Name: evaluating the effectiveness of cancer drug sensitization in vitro and in vivo
Uploaded: 2015-02-06T14:00:00.000+00:00
Duration: 9 min 19 s
Description: Watch this Scientific Journal Video about Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo at JoVE.com

עבודה זו התאפשרה על ידי מענקים לJK ממרכזי אונטריו של אקסלנס וקרן המחקר לאונטריו. ברצוננו להודות לSiddika Pardhan וד&quot;ר פיטר פרגוסון לקבלת סיוע טכני בזמן צילומים.

הערה: הפרוטוקול הבא נועד לשימוש עם תאים חסיד. שינויים נדרשים ליישם את השיטה שלאינם חסיד תאים שגודלו בהשעיה. ניסויי CAM המתוארים בפרוטוקול מיועד לשימוש עם תאים המבטאים את סמן פלואורסצנטי (למשל, GFP, RFP, וכו &#39;). עוברי עוף בן תשעה יום נדרשים ביום 2 לפרוטוקול הניסוי לניסויי CAM. 1. הכנה וTransfection של תאים סרטניים עם Oligonucleotides antisense (ASOs) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בינוני לשאוב מבקבוק T75 (ים) המכיל תאים של עניין, לשטוף עם 1XPBS, ולהוסיף 2 מיליליטר של 0.25% טריפסין / EDTA. הוסף 10 מיליליטר של מדיום גידול מלא לכל בקבוק ולהעביר את התאים בפתרון לשפופרת 50 מיליליטר. ספירת התאים ולהתאים את עוצמת הקול, כך שהריכוז הסופי הוא 1.0x10 5 תאים לכל מיליליטר. </li><li style=";text-align:right;direction:rtl"> תווית שתי קבוצות של צלוחיות T25: קבוצה אחת תכיל שמונה צלוחיות, שכותרתו 1-8, ויהיה uSED לניסוי מדידת חילוף חומרים בזמן אמת; והקבוצה השנייה גם תכיל 8 צלוחיות ותשמש לניסוי CAM עובר עוף. הוסף 2 מיליליטר של תאים בפתרון לכל בקבוק ומקום בחממה (37 ° C, 5% CO 2 O / N). </li><li style=";text-align:right;direction:rtl"> למחרת בבוקר (יום 0, הזמן 0), תווית שלושה 5 מיליליטר צינורות כדלקמן: (ASO ללא מיקוד או siRNA) שליטה, &quot;היעד של עניין&quot; (כלומר, ASO מיקוד או siRNA), וLipofectamine 2000 (או דומה מגיב transfection). לדלל את פתרונות המניות ASO לריכוז המתאים עם מדיום חופשי בסרום בצינור המתאים. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להוסיף את הסכום הנדרש של מגיב transfection לצינור המתאים ודגירה במדיום סרום ללא למשך 5 דקות. מוסיף את הפתרון מגיב transfection לצינורות ASO דגירה במשך 20 דקות. </li></ol></li><li style=";text-align:right;direction:rtl"> הוסף 250 μl של פתרון מגיב transfection שליטת ASO לכל אחד מצלוחיות 1-4 בכל קבוצה, ו- 250μl של פתרון &quot;היעד של עניין&quot; ASO מגיב transfection לכל אחד מצלוחיות 5-8 בכל קבוצה. דגירה של 4 שעות (37 ᵒC, 5% CO 2). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> במהלך דגירה, לבצע את הפעולות מתוארות בסעיף 2.1. לאחר הדגירה, להוסיף 3 מיליליטר של מדיום מלא לכל בקבוק בקבוצת ניסוי CAM ולחזור לO החממה / N (37 ᵒC, 5% CO 2). לעבד את קבוצת ניסוי חילוף חומרים לפי התיאור בסעיף 2.2. לעבד את ניסוי CAM נקבע לפי התיאור בסעיף 4. </li></ol></li></ol> 2. biosensor צ&#39;יפ הכנה וזריעת תאים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בסביבת סטרילית, בזהירות לשטוף שישה שבבי biosensor עם 400 μl של PBS. לעקר את השבבים עם 400 μl של 70% אתנול עבור 20 דקות. לשטוף שלוש פעמים עם 400 μl של PBS. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מניחים את השבבים בתוך cultur רקמות סטרילייםמנות דואר על מנת למנוע זיהום. הנח שלושה שבבים בצלחת שכותרתו &quot;שליטה&quot;, ושלוש בצלחת שכותרתו &quot;יעד של עניין&quot;. </li></ol></li><li style=";text-align:right;direction:rtl"> תווית שני צינורות 50 מיליליטר כ &#39;שליטה&#39; ו &#39;יעד של עניין &quot;. לשטוף את התאים עם PBS ולהוסיף נפח מתאים של 0.25% טריפסין / EDTA. חכה עד שמתנתק monolayer ולאסוף את התאים מבקבוק אחד. להפקיד את הפתרון לתוך הצינור המתאים. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ספירת התאים ולהתאים את עוצמת הקול, כך שהריכוז הסופי הוא 6.0x10 5 תאים / מיליליטר. צנטריפוגה ו resuspend התאים אם הריכוז הראשוני הוא נמוך מדי. </li></ol></li><li style=";text-align:right;direction:rtl"> הוסף 250 μl של פתרון התא לכל שבב biosensor בקבוצה המתאימה (עבור הסכום כולל של 1.25x10 5 תאים לכל שבב). בצע קבוצה אחת המשימה זו בכל פעם כדי למזער את הסיכון של מבלבל את השבבים. מניחים את הכלים סטריליים המכילים שבבים בתוך תא לחות על מנת למנוע אידוי, ולמקם את צ&#39;ה לחותmber בחממה O / N (37 ᵒC, 5% CO 2). </li><li style=";text-align:right;direction:rtl"> למחרת בבוקר (יום 1), לשאוב בזהירות בינונית מכל שבב ולהחליף אותו עם 250 μl של מדיום גידול בתוספת סרום 0.2% שור עוברי (FBS) ו1x פניצילין וסטרפטומיצין (P / S). דגירה של 4 שעות (37 ᵒC, 5% CO 2). </li></ol> הכנת מערכת 3. מטבוליזם מדידה ופתרון הכנה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> במהלך הדגירה, להכין את הפתרונות הנדרשים סמים ומערכת מדידת חילוף חומרים לassay הקרוב. הערה: מערכת מדידת חילוף חומרים מכילה בסך הכל שישה מודולים. כל מודול מכיל שבב אחד לכל ניסוי. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לחלק את assay לקבוצות הניסוי הבא: שבב אחד מכל אחת מ&#39;השליטה &#39;ו&#39; היעד של העניין &quot;קבוצות לקבל רכב למשך assay; שני שבבים מכל קבוצה על מנת לקבל טיפול תרופתי לתקופה מוגדרת של זמן במהלךssay, ואחריו רכב במהלך תקופת המתנה. </li><li style=";text-align:right;direction:rtl"> ללימודי רגישות סמים, לשנות את האורך, עיתוי, וריכוז של טיפול תרופתי כדי להתאים את התרופה המסוימת בשאלה. הערה: לציספלטין, השלבים הבאים נקבעו באופן אמפירי עם תאי A549, ועשויה להשתנות בהתאם לשורת תאים. לבצע את כל השלבים עם קצב זרימת ברירת המחדל של 4 μl / min. 6 שעות של מדיום + FBS 0.2% הצמיחה ו1x P / S 24 שעות של 6 מיקרומטר ציספלטין במדיום + 0.2% FBS 1x P / S 24 שעות של מדיום + FBS 0.2% הצמיחה ו1x P / S 18 שעות של מדיום + FBS 0.2% הצמיחה ו1x P / S 4 שעות של 0.1% Triton-X הערה: סטיות מהפעולות הבאות תדרוש חישוב כדי לקבוע את הנפח הנדרש של פתרונות בינוניים ותרופה המבוססת על קצב הזרימה ומשך הניסוי הרצויים. הסעיפים שלהלן מבוססים על הצעדים שתוארו לעיל. </li></ol></li><li style=";text-align:right;direction:rtl"> תווית ולמלא ארבע עשרה צינורות 50 מיליליטר עם 50 מיליליטר של 0.2% FBS מדיום גידולד 1x P / S. מניחים שישה במתלות צינור מערכת מדידת חילוף חומרים אחד, שש באחר, ושני הנותרים במתלים צינור שלישי שמכיל גם צינורות עם ציספלטין. לאטום את שני המדפים הראשונים עם קרום חדיר אוויר על מנת למנוע אידוי. </li><li style=";text-align:right;direction:rtl"> הכן פתרון של 6 ציספלטין מיקרומטר (בנפח המתאים) בFBS + 0.2% בינוניים עם 1x P / S. לוותר הנפח הנדרש של פתרון ציספלטין לארבעה 50 מיליליטר צינורות שכותרתו. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מניחים את הצינורות בארבעת חריצים שנותרו במתל צינור מדידת חילוף חומרים שלישיים. ודא שהצינורות ממוקמים בחריצים המתאימים שמתאימים לbiomodules הרצוי. לאטום את הצינורות עם קרום חדיר אוויר. </li></ol></li><li style=";text-align:right;direction:rtl"> הכן ולתייג שישה צינורות 50 מיליליטר ולמלא אותם עם 20 מיליליטר כל אחד מ0.1% פתרון Triton-X במדיום. פתרון Triton-X יהיה lyse כל תאים הנותרים ולספק ערך &#39;אפס&#39; לכל שבב. מניחים את הצינורות במתלים צינור יחידת מדידת חילוף החומרים רביעי ולאטום שנינותh קרום permable אוויר על מנת למנוע אידוי מוגזם. </li><li style=";text-align:right;direction:rtl"> טען את השבבים לbiomodules וליזום את הניסוי. </li></ol> ניסוי CAM 4. טיפול תרופתי והזרקה הערה: השלבים והליך הכנת עוברי עופות לניסוי CAM מתוארים במקום אחר 19 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בגין עיבוד CAM ניסוי 48 לאחר transfection שעות (יום 2). תת-לחלק את &quot;שליטה&quot; ו- &quot;היעד של העניין&quot; קבוצות לשתי צלוחיות לרכב, ושניים לציספלטין. לשאוב את המדיום מהצלוחיות ולחדש עם או 3 מיליליטר של מדיום חדש, או 6 מיקרומטר ציספלטין. דגירה של 6 שעות (37 ᵒC, 5% CO 2). </li><li style=";text-align:right;direction:rtl"> לשאוב את המדיום, ולאחר מכן לשטוף וtrypsinize התאים; לאסוף את תאי trypsinized בפתרון לארבעה 15 מיליליטר צינורות שכותרתו כראוי. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> צנטריפוגה ולשטוף את התאים שלוש פעמים עם PBS. להשעות מחדש את התא גלולה ב 5 מיליליטר של PBSd לספור את התאים. </li><li style=";text-align:right;direction:rtl"> כוון את עוצמת הקול, כך שריכוז התא הסופי הוא 1.0x10 6 תאים / מיליליטר. מעביר את פתרון התא לתוך 5 מיליליטר צינורות שכותרתו להזרקה, ומניח על קרח. להפוך את הצינורות בעדינות לפני הזרקה כדי להבטיח שהתאים מתערבבים היטב. </li></ol></li><li style=";text-align:right;direction:rtl"> להפריש סכום כולל של 24 עוברי עופות (בן 9 ימים) להזרקה (6 בכל קבוצה). לבצע ההזרקה באמצעות מחט זכוכית מחוברת לצינור גמיש מחובר למזרק 1 מיליליטר. פרט ביצוע ההזרקה צריך להיות עיוור כדי קבוצת הטיפול. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> באמצעות מיקרוסקופ סטריאו, להזריק 1.0x10 5 תאים בנפח של 100 μl למחזור דם הוורידים של CAM. השתמש בטכניקה איטית, פועמת להזריק נפח המלא של תאים. בעדינות טיפת אתר ההזרקה עם רך לנגב לבלום את זרימת הדם ולספוג כל דליפה. כל תווית מיכל עובר כראוי לאחר כל הזרקה. </li></ol></li><li style=";text-align:right;direction:rtl"> לאשר את קיומו וdistribution של תאי ניאון בכלי הדם של CAM לאחר הזרקה על ידי הדמיתם באמצעות מיקרוסקופ פלואורסצנטי. שימו לב לכל עוברים בו המספר של תאים סרטניים נראה נמוך, או ההפצה היא עניה. </li><li style=";text-align:right;direction:rtl"> מניחים את עוברי העוף בתא לחות ולאחסן אותם בחממה (37 ° C, לחות 60%). חכה 7-9 ימים לפני ספירת מוקדים גרורתי. </li></ol> 5. גרורתי פוקוס ספירה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> במהלך תקופת הדגירה 7-9 היום, לפקח על העוברים וזורקים כל מתים. ודא שתא לחות נותר לח בכל העת במהלך תקופת הדגירה. </li><li style=";text-align:right;direction:rtl"> באמצעות מיקרוסקופ סטריאו ניאון בהגדלה 20X, לסרוק את כל פני השטח העליונים של CAM העובר בדפוס קבוע, כמו רשת. </li><li style=";text-align:right;direction:rtl"> לספור את מספר המוקדים גרורתי בכל שדה הראייה, ואז עולה בקנה אחד המספר לסך סופי לכל עובר. עושה זאת במשך ששת העוברים בכל קבוצה תספק o מספר ממוצעתמוקדים גרורתי f לכל טיפול. </li></ol>

<ol>
	<li>Bouwman, P., Jonkers, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+deregulated+DNA+damage+signalling+on+cancer+chemotherapy+response+and+resistance.">The effects of deregulated DNA damage signalling on cancer chemotherapy response and resistance.</a> Nat Rev Cancer. 12, 587-598 (2012).</li><li>Bozic, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+dynamics+of+cancer+in+response+to+targeted+combination+therapy.">Evolutionary dynamics of cancer in response to targeted combination therapy.</a> Elife. 2, e00747 (2013).</li><li>Diaz, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+evolution+of+acquired+resistance+to+targeted+EGFR+blockade+in+colorectal+cancers.">The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers.</a> Nature. 486, 537-540 (2012).</li><li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+BRCA2+and+Thymidylate+Synthase+Creates+Multidrug+Sensitive+Tumor+Cells+via+the+Induction+of+Combined+'Complementary+Lethality'.">Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined 'Complementary Lethality'.</a> Mol Ther Nucleic Acids. 2, e78 (2013).</li><li>Lord, C. J., Ashworth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA+damage+response+and+cancer+therapy.">The DNA damage response and cancer therapy.</a> Nature. 481, 287-294 (2012).</li><li>Helleday, T., Petermann, E., Lundin, C., Hodgson, B., Sharma, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+repair+pathways+as+targets+for+cancer+therapy.">DNA repair pathways as targets for cancer therapy.</a> Nat Rev Cancer. 8, 193-204 (2008).</li><li>Shaheen, M., Allen, C., Nickoloff, J. A., Hromas, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+lethality:+exploiting+the+addiction+of+cancer+to+DNA+repair.">Synthetic lethality: exploiting the addiction of cancer to DNA repair.</a> Blood. 117, 6074-6082 (2011).</li><li>Green, S., Benedetti, J., Smith, A., Crowley, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Clinical trials in oncology. 28, (2012).</li><li>Begley, C. G., Ellis, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drug+development:+Raise+standards+for+preclinical+cancer+research.">Drug development: Raise standards for preclinical cancer research.</a> Nature. 483, 531-533 (2012).</li><li>Galluzzi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+definitions+of+cell+death+subroutines:+recommendations+of+the+Nomenclature+Committee+on+Cell+Death+2012.">Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012.</a> Cell Death Differ. 19, 531-533 (2012).</li><li>Ruggeri, B. A., Camp, F., Miknyoczki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+disease:+pre-clinical+animal+models+of+cancer+and+their+applications+and+utility+in+drug+discovery.">Animal models of disease: pre-clinical animal models of cancer and their applications and utility in drug discovery.</a> Biochem Pharmacol. 87, 150-161 (2014).</li><li>Kwon, M. C., Berns, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+for+lung+cancer.">Mouse models for lung cancer.</a> Mol Oncol. 7, 165-177 (2013).</li><li>Young, M., Ordonez, L., Clarke, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+are+the+best+routes+to+effectively+model+human+colorectal+cancer.">What are the best routes to effectively model human colorectal cancer.</a> Mol Oncol. 7, 178-189 (2013).</li><li>Sharma, S. V., Haber, D. A., Settleman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-based+platforms+to+evaluate+the+therapeutic+efficacy+of+candidate+anticancer+agents.">Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents.</a> Nat Rev Cancer. 10, 241-253 (2010).</li><li>Garnett, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+genomic+markers+of+drug+sensitivity+in+cancer+cells.">Systematic identification of genomic markers of drug sensitivity in cancer cells.</a> Nature. 483, 570-575 (2012).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+monitoring+of+cisplatin-induced+cell+death.">Real-time monitoring of cisplatin-induced cell death.</a> PLoS One. 6, e19714 (2011).</li><li>Cvetkovic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KISS1R+induces+invasiveness+of+estrogen+receptor-negative+human+mammary+epithelial+and+breast+cancer+cells.">KISS1R induces invasiveness of estrogen receptor-negative human mammary epithelial and breast cancer cells.</a> Endocrinology. 154, 1999-2014 (2013).</li><li>Leong, H. S., Chambers, A. F., Lewis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessing+cancer+cell+migration+and+metastatic+growth+in+vivo+in+the+chick+embryo+using+fluorescence+intravital+imaging.">Assessing cancer cell migration and metastatic growth in vivo in the chick embryo using fluorescence intravital imaging.</a> Methods Mol Biol. 872, 1-14 (2012).</li><li>Hung, Y. P., Albeck, J. G., Tantama, M., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+cytosolic+NADH-NAD(+)+redox+state+with+a+genetically+encoded+fluorescent+biosensor.">Imaging cytosolic NADH-NAD(+) redox state with a genetically encoded fluorescent biosensor.</a> Cell Metab. 14, 545-554 (2011).</li><li>Tantama, M., Hung, Y. P., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+intracellular+pH+in+live+cells+with+a+genetically+encoded+red+fluorescent+protein+sensor.">Imaging intracellular pH in live cells with a genetically encoded red fluorescent protein sensor.</a> J Am Chem Soc. 133, 10034-10037 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BRCA2+inhibition+enhances+cisplatin-mediated+alterations+in+tumor+cell+proliferation,+metabolism,+and+metastasis.">BRCA2 inhibition enhances cisplatin-mediated alterations in tumor cell proliferation, metabolism, and metastasis.</a> Mol. Onc. 8 (8), 1429-1440 (2014).</li></ol>

יש לי המחברים אין לחשוף.

בשל העלות הכרוכה והסיכון כרוך בניסויים קליניים, יש צורך לפתח טוב יותר ויותר מחמיר מתודולוגיית בדיקות פרה-קלינית להעריך כראוי משטרי טיפול אנטי-סרטני רומן. שיטות קיימים כיום נפוצה בשימוש כל חולשות התערוכה שעלולה להגביל את היכולת שלהם להבחין בין מטרות / סוכנים טיפוליי?...

רכש התנגדות לממוקדת ו / או טיפול בסרטן ציטוטוקסיות היא בעיה קלינית חשובה שיכול להוביל לכישלון טיפול, התקפים, והגדיל את תמותת חולה 1. על רקע הרמה הגבוהה של ההטרוגניות ברוב הגידולים, זה ודאות מתמטית שגידול של מספר תאים גבוה מספיק יכיל תת-קבוצה של תאים עמידים לטיפולים בודדים או בשילוב מיקוד מסלולים מולקולריים שבו תאים אלה תלויים להישרדות 2,3. תאי גידול מסוג זה יכול להיות שנבחר באופן חיובי לטיפול ב, שמוביל להישנות מחלה. פיתוח של טיפולים חדשניים שבו זמנית למקד מנגנוני הישרדות של תאי הסרטן שונים, לפני או אחרי בחירה בתיווך טיפול, לכן חשוב מבחינה קלינית. רמה גבוהה של חוסר יציבות הגנום ומוטציה בגנומים גידול היא מאפיין בסיסי שמבדיל את התאים סרטניים לתאי מארח שאינו סרטני 4. כתוצאה מכך, usefuאסטרטגית l כדי להגדיל את האפקטיביות של כימותרפיה פוגע ב- DNA ולמנוע את התפתחותה של התנגדות היא לעכב באופן פעיל בתיקון ה- DNA בתאי גידול 5. זהו שדה פעיל של חקירה ומגוון רחב של יעדי תיקון DNA רומן נבדקים בסביבה פרה-קלינית. מספר המולקולה קטנה או המעכבים מבוססי antisense של מטרות אלו פותחו ועוברים בדיקת 6-8. המטרה היא לזהות את המועמדים פרה-קליניים המבטיחים ביותר ולהעריך את הבטיחות והיעילות שלהם בניסויים קליניים. העלות הגבוהה של ניסויים קליניים ואת הסיכון לכשל (עבור מגוון רחב של סיבות, כולל הערכה טרום-קלינית תת-אופטימלי) הם מכשולים אדירים להתקדמות בפיתוח הטיפולים החדשים 9. השימוש במודלים מתאימים וקפדניים פרה-קליניים להעריך כראוי חדש מטרות טיפוליות ותרופות מועמד עלול להפחית את שיעור כישלון הגבוה של ניסויים קליניים 10 </sup&gt;. כמה שיטות פרה-קליניות נפוצה בשימוש כדי להעריך את היעילות של טיפולים אנטי-סרטני רומן הם: א) מדידה של היכולת להפחית שגשוג תאים סרטניים במבחנה (מבחני התפשטות תאים), ב) הפחתה מושרה טיפול בקיבולת של תאי גידול ל מושבות בתרבית רקמת טופס (מבחני הקמת מושבה), ג) הפחתה מושרה טיפול בפעילות המטבולית של תאי גידול במבחנה (המרה חיזור-צבע), ד) אינדוקציה מושרה טיפול של מוות של תאים סרטניים במבחנה (אפופטוטיים, נימקי, autophagic, הקשורים עם מיטוזה ואחרים) 11, וה) in vivo טיפול-induced הפחתה של צמיחה או אבלציה של xenografts אדם והעכבר 12-14. חולשה העיקרית של מבחנה השיטות המפורטות בהיא שאף אחד מהם לספק הערכה בזמן אמת מתמשכת של השפעת טיפולי מועמד. במקום זאת, הם מספקים מידע רק בנקודתי זמן שנבחרו באופן נרחב מופרדים,במהלך הטיפול. מדידות כאלה הצטמצמו יכולת לשקף את העוצמה ועיתוי של תגובות תאים סרטניים בצורה מדויקת. בvivo מודלים xenograft העכבר מוגבלים גם על ידי עלות גבוהה, משך זמן להשלמת, וסיכון של עיתוי אופטימלי מינון וטיפול (תזמון). בנוסף, יש ראיות לכך שמודלי xenograft המכרסמים הם מנבאים מוגבלים של יעילות קלינית בבני אדם, בהשוואה להערכה במבחנה של תגובות של תאים סרטניים אנושיים ראשוניים ושורות תאי גידול אנושי הוקמו להתערבויות טיפוליות מועמד 15,16. אנחנו המצאתי פרוטוקול שילוב רומן להעריך שילובי תרופות חדשים מראש קליני, באופן שמטפל בחולשות של ההליכים נפוצים יותר מפורטים לעיל. במקום של שגשוג, יצירת מושבות, או מבחני המרת חיזור-צבע, השתמש יחידת מדידת חילוף חומרים לנתח הידבקות תא, נשימה, והחמצה בזמן אמתבמהלך תקופת הטיפול כל 17. במקביל, אנו חקרנו את ההשפעות של שילוב הטיפול בvivo באמצעות עובר עוף מודל chorioallantoic קרום (CAM) של פלישה וגרורות 18,19. אנחנו השתמשנו בשיטות אלה כדי להעריך את היכולת של מולקולת אנטיסנס קצר (ASO) מיקוד BRCA2 להגברת היעילות של ציספלטין התרופה כימותרפיות הנפוצה.

<table><tbody><tr><td>A549 cells</td><td>ATCC</td><td>CCL-185</td><td>http://www.atcc.org/products/all/CCL-185.aspx</td></tr><tr><td>AeraSeal film</td><td>Carl Roth GmbH</td><td></td><td></td></tr><tr><td>AMEM</td><td>Wisent Bioproducts</td><td>210-011-QK</td><td></td></tr><tr><td>Antisense oligodeoxynucleotides</td><td>Avecia</td><td></td><td>BRCA2 target sequence: 5&#039; - UAAGGAACGUCAAGAGAUAC - 3&#039; (bases 7241-7259 )</td></tr><tr><td>Axio Zoom V16 Microscope</td><td>Carl Zeiss</td><td></td><td>http://www.zeiss.ca/microscopy/en_ca/products/stereo-zoom-microscopes/axio-zoom-v16.html</td></tr><tr><td>Bionas Biosensor Chips</td><td>Bionas GmbH and Micronas GmbH</td><td>BIS8001D</td><td></td></tr><tr><td>Bionas Discovery 2500 System&amp;nbsp;</td><td>Bionas GmbH</td><td></td><td>http://www.bionas-discovery.com/prodservices/instruments/system2500/</td></tr><tr><td>Cisplatin</td><td>Sigma Aldrich</td><td>479306</td><td></td></tr><tr><td>Fertilized chicken eggs</td><td>Sourced locally</td><td></td><td></td></tr><tr><td>Fetal bovine serum&amp;nbsp;</td><td>Gibco - Life Technologies</td><td></td><td></td></tr><tr><td>Lipofectamine 2000&amp;nbsp;</td><td>Invitrogen - Life Technologies&amp;nbsp;</td><td>12566014</td><td>http://www.lifetechnologies.com/ca/en/home/life-science/protein-expression-and-analysis/transfection-selection/lipofectamine-2000.html</td></tr><tr><td>PBS</td><td>Wisent Bioproducts</td><td>311-010-CL</td><td></td></tr><tr><td>Trypsin (0.25%)/EDTA</td><td>Wisent Bioproducts</td><td>325-043-CL</td><td></td></tr></tbody></table>

evaluating the effectiveness of cancer drug sensitization in vitro and in vivo

בשל הרמה הגבוהה של הטרוגניות ומוטציות הגלומות בסרטן בבני אדם, טיפולי סוכן יחידים, או משטרי שילוב הממקדים את אותו המסלול, צפויים להיכשל. דגש צריך להיות ממוקם על העיכוב של מסלולים כי הם אחראים להתנגדות פנימית ו / או להתאמה לטיפול. שדה פעיל של החקירה הוא הפיתוח והבדיקה של מעכבי תיקון דנ&quot;א המקדמים את הפעולה של, ולמנוע התנגדות ל, נפוץ כימותרפיה והקרנות. אנחנו השתמשנו בפרוטוקול רומן כדי להעריך את היעילות של עיכוב BRCA2 כאמצעי לרגישות תאים סרטניים לציספלטין התרופה המזיק DNA. חילוף חומרים בתא גידול (החמצה ונשימה) היה פיקוח בזמן אמת, לתקופה של 72 שעות כדי להתוות את יעילות טיפול בדקה אחרת דקת בסיס. בשילוב, ביצענו הערכה של תדירות גרורתי באמצעות קרום עובר עוף chorioallantoic (רמ&quot;א) מודל של extravasation ופלישה. זהפרוטוקול כמה כתובות של החולשות של שימוש נפוץ במבחנה ובשיטות vivo להעריך משטרי טיפול בסרטן רומן. ניתן להשתמש בו, בנוסף לשיטות נפוצות כגון מבחני שגשוג תאים, מבחני מוות של תאים, ובמחקרי xenograft עכבריים vivo, להפלות באופן הדוק יותר בין יעדי מועמד וסוכנים, ובחר את המועמדים המבטיחים ביותר רק להמשך פיתוח.

תוצאות ונתונים מותאמים באישור העבודה שפורסמה 22. עיכוב BRCA2 גורם לירידה בנשימה בתאי גידול ציספלטין טופל תאים אנושיים ריאות A549 סרטן שטופלו ב- BRCA2 מיקוד ASO וציספלטין הציג ירידה מוקדמת ו...

Watch this Scientific Journal Video about Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo at JoVE.com

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics.

הערכת היעילות של תרופות למלחמה בסרטן רגישות<em&gt; במבחנה</em&gt; ו<em&gt; In vivo</em

Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same ...

evaluating-effectiveness-cancer-drug-sensitization-vitro

Research

JoVE Journal

Medicine

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

8.4K Views.  Western University. Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics. 

Video: Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Establishing Dual Resistance to EGFR-TKI and MET-TKI in Lung Adenocarcinoma Cells In Vitro with a 2-step Dose-escalation Procedure

Drug resistance is a major challenge in cancer therapy. The generation of resistant sublines in vitro is necessary for discovering novel mechanisms to overcome this challenge. Here, a 2-step dose-escalation method for establishing dual-resistance to an epidermal growth factor receptor (EGFR)-tyrosine kinase inhibitor (TKI), gefitinib, and a MET-TKI, PHA665752, is described. This method is based on simple stepwise dose-escalation of inhibitors for inducing acquired resistance in cell lines. The alternate method for generating resistant sublines involves exposing the cells to high concentrations of the inhibitor in one step. The stepwise dose-escalation method has a higher possibility of successfully inducing acquired resistance than this method. Activating EGFR mutations are biomarkers of a response to treatment with EGFR-TKI, which is an applied first-line treatment for non-small cell lung cancers (NSCLC) that harbor these mutations. However, despite reports of effective responses, the use of EGFR-TKI is limited because tumors inevitably acquire resistance. The major mechanisms behind EGFR-TKI resistance include a secondary mutation at the gatekeeper site, T790M in exon 20 of EGFR, and a bypass signal of MET. Thus, a potential solution for this issue would be a combination of EGFR-TKI and MET-TKI. This combined treatment has been shown to be effective in an in vitro study model. Acquired gefitinib-resistance was established through MET-amplification by stepwise dose-escalation of gefitinib for 12 months, and a cell line named PC-9MET1000 was generated in a previous study. To further investigate the mechanisms of acquired MET-TKI and EGFR-TKI resistance, a MET-TKI, PHA665752, was administered to these cells with stepwise dose-escalation in the presence of gefitinib for 12 months. This protocol has also been successfully applied for a number of combination therapies to establish acquired resistance to other inhibitor molecules.

Establishing Dual Resistance to EGFR-TKI and MET-TKI in Lung Adenocarcinoma Cells In Vitro with a 2-step Dose-escalation Procedure

An in vitro method for establishing dual resistance to an EGFR-TKI and a MET-TKI in cancer cells is described. This method is useful for developing treatments for patients with EGFR-mutations, who exhibit disease progression despite EGFR-TKI treatment with MET-amplification. It can also be modified for inhibitors targeting other molecules.

יצירת עמידות כפול EGFR-TKI ו- TKI פגש ריאות אדנוקרצינומה תאי במבחנה עם הליך דו-שלבי המינון

Drug resistance is a major challenge in cancer therapy. The generation of resistant sublines in vitro is necessary for discovering novel mechanisms to ...

Cancer Research

Preclinical Assessment of the Bioactivity of the Anticancer Coumarin OT48 by Spheroids, Colony Formation Assays, and Zebrafish Xenografts

In vitro and in vivo pre-clinical screening of novel therapeutic agents are an essential tool in cancer drug discovery. Although human cancer cell lines respond to therapeutic compounds in 2D (dimensional) monolayer cell cultures, 3D culture systems were developed to understand the efficacy of drugs in more physiologically relevant models. In recent years, a paradigm shift was observed in pre-clinical research to validate the potency of new molecules in 3D culture systems, more precisely mimicking the tumor microenvironment. These systems characterize the disease state in a more physiologically relevant manner and help to gain better mechanistic insight and understanding of the pharmacological potency of a given molecule. Moreover, with the current trend in improving in vivo cancer models, zebrafish has emerged as an important vertebrate model to assess in vivo tumor formation and study the effect of therapeutic agents. Here, we investigated the therapeutic efficacy of hydroxycoumarin OT48 alone or in combination with BH3 mimetics in lung cancer cell line A549 by using three different 3D culture systems including colony formation assays (CFA), spheroid formation assay (SFA) and in vivo zebrafish xenografts.

Here, we present the preclinical screening of anticancer coumarins using 3D culture and zebrafish.

הערכת פרה Bioactivity של OT48 נגד סרטן קומרין Spheroids, מבחני היווצרות המושבה ועל דג זברה Xenografts

In vitro and in vivo pre-clinical screening of novel therapeutic agents are an essential tool in cancer drug discovery. Although human cancer cell lines ...

Potentiation of Anticancer Antibody Efficacy by Antineoplastic Drugs: Detection of Antibody-drug Synergism Using the Combination Index Equation

Potentiation of hostile monoclonal antibodies (mAb) by chemotherapeutic agents constitutes a valuable strategy for designing effective and safer therapy against cancer. Here we provide a protocol to identify a rational combination at the preclinical step. First, we describe a cell-based assay to assess the synergism between anticancer mAb and cytotoxic drugs, that uses the combination index equation of Chou and Talalay1. This includes the measurement of tumor cell drug- and antibody-sensitivity using an MTT assay, followed by an automated computer analysis to calculate the combination index (CI) values. CI values of &lt;1 indicate synergism between tested mAbs and cytotoxic agents1. To corroborate the in vitro findings in vivo, we further describe a method to assess the combination regimen efficacy in a xenograft tumor model. In this model, the combined regimen significantly delays tumor growth, which results in a significant extended survival in comparison to single-agent controls. Importantly, the in vivo experimentation reveals that the combination regimen is well tolerated. This protocol allows the effective evaluation of anticancer drug combinations in preclinical models and the identification of rational combination to evaluate in clinical trials.

This protocol describes how to assess synergism between an anticancer antibody and antineoplastic drugs in preclinical models by using the combination index equation of Chou and Talalay.

Potentiation של נוגדנים נגד סרטן יעילות על-ידי סמים Antineoplastic: זיהוי של נוגדן תרופתיים הסינרגטיות באמצעות המשוואה אינדקס שילוב

Potentiation of hostile monoclonal antibodies (mAb) by chemotherapeutic agents constitutes a valuable strategy for designing effective and safer therapy ...

In Vitro Tumor Cell Rechallenge For Predictive Evaluation of Chimeric Antigen Receptor T Cell Antitumor Function

The field of chimeric antigen receptor (CAR) T cell therapy is rapidly advancing with improvements in CAR design, gene-engineering approaches and manufacturing optimizations. One challenge for these development efforts, however, has been the establishment of in vitro assays that can robustly inform selection of the optimal CAR T cell products for in vivo therapeutic success. Standard in vitro tumor-lysis assays often fail to reflect the true antitumor potential of the CAR T cells due to the relatively short co-culture time and high T cell to tumor ratio. Here, we describe an in vitro co-culture method to evaluate CAR T cell recursive killing potential at high tumor cell loads. In this assay, long-term cytotoxic function and proliferative capacity of CAR T cells is examined in vitro over 7 days with additional tumor targets administered to the co-culture every other day. This assay can be coupled with profiling T cell activation, exhaustion and memory phenotypes. Using this assay, we have successfully distinguished the functional and phenotypic differences between CD4+ and CD8+ CAR T cells against glioblastoma (GBM) cells, reflecting their differential in vivo antitumor activity in orthotopic xenograft models. This method provides a facile approach to assess CAR T cell potency and to elucidate the functional variations across different CAR T cell products.

Here, we describe an in vitro co-culture method to recursively challenge tumor-targeted T cells, which allows for phenotypic and functional analysis of antitumor T cell activity.

ב- Rechallenge תא הגידול חוץ גופית להערכה חזוי של Chimeric אנטיגן קולטן תא T פונקציה Antitumor

The field of chimeric antigen receptor (CAR) T cell therapy is rapidly advancing with improvements in CAR design, gene-engineering approaches and ...

Monitoring Cancer Cell Invasion and T-Cell Cytotoxicity in 3D Culture

Significant progress has been made in treating cancer with immunotherapy, although a large number of cancers remain resistant to treatment. A limited number of assays allow for direct monitoring and mechanistic insights into the interactions between tumor and immune cells, amongst which, T-cells play a significant role in executing the cytotoxic response of the adaptive immune system to cancer cells. Most assays are based on two-dimensional (2D) co-culture of cells due to the relative ease of use but with limited representation of the invasive growth phenotype, one of the hallmarks of cancer cells. Current three-dimensional (3D) co-culture systems either require special equipment or separate monitoring for invasion of co-cultured cancer cells and interacting T-cells.
Here we describe an approach to simultaneously monitor the invasive behavior in 3D of cancer cell spheroids and T-cell cytotoxicity in co-culture. Spheroid formation is driven by enhanced cell-cell interactions in scaffold-free agarose microwell casts with U-shaped bottoms. Both T-cell co-culture and cancer cell invasion into type I collagen matrix are performed within the microwells of the agarose casts without the need to transfer the cells, thus maintaining an intact 3D co-culture system throughout the assay. The collagen matrix can be separated from the agarose cast, allowing for immunofluorescence (IF) staining and for confocal imaging of cells. Also, cells can be isolated for further growth or subjected to analyses such as for gene expression or fluorescence activated cell sorting (FACS). Finally, the 3D co-culture can be analyzed by immunohistochemistry (IHC) after embedding and sectioning. Possible modifications of the assay include altered compositions of the extracellular matrix (ECM) as well as the inclusion of different stromal or immune cells with the cancer cells.

The presented approach simultaneously evaluates cancer cell invasion in 3D spheroid assays and T-cell cytotoxicity. Spheroids are generated in a scaffold-free agarose multi-microwell cast. Co-culture and embedding in type I collagen matrix are performed within the same device which allows to monitor cancer cell invasion and T-cell mediated cytotoxicity.

ניטור פלישת תאים סרטניים וcytotoxicity T-Cell בתרבות 3D

Significant progress has been made in treating cancer with immunotherapy, although a large number of cancers remain resistant to treatment. A limited ...

Profiling Sensitivity to Targeted Therapies in EGFR-Mutant NSCLC Patient-Derived Organoids

Novel 3D cancer organoid cultures derived from clinical patient specimens represent an important model system to evaluate intratumor heterogeneity and treatment response to targeted inhibitors in cancer. Pioneering work in gastrointestinal and pancreatic cancers has highlighted the promise of patient-derived organoids (PDOs) as a patient-proximate culture system, with an increasing number of models emerging. Similarly, work in other cancer types has focused on establishing organoid models and optimizing culture protocols. Notably, 3D cancer organoid models maintain the genetic complexity of original tumor specimens and thus translate tumor-derived sequencing data into treatment with genetically informed targeted therapies in an experimental setting. Further, PDOs might foster the evaluation of rational combination treatments to overcome resistance-associated adaptation of tumors in the future. The latter focuses on intense research efforts in non-small-cell lung cancer (NSCLC), as resistance development ultimately limits the treatment success of targeted inhibitors. An early assessment of therapeutically targetable mechanisms using NSCLC PDOs could help inform rational combination treatments. This manuscript describes a standardized protocol for the cell culture plate-based assessment of drug sensitivities to targeted inhibitors in NSCLC-derived 3D PDOs, with potential adaptability to combinational treatments and other treatment modalities.

This protocol describes a standardized evaluation of drug sensitivities to targeted signaling inhibitors in NSCLC patient-derived organoid models.

רגישות ליצירת פרופילים לטיפולים ממוקדים באורגנוידים שמקורם ב-EGFR-Mutant NSCLC

Novel 3D cancer organoid cultures derived from clinical patient specimens represent an important model system to evaluate intratumor heterogeneity and ...

A Combined 3D Tissue Engineered In Vitro/In Silico Lung Tumor Model for Predicting Drug Effectiveness in Specific Mutational Backgrounds

In the present study, we combined an in vitro 3D lung tumor model with an in silico model to optimize predictions of drug response based on a specific mutational background. The model is generated on a decellularized porcine scaffold that reproduces tissue-specific characteristics regarding extracellular matrix composition and architecture including the basement membrane. We standardized a protocol that allows artificial tumor tissue generation within 14 days including three days of drug treatment. Our article provides several detailed descriptions of 3D read-out screening techniques like the determination of the proliferation index Ki67 staining&#39;s, apoptosis from supernatants by M30-ELISA and assessment of epithelial to mesenchymal transition (EMT), which are helpful tools for evaluating the effectiveness of therapeutic compounds. We could show compared to 2D culture a reduction of proliferation in our 3D tumor model that is related to the clinical situation. Despite of this lower proliferation, the model predicted EGFR-targeted drug responses correctly according to the biomarker status as shown by comparison of the lung carcinoma cell lines HCC827 (EGFR -mutated, KRAS wild-type) and A549 (EGFR wild-type, KRAS-mutated) treated with the tyrosine-kinase inhibitor (TKI) gefitinib. To investigate drug responses of more advanced tumor cells, we induced EMT by long-term treatment with TGF-beta-1 as assessed by vimentin/pan-cytokeratin immunofluorescence staining. A flow-bioreactor was employed to adjust culture to physiological conditions, which improved tissue generation. Furthermore, we show the integration of drug responses upon gefitinib treatment or TGF-beta-1 stimulation - apoptosis, proliferation index and EMT - into a Boolean in silico model. Additionally, we explain how drug responses of tumor cells with a specific mutational background and counterstrategies against resistance can be predicted. We are confident that our 3D in vitro approach especially with its in silico expansion provides an additional value for preclinical drug testing in more realistic conditions than in 2D cell culture.

A Combined 3D Tissue Engineered In Vitro/In Silico Lung Tumor Model for Predicting Drug Effectiveness in Specific Mutational Backgrounds

We present a three-dimensional (3D) lung cancer model based on a biological collagen scaffold to study sensitivity towards non-small-cell-lung-cancer-(NSCLC)-targeted therapies. We demonstrate different read-out techniques to determine the proliferation index, apoptosis and epithelial-mesenchymal transition (EMT) status. Collected data are integrated into an in silico model for prediction of drug sensitivity.

רקמת 3D משולב תכנון הנדסי<em&gt; במבחנה</em&gt; /<em&gt; סיליקו</em&gt; דגם גידול ריאות לניבוי יעילות טיפול תרופתי רקעים מוטציוני ספציפיים

In the present study, we combined an in vitro 3D lung tumor model with an in silico model to optimize predictions of drug response based on a specific ...

Bioengineering

In Vitro and In Vivo Evaluation of Photocontrolled Biologically Active Compounds - Potential Drug Candidates for Cancer Photopharmacology

Photocontrolled, biologically active compounds are an emerging class of &#34;smart&#34; drug candidates. They provide additional safety in systemic chemotherapy due to their precise spatiotemporal activation by directing a benign, non-ionizable light to a specific location within the patient&#39;s body. This paper presents a set of methods to evaluate the in vitro potency and ex vivo efficiency of the photoactivation of photocontrolled, biologically active compounds as well as the in vivo efficacy at early stages of drug development. The methodology is applied to anticancer cytotoxic peptides, namely, the diarylethene-containing analogs of a known antibiotic, gramicidin S. The experiments are performed using 2D (adherent cells) and 3D (spheroids) cell cultures of a cancer cell line (Lewis lung carcinoma, LLC), live tissue surrogates (pork meat mince), and an allograft cancer model (subcutaneous LLC) in immunocompetent mice. The selection of the most effective compounds and estimation of realistic phototherapeutic windows are performed via automated fluorescence microscopy. The photoactivation efficiency at varying illumination regimens is determined at different depths in a model tissue, and the optimal light dosage is applied in the final therapeutic in vivo experiment.

In Vitro and In Vivo Evaluation of Photocontrolled Biologically Active Compounds - Potential Drug Candidates for Cancer Photopharmacology

This protocol presents a set of experiments adopted for the evaluation of photoswitchable anticancer peptides, that can be used in the preclinical screening of such compounds. This includes cytotoxicity assessment in 2D and 3D cell cultures, the evaluation of ex vivo (model tissue) photoisomerization efficiency, and in vivo efficacy.

הערכה חוץ גופית ו-in vivo של תרכובות פעילות ביולוגיות מבוקרות - תרופות מועמדות פוטנציאליות לפוטופרמקולוגיה של סרטן

Photocontrolled, biologically active compounds are an emerging class of &#34;smart&#34; drug candidates. They provide additional safety in systemic ...

Chemistry

An Organotypic High Throughput System for Characterization of Drug Sensitivity of Primary Multiple Myeloma Cells

In this work we describe a novel approach that combines ex vivo drug sensitivity assays and digital image analysis to estimate chemosensitivity and heterogeneity of patient-derived multiple myeloma (MM) cells. This approach consists in seeding primary MM cells freshly extracted from bone marrow aspirates into microfluidic chambers implemented in multi-well plates, each consisting of a reconstruction of the bone marrow microenvironment, including extracellular matrix (collagen or basement membrane matrix) and stroma (patient-derived mesenchymal stem cells) or human-derived endothelial cells (HUVECs). The chambers are drugged with different agents and concentrations, and are imaged sequentially for 96 hr through bright field microscopy, in a motorized microscope equipped with a digital camera. Digital image analysis software detects live and dead cells from presence or absence of membrane motion, and generates curves of change in viability as a function of drug concentration and exposure time. We use a computational model to determine the parameters of chemosensitivity of the tumor population to each drug, as well as the number of sub-populations present as a measure of tumor heterogeneity. These patient-tailored models can then be used to simulate therapeutic regimens and estimate clinical response.

We describe a high-throughput drug sensitivity assay for primary multiple myeloma cells. It consists of a reconstruction of the bone marrow microenvironment (including extracellular matrix and stroma) in multi-well plates, and a non-invasive method for longitudinal quantification of cell viability.

מערכת תפוקה Organotypic גבוהה לאפיון של תרופות רגישות של תאי מיאלומה נפוצה ראשיים

In this work we describe a novel approach that combines ex vivo drug sensitivity assays and digital image analysis to estimate chemosensitivity and ...

Assessing Specificity of Anticancer Drugs In Vitro

A procedure for assessing specificity of anticancer drugs in vitro using cultures containing both tumor and non-tumor cells is demonstrated. The key element is the quantitative determination of a tumor-specific genetic alteration in relation to a universal sequence using a dual-probe digital PCR assay and the subsequent calculation of the proportion of tumor cells. The assay is carried out on a culture containing tumor cells of an established line and spiked-in non-tumor cells. The mixed culture is treated with a test drug at various concentrations. After the treatment, DNA is prepared directly from the survived adhesive cells in wells of 96-well plates using a simple and inexpensive method, and subjected to a dual-probe digital PCR assay for measuring a tumor-specific genetic alteration and a reference universal sequence. In the present demonstration, a heterozygous deletion of the NF1 gene is used as the tumor-specific genetic alteration and a RPP30 gene as the reference gene. Using the ratio NF1/RPP30, the proportion of tumor cells was calculated. Since the dose-dependent change of the proportion of tumor cells provides an in vitro indication for specificity of the drug, this genetic and cell-based in vitro assay will likely have application potential in drug discovery. Furthermore, for personalized cancer-care, this genetic- and cell-based tool may contribute to optimizing adjuvant chemotherapy by means of testing efficacy and specificity of candidate drugs using primary cultures of individual tumors.

Assessing Specificity of Anticancer Drugs In Vitro

The goal of this protocol is to assess specificity of anticancer drugs in vitro using mixed cultures containing both tumor and non-tumor cells.

הערכה ספציפית של תרופות נגד הסרטן<em&gt; במבחנה</em

A procedure for assessing specificity of anticancer drugs in vitro using cultures containing both tumor and non-tumor cells is demonstrated. The key ...

הערכת היעילות של תרופות למלחמה בסרטן רגישות

Summary

Explore More Videos

Chapters in this video