tr><td>AeraSeal film</td><td>Carl Roth GmbH</td><td></td><td></td></tr><tr><td>AMEM</td><td>Wisent Bioproducts</td><td>210-011-QK</td><td></td></tr><tr><td>Antisense oligodeoxynucleotides</td><td>Avecia</td><td></td><td>BRCA2 target sequence: 5&#039; - UAAGGAACGUCAAGAGAUAC - 3&#039; (bases 7241-7259 )</td></tr><tr><td>Axio Zoom V16 Microscope</td><td>Carl Zeiss</td><td></td><td>http://www.zeiss.ca/microscopy/en_ca/products/stereo-zoom-microscopes/axio-zoom-v16.html</td></tr><tr><td>Bionas Biosensor Chips</td><td>Bionas GmbH and Micronas GmbH</td><td>BIS8001D</td><td></td></tr><tr><td>Bionas Discovery 2500 System&amp;nbsp;</td><td>Bionas GmbH</td><td></td><td>http://www.bionas-discovery.com/prodservices/instruments/system2500/</td></tr><tr><td>Cisplatin</td><td>Sigma Aldrich</td><td>479306</td><td></td></tr><tr><td>Fertilized chicken eggs</td><td>Sourced locally</td><td></td><td></td></tr><tr><td>Fetal bovine serum&amp;nbsp;</td><td>Gibco - Life Technologies</td><td></td><td></td></tr><tr><td>Lipofectamine 2000&amp;nbsp;</td><td>Invitrogen - Life Technologies&amp;nbsp;</td><td>12566014</td><td>http://www.lifetechnologies.com/ca/en/home/life-science/protein-expression-and-analysis/transfection-selection/lipofectamine-2000.html</td></tr><tr><td>PBS</td><td>Wisent Bioproducts</td><td>311-010-CL</td><td></td></tr><tr><td>Trypsin (0.25%)/EDTA</td><td>Wisent Bioproducts</td><td>325-043-CL</td><td></td></tr></tbody></table>

evaluating the effectiveness of cancer drug sensitization in vitro and in vivo

Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same pathway, are likely to fail. Emphasis must be placed upon the inhibition of pathways that are responsible for intrinsic and/or adaptive resistance to therapy. An active field of investigation is the development and testing of DNA repair inhibitors that promote the action of, and prevent resistance to, commonly used chemotherapy and radiotherapy. We used a novel protocol to evaluate the effectiveness of BRCA2 inhibition as a means to sensitize tumor cells to the DNA damaging drug cisplatin. Tumor cell metabolism (acidification and respiration) was monitored in real-time for a period of 72 hr to delineate treatment effectiveness on a minute by minute basis. In combination, we performed an assessment of metastatic frequency using a chicken embryo chorioallantoic membrane (CAM) model of extravasation and invasion. This protocol addresses some of the weaknesses of commonly used in vitro and in vivo methods to evaluate novel cancer therapy regimens. It can be used in addition to common methods such as cell proliferation assays, cell death assays, and in vivo murine xenograft studies, to more closely discriminate amongst candidate targets and agents, and select only the most promising candidates for further development.

Results and figures adapted with permission from published work22.
BRCA2 inhibition induces a decrease in respiration in cisplatin treated tumor cells
Human A549 lung cancer cells treated with BRCA2-targeting ASO and cisplatin exhibited an early and irreversible decrease in respiration, compared to cells which received control ASO and cisplatin alone; after 24 hr of cisplatin treatment the difference in respiration between BRCA2 ASO and control A...

Watch this Scientific Journal Video about Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo at JoVE.com

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics.

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same ...

evaluating-effectiveness-cancer-drug-sensitization-vitro

Research

JoVE Journal

Medicine

8.6K Views.  Western University. Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics. 

Video: Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Establishing Dual Resistance to EGFR-TKI and MET-TKI in Lung Adenocarcinoma Cells In Vitro with a 2-step Dose-escalation Procedure

Drug resistance is a major challenge in cancer therapy. The generation of resistant sublines in vitro is necessary for discovering novel mechanisms to overcome this challenge. Here, a 2-step dose-escalation method for establishing dual-resistance to an epidermal growth factor receptor (EGFR)-tyrosine kinase inhibitor (TKI), gefitinib, and a MET-TKI, PHA665752, is described. This method is based on simple stepwise dose-escalation of inhibitors for inducing acquired resistance in cell lines. The alternate method for generating resistant sublines involves exposing the cells to high concentrations of the inhibitor in one step. The stepwise dose-escalation method has a higher possibility of successfully inducing acquired resistance than this method. Activating EGFR mutations are biomarkers of a response to treatment with EGFR-TKI, which is an applied first-line treatment for non-small cell lung cancers (NSCLC) that harbor these mutations. However, despite reports of effective responses, the use of EGFR-TKI is limited because tumors inevitably acquire resistance. The major mechanisms behind EGFR-TKI resistance include a secondary mutation at the gatekeeper site, T790M in exon 20 of EGFR, and a bypass signal of MET. Thus, a potential solution for this issue would be a combination of EGFR-TKI and MET-TKI. This combined treatment has been shown to be effective in an in vitro study model. Acquired gefitinib-resistance was established through MET-amplification by stepwise dose-escalation of gefitinib for 12 months, and a cell line named PC-9MET1000 was generated in a previous study. To further investigate the mechanisms of acquired MET-TKI and EGFR-TKI resistance, a MET-TKI, PHA665752, was administered to these cells with stepwise dose-escalation in the presence of gefitinib for 12 months. This protocol has also been successfully applied for a number of combination therapies to establish acquired resistance to other inhibitor molecules.

Establishing Dual Resistance to EGFR-TKI and MET-TKI in Lung Adenocarcinoma Cells In Vitro with a 2-step Dose-escalation Procedure

An in vitro method for establishing dual resistance to an EGFR-TKI and a MET-TKI in cancer cells is described. This method is useful for developing treatments for patients with EGFR-mutations, who exhibit disease progression despite EGFR-TKI treatment with MET-amplification. It can also be modified for inhibitors targeting other molecules.

Drug resistance is a major challenge in cancer therapy. The generation of resistant sublines in vitro is necessary for discovering novel mechanisms to ...

Cancer Research

Preclinical Assessment of the Bioactivity of the Anticancer Coumarin OT48 by Spheroids, Colony Formation Assays, and Zebrafish Xenografts

In vitro and in vivo pre-clinical screening of novel therapeutic agents are an essential tool in cancer drug discovery. Although human cancer cell lines respond to therapeutic compounds in 2D (dimensional) monolayer cell cultures, 3D culture systems were developed to understand the efficacy of drugs in more physiologically relevant models. In recent years, a paradigm shift was observed in pre-clinical research to validate the potency of new molecules in 3D culture systems, more precisely mimicking the tumor microenvironment. These systems characterize the disease state in a more physiologically relevant manner and help to gain better mechanistic insight and understanding of the pharmacological potency of a given molecule. Moreover, with the current trend in improving in vivo cancer models, zebrafish has emerged as an important vertebrate model to assess in vivo tumor formation and study the effect of therapeutic agents. Here, we investigated the therapeutic efficacy of hydroxycoumarin OT48 alone or in combination with BH3 mimetics in lung cancer cell line A549 by using three different 3D culture systems including colony formation assays (CFA), spheroid formation assay (SFA) and in vivo zebrafish xenografts.

Here, we present the preclinical screening of anticancer coumarins using 3D culture and zebrafish.

In vitro and in vivo pre-clinical screening of novel therapeutic agents are an essential tool in cancer drug discovery. Although human cancer cell lines ...

Potentiation of Anticancer Antibody Efficacy by Antineoplastic Drugs: Detection of Antibody-drug Synergism Using the Combination Index Equation

Potentiation of hostile monoclonal antibodies (mAb) by chemotherapeutic agents constitutes a valuable strategy for designing effective and safer therapy against cancer. Here we provide a protocol to identify a rational combination at the preclinical step. First, we describe a cell-based assay to assess the synergism between anticancer mAb and cytotoxic drugs, that uses the combination index equation of Chou and Talalay1. This includes the measurement of tumor cell drug- and antibody-sensitivity using an MTT assay, followed by an automated computer analysis to calculate the combination index (CI) values. CI values of &lt;1 indicate synergism between tested mAbs and cytotoxic agents1. To corroborate the in vitro findings in vivo, we further describe a method to assess the combination regimen efficacy in a xenograft tumor model. In this model, the combined regimen significantly delays tumor growth, which results in a significant extended survival in comparison to single-agent controls. Importantly, the in vivo experimentation reveals that the combination regimen is well tolerated. This protocol allows the effective evaluation of anticancer drug combinations in preclinical models and the identification of rational combination to evaluate in clinical trials.

This protocol describes how to assess synergism between an anticancer antibody and antineoplastic drugs in preclinical models by using the combination index equation of Chou and Talalay.

Potentiation of hostile monoclonal antibodies (mAb) by chemotherapeutic agents constitutes a valuable strategy for designing effective and safer therapy ...

In Vitro Tumor Cell Rechallenge For Predictive Evaluation of Chimeric Antigen Receptor T Cell Antitumor Function

The field of chimeric antigen receptor (CAR) T cell therapy is rapidly advancing with improvements in CAR design, gene-engineering approaches and manufacturing optimizations. One challenge for these development efforts, however, has been the establishment of in vitro assays that can robustly inform selection of the optimal CAR T cell products for in vivo therapeutic success. Standard in vitro tumor-lysis assays often fail to reflect the true antitumor potential of the CAR T cells due to the relatively short co-culture time and high T cell to tumor ratio. Here, we describe an in vitro co-culture method to evaluate CAR T cell recursive killing potential at high tumor cell loads. In this assay, long-term cytotoxic function and proliferative capacity of CAR T cells is examined in vitro over 7 days with additional tumor targets administered to the co-culture every other day. This assay can be coupled with profiling T cell activation, exhaustion and memory phenotypes. Using this assay, we have successfully distinguished the functional and phenotypic differences between CD4+ and CD8+ CAR T cells against glioblastoma (GBM) cells, reflecting their differential in vivo antitumor activity in orthotopic xenograft models. This method provides a facile approach to assess CAR T cell potency and to elucidate the functional variations across different CAR T cell products.

Here, we describe an in vitro co-culture method to recursively challenge tumor-targeted T cells, which allows for phenotypic and functional analysis of antitumor T cell activity.

The field of chimeric antigen receptor (CAR) T cell therapy is rapidly advancing with improvements in CAR design, gene-engineering approaches and ...

Monitoring Cancer Cell Invasion and T-Cell Cytotoxicity in 3D Culture

Significant progress has been made in treating cancer with immunotherapy, although a large number of cancers remain resistant to treatment. A limited number of assays allow for direct monitoring and mechanistic insights into the interactions between tumor and immune cells, amongst which, T-cells play a significant role in executing the cytotoxic response of the adaptive immune system to cancer cells. Most assays are based on two-dimensional (2D) co-culture of cells due to the relative ease of use but with limited representation of the invasive growth phenotype, one of the hallmarks of cancer cells. Current three-dimensional (3D) co-culture systems either require special equipment or separate monitoring for invasion of co-cultured cancer cells and interacting T-cells.
Here we describe an approach to simultaneously monitor the invasive behavior in 3D of cancer cell spheroids and T-cell cytotoxicity in co-culture. Spheroid formation is driven by enhanced cell-cell interactions in scaffold-free agarose microwell casts with U-shaped bottoms. Both T-cell co-culture and cancer cell invasion into type I collagen matrix are performed within the microwells of the agarose casts without the need to transfer the cells, thus maintaining an intact 3D co-culture system throughout the assay. The collagen matrix can be separated from the agarose cast, allowing for immunofluorescence (IF) staining and for confocal imaging of cells. Also, cells can be isolated for further growth or subjected to analyses such as for gene expression or fluorescence activated cell sorting (FACS). Finally, the 3D co-culture can be analyzed by immunohistochemistry (IHC) after embedding and sectioning. Possible modifications of the assay include altered compositions of the extracellular matrix (ECM) as well as the inclusion of different stromal or immune cells with the cancer cells.

The presented approach simultaneously evaluates cancer cell invasion in 3D spheroid assays and T-cell cytotoxicity. Spheroids are generated in a scaffold-free agarose multi-microwell cast. Co-culture and embedding in type I collagen matrix are performed within the same device which allows to monitor cancer cell invasion and T-cell mediated cytotoxicity.

Significant progress has been made in treating cancer with immunotherapy, although a large number of cancers remain resistant to treatment. A limited ...

Profiling Sensitivity to Targeted Therapies in EGFR-Mutant NSCLC Patient-Derived Organoids

Novel 3D cancer organoid cultures derived from clinical patient specimens represent an important model system to evaluate intratumor heterogeneity and treatment response to targeted inhibitors in cancer. Pioneering work in gastrointestinal and pancreatic cancers has highlighted the promise of patient-derived organoids (PDOs) as a patient-proximate culture system, with an increasing number of models emerging. Similarly, work in other cancer types has focused on establishing organoid models and optimizing culture protocols. Notably, 3D cancer organoid models maintain the genetic complexity of original tumor specimens and thus translate tumor-derived sequencing data into treatment with genetically informed targeted therapies in an experimental setting. Further, PDOs might foster the evaluation of rational combination treatments to overcome resistance-associated adaptation of tumors in the future. The latter focuses on intense research efforts in non-small-cell lung cancer (NSCLC), as resistance development ultimately limits the treatment success of targeted inhibitors. An early assessment of therapeutically targetable mechanisms using NSCLC PDOs could help inform rational combination treatments. This manuscript describes a standardized protocol for the cell culture plate-based assessment of drug sensitivities to targeted inhibitors in NSCLC-derived 3D PDOs, with potential adaptability to combinational treatments and other treatment modalities.

This protocol describes a standardized evaluation of drug sensitivities to targeted signaling inhibitors in NSCLC patient-derived organoid models.

Novel 3D cancer organoid cultures derived from clinical patient specimens represent an important model system to evaluate intratumor heterogeneity and ...

A Combined 3D Tissue Engineered In Vitro/In Silico Lung Tumor Model for Predicting Drug Effectiveness in Specific Mutational Backgrounds

In the present study, we combined an in vitro 3D lung tumor model with an in silico model to optimize predictions of drug response based on a specific mutational background. The model is generated on a decellularized porcine scaffold that reproduces tissue-specific characteristics regarding extracellular matrix composition and architecture including the basement membrane. We standardized a protocol that allows artificial tumor tissue generation within 14 days including three days of drug treatment. Our article provides several detailed descriptions of 3D read-out screening techniques like the determination of the proliferation index Ki67 staining&#39;s, apoptosis from supernatants by M30-ELISA and assessment of epithelial to mesenchymal transition (EMT), which are helpful tools for evaluating the effectiveness of therapeutic compounds. We could show compared to 2D culture a reduction of proliferation in our 3D tumor model that is related to the clinical situation. Despite of this lower proliferation, the model predicted EGFR-targeted drug responses correctly according to the biomarker status as shown by comparison of the lung carcinoma cell lines HCC827 (EGFR -mutated, KRAS wild-type) and A549 (EGFR wild-type, KRAS-mutated) treated with the tyrosine-kinase inhibitor (TKI) gefitinib. To investigate drug responses of more advanced tumor cells, we induced EMT by long-term treatment with TGF-beta-1 as assessed by vimentin/pan-cytokeratin immunofluorescence staining. A flow-bioreactor was employed to adjust culture to physiological conditions, which improved tissue generation. Furthermore, we show the integration of drug responses upon gefitinib treatment or TGF-beta-1 stimulation - apoptosis, proliferation index and EMT - into a Boolean in silico model. Additionally, we explain how drug responses of tumor cells with a specific mutational background and counterstrategies against resistance can be predicted. We are confident that our 3D in vitro approach especially with its in silico expansion provides an additional value for preclinical drug testing in more realistic conditions than in 2D cell culture.

A Combined 3D Tissue Engineered In Vitro/In Silico Lung Tumor Model for Predicting Drug Effectiveness in Specific Mutational Backgrounds

We present a three-dimensional (3D) lung cancer model based on a biological collagen scaffold to study sensitivity towards non-small-cell-lung-cancer-(NSCLC)-targeted therapies. We demonstrate different read-out techniques to determine the proliferation index, apoptosis and epithelial-mesenchymal transition (EMT) status. Collected data are integrated into an in silico model for prediction of drug sensitivity.

In the present study, we combined an in vitro 3D lung tumor model with an in silico model to optimize predictions of drug response based on a specific ...

Bioengineering

In Vitro and In Vivo Evaluation of Photocontrolled Biologically Active Compounds - Potential Drug Candidates for Cancer Photopharmacology

Photocontrolled, biologically active compounds are an emerging class of &#34;smart&#34; drug candidates. They provide additional safety in systemic chemotherapy due to their precise spatiotemporal activation by directing a benign, non-ionizable light to a specific location within the patient&#39;s body. This paper presents a set of methods to evaluate the in vitro potency and ex vivo efficiency of the photoactivation of photocontrolled, biologically active compounds as well as the in vivo efficacy at early stages of drug development. The methodology is applied to anticancer cytotoxic peptides, namely, the diarylethene-containing analogs of a known antibiotic, gramicidin S. The experiments are performed using 2D (adherent cells) and 3D (spheroids) cell cultures of a cancer cell line (Lewis lung carcinoma, LLC), live tissue surrogates (pork meat mince), and an allograft cancer model (subcutaneous LLC) in immunocompetent mice. The selection of the most effective compounds and estimation of realistic phototherapeutic windows are performed via automated fluorescence microscopy. The photoactivation efficiency at varying illumination regimens is determined at different depths in a model tissue, and the optimal light dosage is applied in the final therapeutic in vivo experiment.

In Vitro and In Vivo Evaluation of Photocontrolled Biologically Active Compounds - Potential Drug Candidates for Cancer Photopharmacology

This protocol presents a set of experiments adopted for the evaluation of photoswitchable anticancer peptides, that can be used in the preclinical screening of such compounds. This includes cytotoxicity assessment in 2D and 3D cell cultures, the evaluation of ex vivo (model tissue) photoisomerization efficiency, and in vivo efficacy.

Photocontrolled, biologically active compounds are an emerging class of &#34;smart&#34; drug candidates. They provide additional safety in systemic ...

Chemistry

An Organotypic High Throughput System for Characterization of Drug Sensitivity of Primary Multiple Myeloma Cells

In this work we describe a novel approach that combines ex vivo drug sensitivity assays and digital image analysis to estimate chemosensitivity and heterogeneity of patient-derived multiple myeloma (MM) cells. This approach consists in seeding primary MM cells freshly extracted from bone marrow aspirates into microfluidic chambers implemented in multi-well plates, each consisting of a reconstruction of the bone marrow microenvironment, including extracellular matrix (collagen or basement membrane matrix) and stroma (patient-derived mesenchymal stem cells) or human-derived endothelial cells (HUVECs). The chambers are drugged with different agents and concentrations, and are imaged sequentially for 96 hr through bright field microscopy, in a motorized microscope equipped with a digital camera. Digital image analysis software detects live and dead cells from presence or absence of membrane motion, and generates curves of change in viability as a function of drug concentration and exposure time. We use a computational model to determine the parameters of chemosensitivity of the tumor population to each drug, as well as the number of sub-populations present as a measure of tumor heterogeneity. These patient-tailored models can then be used to simulate therapeutic regimens and estimate clinical response.

We describe a high-throughput drug sensitivity assay for primary multiple myeloma cells. It consists of a reconstruction of the bone marrow microenvironment (including extracellular matrix and stroma) in multi-well plates, and a non-invasive method for longitudinal quantification of cell viability.

In this work we describe a novel approach that combines ex vivo drug sensitivity assays and digital image analysis to estimate chemosensitivity and ...

Assessing Specificity of Anticancer Drugs In Vitro

A procedure for assessing specificity of anticancer drugs in vitro using cultures containing both tumor and non-tumor cells is demonstrated. The key element is the quantitative determination of a tumor-specific genetic alteration in relation to a universal sequence using a dual-probe digital PCR assay and the subsequent calculation of the proportion of tumor cells. The assay is carried out on a culture containing tumor cells of an established line and spiked-in non-tumor cells. The mixed culture is treated with a test drug at various concentrations. After the treatment, DNA is prepared directly from the survived adhesive cells in wells of 96-well plates using a simple and inexpensive method, and subjected to a dual-probe digital PCR assay for measuring a tumor-specific genetic alteration and a reference universal sequence. In the present demonstration, a heterozygous deletion of the NF1 gene is used as the tumor-specific genetic alteration and a RPP30 gene as the reference gene. Using the ratio NF1/RPP30, the proportion of tumor cells was calculated. Since the dose-dependent change of the proportion of tumor cells provides an in vitro indication for specificity of the drug, this genetic and cell-based in vitro assay will likely have application potential in drug discovery. Furthermore, for personalized cancer-care, this genetic- and cell-based tool may contribute to optimizing adjuvant chemotherapy by means of testing efficacy and specificity of candidate drugs using primary cultures of individual tumors.

Assessing Specificity of Anticancer Drugs In Vitro

The goal of this protocol is to assess specificity of anticancer drugs in vitro using mixed cultures containing both tumor and non-tumor cells.

A procedure for assessing specificity of anticancer drugs in vitro using cultures containing both tumor and non-tumor cells is demonstrated. The key ...

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Samenvatting

Meer video's verkennen