עבודה זו התאפשרה על ידי מענקים לJK ממרכזי אונטריו של אקסלנס וקרן המחקר לאונטריו. ברצוננו להודות לSiddika Pardhan וד&quot;ר פיטר פרגוסון לקבלת סיוע טכני בזמן צילומים.

הערה: הפרוטוקול הבא נועד לשימוש עם תאים חסיד. שינויים נדרשים ליישם את השיטה שלאינם חסיד תאים שגודלו בהשעיה. ניסויי CAM המתוארים בפרוטוקול מיועד לשימוש עם תאים המבטאים את סמן פלואורסצנטי (למשל, GFP, RFP, וכו &#39;). עוברי עוף בן תשעה יום נדרשים ביום 2 לפרוטוקול הניסוי לניסויי CAM. 1. הכנה וTransfection של תאים סרטניים עם Oligonucleotides antisense (ASOs) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בינוני לשאוב מבקבוק T75 (ים) המכיל תאים של עניין, לשטוף עם 1XPBS, ולהוסיף 2 מיליליטר של 0.25% טריפסין / EDTA. הוסף 10 מיליליטר של מדיום גידול מלא לכל בקבוק ולהעביר את התאים בפתרון לשפופרת 50 מיליליטר. ספירת התאים ולהתאים את עוצמת הקול, כך שהריכוז הסופי הוא 1.0x10 5 תאים לכל מיליליטר. </li><li style=";text-align:right;direction:rtl"> תווית שתי קבוצות של צלוחיות T25: קבוצה אחת תכיל שמונה צלוחיות, שכותרתו 1-8, ויהיה uSED לניסוי מדידת חילוף חומרים בזמן אמת; והקבוצה השנייה גם תכיל 8 צלוחיות ותשמש לניסוי CAM עובר עוף. הוסף 2 מיליליטר של תאים בפתרון לכל בקבוק ומקום בחממה (37 ° C, 5% CO 2 O / N). </li><li style=";text-align:right;direction:rtl"> למחרת בבוקר (יום 0, הזמן 0), תווית שלושה 5 מיליליטר צינורות כדלקמן: (ASO ללא מיקוד או siRNA) שליטה, &quot;היעד של עניין&quot; (כלומר, ASO מיקוד או siRNA), וLipofectamine 2000 (או דומה מגיב transfection). לדלל את פתרונות המניות ASO לריכוז המתאים עם מדיום חופשי בסרום בצינור המתאים. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להוסיף את הסכום הנדרש של מגיב transfection לצינור המתאים ודגירה במדיום סרום ללא למשך 5 דקות. מוסיף את הפתרון מגיב transfection לצינורות ASO דגירה במשך 20 דקות. </li></ol></li><li style=";text-align:right;direction:rtl"> הוסף 250 μl של פתרון מגיב transfection שליטת ASO לכל אחד מצלוחיות 1-4 בכל קבוצה, ו- 250μl של פתרון &quot;היעד של עניין&quot; ASO מגיב transfection לכל אחד מצלוחיות 5-8 בכל קבוצה. דגירה של 4 שעות (37 ᵒC, 5% CO 2). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> במהלך דגירה, לבצע את הפעולות מתוארות בסעיף 2.1. לאחר הדגירה, להוסיף 3 מיליליטר של מדיום מלא לכל בקבוק בקבוצת ניסוי CAM ולחזור לO החממה / N (37 ᵒC, 5% CO 2). לעבד את קבוצת ניסוי חילוף חומרים לפי התיאור בסעיף 2.2. לעבד את ניסוי CAM נקבע לפי התיאור בסעיף 4. </li></ol></li></ol> 2. biosensor צ&#39;יפ הכנה וזריעת תאים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בסביבת סטרילית, בזהירות לשטוף שישה שבבי biosensor עם 400 μl של PBS. לעקר את השבבים עם 400 μl של 70% אתנול עבור 20 דקות. לשטוף שלוש פעמים עם 400 μl של PBS. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מניחים את השבבים בתוך cultur רקמות סטרילייםמנות דואר על מנת למנוע זיהום. הנח שלושה שבבים בצלחת שכותרתו &quot;שליטה&quot;, ושלוש בצלחת שכותרתו &quot;יעד של עניין&quot;. </li></ol></li><li style=";text-align:right;direction:rtl"> תווית שני צינורות 50 מיליליטר כ &#39;שליטה&#39; ו &#39;יעד של עניין &quot;. לשטוף את התאים עם PBS ולהוסיף נפח מתאים של 0.25% טריפסין / EDTA. חכה עד שמתנתק monolayer ולאסוף את התאים מבקבוק אחד. להפקיד את הפתרון לתוך הצינור המתאים. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ספירת התאים ולהתאים את עוצמת הקול, כך שהריכוז הסופי הוא 6.0x10 5 תאים / מיליליטר. צנטריפוגה ו resuspend התאים אם הריכוז הראשוני הוא נמוך מדי. </li></ol></li><li style=";text-align:right;direction:rtl"> הוסף 250 μl של פתרון התא לכל שבב biosensor בקבוצה המתאימה (עבור הסכום כולל של 1.25x10 5 תאים לכל שבב). בצע קבוצה אחת המשימה זו בכל פעם כדי למזער את הסיכון של מבלבל את השבבים. מניחים את הכלים סטריליים המכילים שבבים בתוך תא לחות על מנת למנוע אידוי, ולמקם את צ&#39;ה לחותmber בחממה O / N (37 ᵒC, 5% CO 2). </li><li style=";text-align:right;direction:rtl"> למחרת בבוקר (יום 1), לשאוב בזהירות בינונית מכל שבב ולהחליף אותו עם 250 μl של מדיום גידול בתוספת סרום 0.2% שור עוברי (FBS) ו1x פניצילין וסטרפטומיצין (P / S). דגירה של 4 שעות (37 ᵒC, 5% CO 2). </li></ol> הכנת מערכת 3. מטבוליזם מדידה ופתרון הכנה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> במהלך הדגירה, להכין את הפתרונות הנדרשים סמים ומערכת מדידת חילוף חומרים לassay הקרוב. הערה: מערכת מדידת חילוף חומרים מכילה בסך הכל שישה מודולים. כל מודול מכיל שבב אחד לכל ניסוי. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לחלק את assay לקבוצות הניסוי הבא: שבב אחד מכל אחת מ&#39;השליטה &#39;ו&#39; היעד של העניין &quot;קבוצות לקבל רכב למשך assay; שני שבבים מכל קבוצה על מנת לקבל טיפול תרופתי לתקופה מוגדרת של זמן במהלךssay, ואחריו רכב במהלך תקופת המתנה. </li><li style=";text-align:right;direction:rtl"> ללימודי רגישות סמים, לשנות את האורך, עיתוי, וריכוז של טיפול תרופתי כדי להתאים את התרופה המסוימת בשאלה. הערה: לציספלטין, השלבים הבאים נקבעו באופן אמפירי עם תאי A549, ועשויה להשתנות בהתאם לשורת תאים. לבצע את כל השלבים עם קצב זרימת ברירת המחדל של 4 μl / min. 6 שעות של מדיום + FBS 0.2% הצמיחה ו1x P / S 24 שעות של 6 מיקרומטר ציספלטין במדיום + 0.2% FBS 1x P / S 24 שעות של מדיום + FBS 0.2% הצמיחה ו1x P / S 18 שעות של מדיום + FBS 0.2% הצמיחה ו1x P / S 4 שעות של 0.1% Triton-X הערה: סטיות מהפעולות הבאות תדרוש חישוב כדי לקבוע את הנפח הנדרש של פתרונות בינוניים ותרופה המבוססת על קצב הזרימה ומשך הניסוי הרצויים. הסעיפים שלהלן מבוססים על הצעדים שתוארו לעיל. </li></ol></li><li style=";text-align:right;direction:rtl"> תווית ולמלא ארבע עשרה צינורות 50 מיליליטר עם 50 מיליליטר של 0.2% FBS מדיום גידולד 1x P / S. מניחים שישה במתלות צינור מערכת מדידת חילוף חומרים אחד, שש באחר, ושני הנותרים במתלים צינור שלישי שמכיל גם צינורות עם ציספלטין. לאטום את שני המדפים הראשונים עם קרום חדיר אוויר על מנת למנוע אידוי. </li><li style=";text-align:right;direction:rtl"> הכן פתרון של 6 ציספלטין מיקרומטר (בנפח המתאים) בFBS + 0.2% בינוניים עם 1x P / S. לוותר הנפח הנדרש של פתרון ציספלטין לארבעה 50 מיליליטר צינורות שכותרתו. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מניחים את הצינורות בארבעת חריצים שנותרו במתל צינור מדידת חילוף חומרים שלישיים. ודא שהצינורות ממוקמים בחריצים המתאימים שמתאימים לbiomodules הרצוי. לאטום את הצינורות עם קרום חדיר אוויר. </li></ol></li><li style=";text-align:right;direction:rtl"> הכן ולתייג שישה צינורות 50 מיליליטר ולמלא אותם עם 20 מיליליטר כל אחד מ0.1% פתרון Triton-X במדיום. פתרון Triton-X יהיה lyse כל תאים הנותרים ולספק ערך &#39;אפס&#39; לכל שבב. מניחים את הצינורות במתלים צינור יחידת מדידת חילוף החומרים רביעי ולאטום שנינותh קרום permable אוויר על מנת למנוע אידוי מוגזם. </li><li style=";text-align:right;direction:rtl"> טען את השבבים לbiomodules וליזום את הניסוי. </li></ol> ניסוי CAM 4. טיפול תרופתי והזרקה הערה: השלבים והליך הכנת עוברי עופות לניסוי CAM מתוארים במקום אחר 19 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בגין עיבוד CAM ניסוי 48 לאחר transfection שעות (יום 2). תת-לחלק את &quot;שליטה&quot; ו- &quot;היעד של העניין&quot; קבוצות לשתי צלוחיות לרכב, ושניים לציספלטין. לשאוב את המדיום מהצלוחיות ולחדש עם או 3 מיליליטר של מדיום חדש, או 6 מיקרומטר ציספלטין. דגירה של 6 שעות (37 ᵒC, 5% CO 2). </li><li style=";text-align:right;direction:rtl"> לשאוב את המדיום, ולאחר מכן לשטוף וtrypsinize התאים; לאסוף את תאי trypsinized בפתרון לארבעה 15 מיליליטר צינורות שכותרתו כראוי. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> צנטריפוגה ולשטוף את התאים שלוש פעמים עם PBS. להשעות מחדש את התא גלולה ב 5 מיליליטר של PBSd לספור את התאים. </li><li style=";text-align:right;direction:rtl"> כוון את עוצמת הקול, כך שריכוז התא הסופי הוא 1.0x10 6 תאים / מיליליטר. מעביר את פתרון התא לתוך 5 מיליליטר צינורות שכותרתו להזרקה, ומניח על קרח. להפוך את הצינורות בעדינות לפני הזרקה כדי להבטיח שהתאים מתערבבים היטב. </li></ol></li><li style=";text-align:right;direction:rtl"> להפריש סכום כולל של 24 עוברי עופות (בן 9 ימים) להזרקה (6 בכל קבוצה). לבצע ההזרקה באמצעות מחט זכוכית מחוברת לצינור גמיש מחובר למזרק 1 מיליליטר. פרט ביצוע ההזרקה צריך להיות עיוור כדי קבוצת הטיפול. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> באמצעות מיקרוסקופ סטריאו, להזריק 1.0x10 5 תאים בנפח של 100 μl למחזור דם הוורידים של CAM. השתמש בטכניקה איטית, פועמת להזריק נפח המלא של תאים. בעדינות טיפת אתר ההזרקה עם רך לנגב לבלום את זרימת הדם ולספוג כל דליפה. כל תווית מיכל עובר כראוי לאחר כל הזרקה. </li></ol></li><li style=";text-align:right;direction:rtl"> לאשר את קיומו וdistribution של תאי ניאון בכלי הדם של CAM לאחר הזרקה על ידי הדמיתם באמצעות מיקרוסקופ פלואורסצנטי. שימו לב לכל עוברים בו המספר של תאים סרטניים נראה נמוך, או ההפצה היא עניה. </li><li style=";text-align:right;direction:rtl"> מניחים את עוברי העוף בתא לחות ולאחסן אותם בחממה (37 ° C, לחות 60%). חכה 7-9 ימים לפני ספירת מוקדים גרורתי. </li></ol> 5. גרורתי פוקוס ספירה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> במהלך תקופת הדגירה 7-9 היום, לפקח על העוברים וזורקים כל מתים. ודא שתא לחות נותר לח בכל העת במהלך תקופת הדגירה. </li><li style=";text-align:right;direction:rtl"> באמצעות מיקרוסקופ סטריאו ניאון בהגדלה 20X, לסרוק את כל פני השטח העליונים של CAM העובר בדפוס קבוע, כמו רשת. </li><li style=";text-align:right;direction:rtl"> לספור את מספר המוקדים גרורתי בכל שדה הראייה, ואז עולה בקנה אחד המספר לסך סופי לכל עובר. עושה זאת במשך ששת העוברים בכל קבוצה תספק o מספר ממוצעתמוקדים גרורתי f לכל טיפול. </li></ol>

<ol>
	<li>Bouwman, P., Jonkers, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+deregulated+DNA+damage+signalling+on+cancer+chemotherapy+response+and+resistance.">The effects of deregulated DNA damage signalling on cancer chemotherapy response and resistance.</a> Nat Rev Cancer. 12, 587-598 (2012).</li><li>Bozic, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+dynamics+of+cancer+in+response+to+targeted+combination+therapy.">Evolutionary dynamics of cancer in response to targeted combination therapy.</a> Elife. 2, e00747 (2013).</li><li>Diaz, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+evolution+of+acquired+resistance+to+targeted+EGFR+blockade+in+colorectal+cancers.">The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers.</a> Nature. 486, 537-540 (2012).</li><li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+BRCA2+and+Thymidylate+Synthase+Creates+Multidrug+Sensitive+Tumor+Cells+via+the+Induction+of+Combined+'Complementary+Lethality'.">Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined 'Complementary Lethality'.</a> Mol Ther Nucleic Acids. 2, e78 (2013).</li><li>Lord, C. J., Ashworth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA+damage+response+and+cancer+therapy.">The DNA damage response and cancer therapy.</a> Nature. 481, 287-294 (2012).</li><li>Helleday, T., Petermann, E., Lundin, C., Hodgson, B., Sharma, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+repair+pathways+as+targets+for+cancer+therapy.">DNA repair pathways as targets for cancer therapy.</a> Nat Rev Cancer. 8, 193-204 (2008).</li><li>Shaheen, M., Allen, C., Nickoloff, J. A., Hromas, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+lethality:+exploiting+the+addiction+of+cancer+to+DNA+repair.">Synthetic lethality: exploiting the addiction of cancer to DNA repair.</a> Blood. 117, 6074-6082 (2011).</li><li>Green, S., Benedetti, J., Smith, A., Crowley, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Clinical trials in oncology. 28, (2012).</li><li>Begley, C. G., Ellis, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drug+development:+Raise+standards+for+preclinical+cancer+research.">Drug development: Raise standards for preclinical cancer research.</a> Nature. 483, 531-533 (2012).</li><li>Galluzzi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+definitions+of+cell+death+subroutines:+recommendations+of+the+Nomenclature+Committee+on+Cell+Death+2012.">Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012.</a> Cell Death Differ. 19, 531-533 (2012).</li><li>Ruggeri, B. A., Camp, F., Miknyoczki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+disease:+pre-clinical+animal+models+of+cancer+and+their+applications+and+utility+in+drug+discovery.">Animal models of disease: pre-clinical animal models of cancer and their applications and utility in drug discovery.</a> Biochem Pharmacol. 87, 150-161 (2014).</li><li>Kwon, M. C., Berns, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+for+lung+cancer.">Mouse models for lung cancer.</a> Mol Oncol. 7, 165-177 (2013).</li><li>Young, M., Ordonez, L., Clarke, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+are+the+best+routes+to+effectively+model+human+colorectal+cancer.">What are the best routes to effectively model human colorectal cancer.</a> Mol Oncol. 7, 178-189 (2013).</li><li>Sharma, S. V., Haber, D. A., Settleman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-based+platforms+to+evaluate+the+therapeutic+efficacy+of+candidate+anticancer+agents.">Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents.</a> Nat Rev Cancer. 10, 241-253 (2010).</li><li>Garnett, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+genomic+markers+of+drug+sensitivity+in+cancer+cells.">Systematic identification of genomic markers of drug sensitivity in cancer cells.</a> Nature. 483, 570-575 (2012).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+monitoring+of+cisplatin-induced+cell+death.">Real-time monitoring of cisplatin-induced cell death.</a> PLoS One. 6, e19714 (2011).</li><li>Cvetkovic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KISS1R+induces+invasiveness+of+estrogen+receptor-negative+human+mammary+epithelial+and+breast+cancer+cells.">KISS1R induces invasiveness of estrogen receptor-negative human mammary epithelial and breast cancer cells.</a> Endocrinology. 154, 1999-2014 (2013).</li><li>Leong, H. S., Chambers, A. F., Lewis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessing+cancer+cell+migration+and+metastatic+growth+in+vivo+in+the+chick+embryo+using+fluorescence+intravital+imaging.">Assessing cancer cell migration and metastatic growth in vivo in the chick embryo using fluorescence intravital imaging.</a> Methods Mol Biol. 872, 1-14 (2012).</li><li>Hung, Y. P., Albeck, J. G., Tantama, M., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+cytosolic+NADH-NAD(+)+redox+state+with+a+genetically+encoded+fluorescent+biosensor.">Imaging cytosolic NADH-NAD(+) redox state with a genetically encoded fluorescent biosensor.</a> Cell Metab. 14, 545-554 (2011).</li><li>Tantama, M., Hung, Y. P., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+intracellular+pH+in+live+cells+with+a+genetically+encoded+red+fluorescent+protein+sensor.">Imaging intracellular pH in live cells with a genetically encoded red fluorescent protein sensor.</a> J Am Chem Soc. 133, 10034-10037 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BRCA2+inhibition+enhances+cisplatin-mediated+alterations+in+tumor+cell+proliferation,+metabolism,+and+metastasis.">BRCA2 inhibition enhances cisplatin-mediated alterations in tumor cell proliferation, metabolism, and metastasis.</a> Mol. Onc. 8 (8), 1429-1440 (2014).</li></ol>

יש לי המחברים אין לחשוף.

בשל העלות הכרוכה והסיכון כרוך בניסויים קליניים, יש צורך לפתח טוב יותר ויותר מחמיר מתודולוגיית בדיקות פרה-קלינית להעריך כראוי משטרי טיפול אנטי-סרטני רומן. שיטות קיימים כיום נפוצה בשימוש כל חולשות התערוכה שעלולה להגביל את היכולת שלהם להבחין בין מטרות / סוכנים טיפוליי?...

רכש התנגדות לממוקדת ו / או טיפול בסרטן ציטוטוקסיות היא בעיה קלינית חשובה שיכול להוביל לכישלון טיפול, התקפים, והגדיל את תמותת חולה 1. על רקע הרמה הגבוהה של ההטרוגניות ברוב הגידולים, זה ודאות מתמטית שגידול של מספר תאים גבוה מספיק יכיל תת-קבוצה של תאים עמידים לטיפולים בודדים או בשילוב מיקוד מסלולים מולקולריים שבו תאים אלה תלויים להישרדות 2,3. תאי גידול מסוג זה יכול להיות שנבחר באופן חיובי לטיפול ב, שמוביל להישנות מחלה. פיתוח של טיפולים חדשניים שבו זמנית למקד מנגנוני הישרדות של תאי הסרטן שונים, לפני או אחרי בחירה בתיווך טיפול, לכן חשוב מבחינה קלינית. רמה גבוהה של חוסר יציבות הגנום ומוטציה בגנומים גידול היא מאפיין בסיסי שמבדיל את התאים סרטניים לתאי מארח שאינו סרטני 4. כתוצאה מכך, usefuאסטרטגית l כדי להגדיל את האפקטיביות של כימותרפיה פוגע ב- DNA ולמנוע את התפתחותה של התנגדות היא לעכב באופן פעיל בתיקון ה- DNA בתאי גידול 5. זהו שדה פעיל של חקירה ומגוון רחב של יעדי תיקון DNA רומן נבדקים בסביבה פרה-קלינית. מספר המולקולה קטנה או המעכבים מבוססי antisense של מטרות אלו פותחו ועוברים בדיקת 6-8. המטרה היא לזהות את המועמדים פרה-קליניים המבטיחים ביותר ולהעריך את הבטיחות והיעילות שלהם בניסויים קליניים. העלות הגבוהה של ניסויים קליניים ואת הסיכון לכשל (עבור מגוון רחב של סיבות, כולל הערכה טרום-קלינית תת-אופטימלי) הם מכשולים אדירים להתקדמות בפיתוח הטיפולים החדשים 9. השימוש במודלים מתאימים וקפדניים פרה-קליניים להעריך כראוי חדש מטרות טיפוליות ותרופות מועמד עלול להפחית את שיעור כישלון הגבוה של ניסויים קליניים 10 </sup&gt;. כמה שיטות פרה-קליניות נפוצה בשימוש כדי להעריך את היעילות של טיפולים אנטי-סרטני רומן הם: א) מדידה של היכולת להפחית שגשוג תאים סרטניים במבחנה (מבחני התפשטות תאים), ב) הפחתה מושרה טיפול בקיבולת של תאי גידול ל מושבות בתרבית רקמת טופס (מבחני הקמת מושבה), ג) הפחתה מושרה טיפול בפעילות המטבולית של תאי גידול במבחנה (המרה חיזור-צבע), ד) אינדוקציה מושרה טיפול של מוות של תאים סרטניים במבחנה (אפופטוטיים, נימקי, autophagic, הקשורים עם מיטוזה ואחרים) 11, וה) in vivo טיפול-induced הפחתה של צמיחה או אבלציה של xenografts אדם והעכבר 12-14. חולשה העיקרית של מבחנה השיטות המפורטות בהיא שאף אחד מהם לספק הערכה בזמן אמת מתמשכת של השפעת טיפולי מועמד. במקום זאת, הם מספקים מידע רק בנקודתי זמן שנבחרו באופן נרחב מופרדים,במהלך הטיפול. מדידות כאלה הצטמצמו יכולת לשקף את העוצמה ועיתוי של תגובות תאים סרטניים בצורה מדויקת. בvivo מודלים xenograft העכבר מוגבלים גם על ידי עלות גבוהה, משך זמן להשלמת, וסיכון של עיתוי אופטימלי מינון וטיפול (תזמון). בנוסף, יש ראיות לכך שמודלי xenograft המכרסמים הם מנבאים מוגבלים של יעילות קלינית בבני אדם, בהשוואה להערכה במבחנה של תגובות של תאים סרטניים אנושיים ראשוניים ושורות תאי גידול אנושי הוקמו להתערבויות טיפוליות מועמד 15,16. אנחנו המצאתי פרוטוקול שילוב רומן להעריך שילובי תרופות חדשים מראש קליני, באופן שמטפל בחולשות של ההליכים נפוצים יותר מפורטים לעיל. במקום של שגשוג, יצירת מושבות, או מבחני המרת חיזור-צבע, השתמש יחידת מדידת חילוף חומרים לנתח הידבקות תא, נשימה, והחמצה בזמן אמתבמהלך תקופת הטיפול כל 17. במקביל, אנו חקרנו את ההשפעות של שילוב הטיפול בvivo באמצעות עובר עוף מודל chorioallantoic קרום (CAM) של פלישה וגרורות 18,19. אנחנו השתמשנו בשיטות אלה כדי להעריך את היכולת של מולקולת אנטיסנס קצר (ASO) מיקוד BRCA2 להגברת היעילות של ציספלטין התרופה כימותרפיות הנפוצה.

<table border="0" cellpadding="0" cellspacing="0" >
	<tbody>
		<tr >
			<td >Name of Material/ Equipment</td>
			<td >Company</td>
			<td >Catalog Number</td>
			<td >Comments/Description</td>
		</tr>
		<tr >
			<td >A549 cells</td>
			<td >ATCC</td>
			<td >CCL-185</td>
			<td>http://www.atcc.org/products/all/CCL-185.aspx</td>
		</tr>
		<tr >
			<td >AeraSeal film&#160;</td>
			<td >Carl Roth GmbH</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >AMEM</td>
			<td >Wisent Bioproducts</td>
			<td >210-011-QK</td>
			<td></td>
		</tr>
		<tr >
			<td >Antisense oligodeoxynucleotides</td>
			<td >Avecia</td>
			<td ></td>
			<td>BRCA2 target sequence: 5&#39; - UAAGGAACGUCAAGAGAUAC - 3&#39; (bases 7241-7259 )</td>
		</tr>
		<tr >
			<td >Axio Zoom V16 Microscope</td>
			<td >Carl Zeiss</td>
			<td ></td>
			<td>http://www.zeiss.ca/microscopy/en_ca/products/stereo-zoom-microscopes/axio-zoom-v16.html</td>
		</tr>
		<tr >
			<td >Bionas Biosensor Chips</td>
			<td >Bionas GmbH and Micronas GmbH</td>
			<td >BIS8001D</td>
			<td></td>
		</tr>
		<tr >
			<td >Bionas Discovery 2500 System&#160;</td>
			<td >Bionas GmbH</td>
			<td ></td>
			<td>http://www.bionas-discovery.com/prodservices/instruments/system2500/</td>
		</tr>
		<tr >
			<td >Cisplatin</td>
			<td >Sigma Aldrich</td>
			<td >479306</td>
			<td></td>
		</tr>
		<tr >
			<td >Fertilized chicken eggs</td>
			<td >Sourced locally</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Fetal bovine serum&#160;</td>
			<td >Gibco - Life Technologies</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Lipofectamine 2000&#160;</td>
			<td >Invitrogen - Life Technologies&#160;</td>
			<td >12566014</td>
			<td>http://www.lifetechnologies.com/ca/en/home/life-science/protein-expression-and-analysis/transfection-selection/lipofectamine-2000.html</td>
		</tr>
		<tr >
			<td >PBS</td>
			<td >Wisent Bioproducts</td>
			<td >311-010-CL</td>
			<td></td>
		</tr>
		<tr >
			<td >Trypsin (0.25%)/EDTA</td>
			<td >Wisent Bioproducts</td>
			<td >325-043-CL</td>
			<td></td>
		</tr>
	</tbody>
</table>

evaluating the effectiveness of cancer drug sensitization in vitro and in vivo

בשל הרמה הגבוהה של הטרוגניות ומוטציות הגלומות בסרטן בבני אדם, טיפולי סוכן יחידים, או משטרי שילוב הממקדים את אותו המסלול, צפויים להיכשל. דגש צריך להיות ממוקם על העיכוב של מסלולים כי הם אחראים להתנגדות פנימית ו / או להתאמה לטיפול. שדה פעיל של החקירה הוא הפיתוח והבדיקה של מעכבי תיקון דנ&quot;א המקדמים את הפעולה של, ולמנוע התנגדות ל, נפוץ כימותרפיה והקרנות. אנחנו השתמשנו בפרוטוקול רומן כדי להעריך את היעילות של עיכוב BRCA2 כאמצעי לרגישות תאים סרטניים לציספלטין התרופה המזיק DNA. חילוף חומרים בתא גידול (החמצה ונשימה) היה פיקוח בזמן אמת, לתקופה של 72 שעות כדי להתוות את יעילות טיפול בדקה אחרת דקת בסיס. בשילוב, ביצענו הערכה של תדירות גרורתי באמצעות קרום עובר עוף chorioallantoic (רמ&quot;א) מודל של extravasation ופלישה. זהפרוטוקול כמה כתובות של החולשות של שימוש נפוץ במבחנה ובשיטות vivo להעריך משטרי טיפול בסרטן רומן. ניתן להשתמש בו, בנוסף לשיטות נפוצות כגון מבחני שגשוג תאים, מבחני מוות של תאים, ובמחקרי xenograft עכבריים vivo, להפלות באופן הדוק יותר בין יעדי מועמד וסוכנים, ובחר את המועמדים המבטיחים ביותר רק להמשך פיתוח.

תוצאות ונתונים מותאמים באישור העבודה שפורסמה 22. עיכוב BRCA2 גורם לירידה בנשימה בתאי גידול ציספלטין טופל תאים אנושיים ריאות A549 סרטן שטופלו ב- BRCA2 מיקוד ASO וציספלטין הציג ירידה מוקדמת ו...

Watch this Scientific Journal Video about Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo at JoVE.com

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics.

הערכת היעילות של תרופות למלחמה בסרטן רגישות<em&gt; במבחנה</em&gt; ו<em&gt; In vivo</em

Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same ...

evaluating-effectiveness-cancer-drug-sensitization-vitro

Research

JoVE Journal

Medicine

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

8.2K Views.  Western University. Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics. 

Video: Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent until many years after removal of the primary tumor and adjuvant therapy. A likely explanation of this phenomenon is that tumor cells have seeded metastatic sites, are resistant to conventional therapies, and remain dormant for long periods of time 1-4.
The existence of dormant cancer cells at secondary sites has been described previously as quiescent solitary cells that neither proliferate nor undergo apoptosis 5-7. Moreover, these solitary cells has been shown to disseminate from the primary tumor at an early stage of disease progression 8-10 and reside growth-arrested in the patients' bone marrow, blood and lymph nodes 1,4,11. Therefore, understanding mechanisms that regulate dormancy or the switch to a proliferative state is critical for discovering novel targets and interventions to prevent disease recurrence. However, unraveling the mechanisms regulating the switch from tumor dormancy to metastatic growth has been hampered by the lack of available model systems.
in vivo and ex vivo model systems to study metastatic progression of tumor cells have been described previously 1,12-14. However these model systems have not provided in real time and in a high throughput manner mechanistic insights into what triggers the emergence of solitary dormant tumor cells to proliferate as metastatic disease. We have recently developed a 3D in vitro system to model the in vivo growth characteristics of cells that exhibit either dormant (D2.OR, MCF7, K7M2-AS.46) or proliferative (D2A1, MDA-MB-231, K7M2) metastatic behavior in vivo . We demonstrated that tumor cells that exhibit dormancy in vivo at a metastatic site remain quiescent when cultured in a 3-dimension (3D) basement membrane extract (BME), whereas cells highly metastatic in vivo readily proliferate in 3D culture after variable, but relatively short periods of quiescence. Importantly by utilizing the 3D in vitro model system we demonstrated for the first time that the ECM composition plays an important role in regulating whether dormant tumor cells will switch to a proliferative state and have confirmed this in in vivo studies15-17. Hence, the model system described in this report provides an in vitro method to model tumor dormancy and study the transition to proliferative growth induced by the microenvironment.

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

A modified 3-D in vitro system is presented in which growth characteristics of several tumor cell lines in reconstituted basement membrane correlate with the dormant or proliferative behavior of the tumor cells at a metastatic secondary site in vivo.

במבחנה מערכת לחקר תרדמת גידול ואת החלף ל גידול גרורתי

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent ...

Live Imaging of Drug Responses in the Tumor Microenvironment in Mouse Models of Breast Cancer

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional co-culture systems are frequently used to explicate tumor-stroma interactions, including their role in drug responses. However, many of the interactions that occur in vivo in the intact microenvironment cannot be completely replicated in these in vitro settings. Thus, direct visualization of these processes in real-time has become an important tool in understanding tumor responses to therapies and identifying the interactions between cancer cells and the stroma that can influence these responses. Here we provide a method for using spinning disk confocal microscopy of live, anesthetized mice to directly observe drug distribution, cancer cell responses and changes in tumor-stroma interactions following administration of systemic therapy in breast cancer models. We describe procedures for labeling different tumor components, treatment of animals for observing therapeutic responses, and the surgical procedure for exposing tumor tissues for imaging up to 40 hours. The results obtained from this protocol are time-lapse movies, in which such processes as drug infiltration, cancer cell death and stromal cell migration can be evaluated using image analysis software.

We describe a method for imaging response to anti-cancer treatment in vivo and at single cell resolution.

חי הדמיה של תגובות סמים בmicroenvironment הגידול במודלים עכבריים של סרטן השד

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional ...

Slow-release Drug Delivery through Elvax 40W to the Rat Retina: Implications for the Treatment of Chronic Conditions

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these diseases. Chronic retinal diseases such as retinal oedema or neovascularization usually require multiple intraocular injections to effectively treat the condition. However, the risks associated with these injections increase with repeated delivery of the drug. Therefore, alternative delivery methods need to be established in order to minimize the risks of reinjection. Several other investigations have developed methods to deliver drugs over extended time, through materials capable of releasing chemicals slowly into the eye. In this investigation, we outline the use of Elvax 40W, a copolymer resin, to act as a vehicle for drug delivery to the adult rat retina. The resin is made and loaded with the drug. The drug-resin complex is then implanted into the vitreous cavity, where it will slowly release the drug over time. This method was tested using 2-amino-4-phosphonobutyrate (APB), a glutamate analogue that blocks the light response of the retina. It was demonstrated that the APB was slowly released from the resin, and was able to block the retinal response by 7 days after implantation. This indicates that slow-release drug delivery using this copolymer resin is effective for treating the retina, and could be used therapeutically with further testing.

This paper details how Elvax 40W can be used as a slow-release method for drug delivery to the adult rat retina. The protocol for preparing, loading, and delivering the drug-resin complex to the eye is described.

משלוח שחרור איטי תרופות דרך Elvax 40W לרשתית העכברוש: ​​השלכות לטיפול במצבים כרוניים

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these ...

Carotid Artery Infusions for Pharmacokinetic and Pharmacodynamic Analysis of Taxanes in Mice

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study model. As the use of mouse models are often a vital step in preclinical drug discovery and drug development1-8, it is necessary to design a system to introduce drugs into mice in a uniform, reproducible manner. Ideally, the system should permit the collection of blood samples at regular intervals over a set time course. The ability to measure drug concentrations by mass-spectrometry, has allowed investigators to follow the changes in plasma drug levels over time in individual mice1, 9, 10. In this study, paclitaxel was introduced into transgenic mice as a continuous arterial infusion over three hours, while blood samples were simultaneously taken by retro-orbital bleeds at set time points. Carotid artery infusions are a potential alternative to jugular vein infusions, when factors such as mammary tumors or other obstructions make jugular infusions impractical. Using this technique, paclitaxel concentrations in plasma and tissue achieved similar levels as compared to jugular infusion. In this tutorial, we will demonstrate how to successfully catheterize the carotid artery by preparing an optimized catheter for the individual mouse model, then show how to insert and secure the catheter into the mouse carotid artery, thread the end of the catheter out through the back of the mouse&#8217;s neck, and hook the mouse to a pump to deliver a controlled rate of drug influx. Multiple low volume retro-orbital bleeds allow for analysis of plasma drug concentrations over time.

This method was developed with the goal of delivering a steady drug solution via the carotid artery, to assess the pharmacokinetics of novel drugs in mouse models.

חליטות עורק הראשי לpharmacokinetic וpharmacodynamic ניתוח של taxanes בעכברים

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study ...

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of women are alive 5 years after diagnosis. The omentum is a preferred site of HGSC metastasis formation. Despite the clinical importance of this microenvironment, the contribution of omental adipose tissue to ovarian cancer progression remains understudied. Omental adipose is unusual in that it contains structures known as milky spots, which are comprised of B, T, and NK cells, macrophages, and progenitor cells surrounding dense nests of vasculature. Milky spots play a key role in the physiologic functions of the omentum, which are required for peritoneal homeostasis. We have shown that milky spots also promote ovarian cancer metastatic colonization of peritoneal adipose, a key step in the development of peritoneal metastases. Here we describe the approaches we developed to evaluate and quantify milky spots in peritoneal adipose and study their functional contribution to ovarian cancer cell metastatic colonization of omental tissues both in vivo and ex vivo. These approaches are generalizable to additional mouse models and cell lines, thus enabling the study of ovarian cancer metastasis formation from initial localization of cells to milky spot structures to the development of widespread peritoneal metastases.

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

We outline a protocol that implements both in vivo and ex vivo approaches to study ovarian cancer colonization of peritoneal adipose tissues, particularly the omentum. Furthermore, we present a protocol to quantitate and analyze immune cell-structures in the omentum known as milky spots, which promote metastases of peritoneal adipose.

In vivo לשעבר vivo גישות לחקר סרטן השחלות גרורתי התיישבות של מבני ספוט החלב בהצפק שומני

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

לומד סרטן לבלב גזע מאפייני תא לפיתוח טיפול חדש אסטרטגיות

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Depletion of Mouse Cells from Human Tumor Xenografts Significantly Improves Downstream Analysis of Target Cells

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic patient tumors in different assays1. Human tumor xenografts represent the gold standard with respect to tumor biology, drug discovery, and metastasis research 2-4. Tumor xenografts can be derived from different types of material like tumor cell lines, tumor tissue from primary patient tumors4 or serially transplanted tumors. When propagated in vivo, xenografted tissue is infiltrated and vascularized by cells of mouse origin. Multiple factors such as the tumor entity, the origin of xenografted material, growth rate and region of transplantation influence the composition and the amount of mouse cells present in tumor xenografts. However, even when these factors are kept constant, the degree of mouse cell contamination is highly variable.
Contaminating mouse cells significantly impair downstream analyses of human tumor xenografts. As mouse fibroblasts show high plating efficacies and proliferation rates, they tend to overgrow cultures of human tumor cells, especially slowly proliferating subpopulations. Mouse cell derived DNA, mRNA, and protein components can bias downstream gene expression analysis, next-generation sequencing, as well as proteome analysis 5. To overcome these limitations, we have developed a fast and easy method to isolate untouched human tumor cells from xenografted tumor tissue. This procedure is based on the comprehensive depletion of cells of mouse origin by combining automated tissue dissociation with the benchtop tissue dissociator and magnetic cell sorting. Here, we demonstrate that human target cells can be can be obtained with purities higher than 96% within less than 20 min independent of the tumor type.

Human tumor xenografts are vascularized and infiltrated by cells of mouse origin during the growth phase in vivo. To circumvent the bias caused by these contaminating cells during downstream analysis, we developed a method allowing for comprehensive depletion of all mouse cells by magnetic cell sorting.

חסך בתאי עכבר מן xenografts גידול האנושי משפר משמעותי ניתוח במורד זרם של תאי יעד

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant CFTR channel in subjects with cystic fibrosis (CF). Identification of subjects that may benefit from these drugs is challenging because of the extensive heterogeneity of CFTR mutations, as well as other unknown factors that contribute to individual drug efficacy. Here, we describe a simple and relatively rapid assay for measuring individual CFTR function and response to CFTR modulators in vitro. Three dimensional (3D) epithelial organoids are grown from rectal biopsies in standard organoid medium. Once established, the organoids can be bio-banked for future analysis. For the assay, 30-80 organoids are seeded in 96-well plates in basement membrane matrix and are then exposed to drugs. One day later, the organoids are stained with calcein green, and forskolin-induced swelling is monitored by confocal live cell microscopy at 37 &#176;C. Forskolin-induced swelling is fully CFTR-dependent and is sufficiently sensitive and precise to allow for discrimination between the drug responses of individuals with different and even identical CFTR mutations. In vitro swell responses correlate with the clinical response to therapy. This assay provides a cost-effective approach for the identification of drug-responsive individuals, independent of their CFTR mutations. It may also be instrumental in the development of future CFTR modulators.

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

This protocol describes an assay for measuring CFTR function and CFTR modulator responses in cultured tissue from subjects with cystic fibrosis (CF). Biopsy-derived intestinal organoids swell in a cAMP-driven fashion, a response that is defective (or strongly reduced) in CF organoids and can be restored by exposure to CFTR modulators.

Forskolin-induced נפיחות מעיים Organoids: An<em&gt; במבחנה</em&gt; Assay עבור הערכת תגובה לתרופה בחולי סיסטיק פיברוזיס

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic study in the liver. Here, numerous assays are described to comprehensively measure the phenotype and parameters of hepatic steatosis in mouse and hepatocyte models. 
Combining the physiological, histological, and biochemical methods, this system can be used to assess the progress of hepatic steatosis. In vivo, the measurements of body weight and nuclear magnetic resonance (NMR) provide a general understanding of mice in a non-invasive manner. Hematoxylin and Eosin (H&amp;E) and Oil Red O staining determine the histological morphology and lipid deposition of liver tissue under nutrient overload conditions, such as high-fat diet feeding. Next, the total lipid contents are isolated by chloroform/methanol extraction, which are followed by a biochemical analysis for triglyceride and cholesterol. Moreover, mouse primary hepatocytes are treated with high glucose plus insulin to stimulate lipid accumulation, an efficient in vitro model to mimic diet-induced hyperglycemia and hyperinsulinemia in vivo. Then, the lipid deposition is measured by Oil Red O staining and chloroform/methanol extraction. Oil Red O staining determines intuitive hepatic steatotic phenotypes, while the lipid extraction analysis determines the parameters that can be analyzed statistically. The present protocols are of interest to scientists in the fields of fatty liver diseases, insulin resistance, and type 2 diabetes.

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Here, optimized methods to generate in vivo and in vitro models of hepatic steatosis and to analyze the steatotic phenotypes and related physiological parameters are described.

ניתוח אופטימלי של<em&gt; In vivo</em&gt; ו<em&gt; במבחנה</em&gt; כבדית steatosis

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Preparation of Herbal Medicine: Er-Xian Decoction and Er-Xian-containing Serum for In Vivo and In Vitro Experiments

Traditional herbal medicine, an alternative medicine in the clinical setting, has received increased attention in recent years. Before delivery to the body, an additional extraction procedure is commonly required to release the active constituents from raw herbs. Water decoction is a classical extraction procedure that is still broadly used in the clinical settings. Here, we propose a detailed protocol for er-xian decoction (EXD) in order to apply herbal decoctions to experimental studies. The calculation of an animal-appropriate dose is described, as well as the four main steps of EXD: soaking, water decoction, filtration, and concentration. In addition, serum-containing EXD is introduced to rats as a means of in vitro validation. Here, rats were orally administered EXD for three days. Blood samples were then collected, inactivated, centrifuged, and filtered. The serum, diluted with the culture medium, can be utilized to treat cells or tissues in vitro. For example, EXD was applied to both in vivo and in vitro studies and demonstrated that EXD enhances osteogenesis. This protocol can be used as a reference for the preparation and application of herbal medicines.

Preparation of Herbal Medicine: Er-Xian Decoction and Er-Xian-containing Serum for In Vivo and In Vitro Experiments

Here, we present the preparation of an er-xian decoction (EXD) in four steps&#8212;soaking, decoction, filtration, and concentration&#8212;and demonstrate the administration of a prepared EXD-containing serum to rats. These methods are applicable to the in vivo and in vitro study of herbal decoctions such as traditional Chinese medicines.

הכנה של צמחי מרפא: Er-Xian מרתח ו Er-Xian המכיל בסרום עבור<em&gt; בויבו</em&gt;<em&gt; במבחנה</em&gt; ניסויים

Traditional herbal medicine, an alternative medicine in the clinical setting, has received increased attention in recent years. Before delivery to the ...