We thank Chris Benner for implementing the X. tropicalis genome (xenTro2, xenTro2r) into HOMER and the Gilchrist lab for discussions on post-sequencing analysis. I.P. assisted the GO term analysis. G.E.G and J.C.S. were supported by the Wellcome Trust and are now supported by the Medical Research Council (program number U117597140).

<ol>
	<li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detecting+protein-DNA+interactions+in+vivo:+distribution+of+RNA+polymerase+on+specific+bacterial+genes.">Detecting protein-DNA interactions in vivo: distribution of RNA polymerase on specific bacterial genes.</a> Proc Natl Acad Sci U S A. 81 (14), 4275-4279 (1984).</li><li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+interactions+of+RNA+polymerase+II+with+genes+of+Drosophila+melanogaster.">In vivo interactions of RNA polymerase II with genes of Drosophila melanogaster.</a> Mol Cell Biol. 5 (8), 2009-2018 (1985).</li><li>Solomon, M. J., Larsen, P. L., Varshavsky, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+protein-DNA+interactions+in+vivo+with+formaldehyde:+evidence+that+histone+H4+is+retained+on+a+highly+transcribed+gene.">Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 is retained on a highly transcribed gene.</a> Cell. 53 (6), 937-947 (1988).</li><li>Ren, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+location+and+function+of+DNA+binding+proteins.">Genome-wide location and function of DNA binding proteins.</a> Science. 290 (5500), 2306-2309 (2000).</li><li>Johnson, D., Mortazavi, A., Myers, R., Wold, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+in+vivo+protein-DNA+interactions.">Genome-wide mapping of in vivo protein-DNA interactions.</a> Science. 316 (5830), 1497-1502 (2007).</li><li>Hellsten, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genome+of+the+Western+clawed+frog+Xenopus+tropicalis.">The genome of the Western clawed frog Xenopus tropicalis.</a> Science. 328 (5978), 633-636 (2010).</li><li>Lee, T. I., Johnstone, S. E., Young, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+and+microarray-based+analysis+of+protein+location.">Chromatin immunoprecipitation and microarray-based analysis of protein location.</a> Nature Protocols. 1 (2), 729-748 (2006).</li><li>Blythe, S. A., Reid, C. D., Kessler, D. S., Klein, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+in+early+Xenopus+laevis+embryos.">Chromatin immunoprecipitation in early Xenopus laevis embryos.</a> Dev Dyn. 238 (6), 1422-1432 (2009).</li><li>Gentsch, G. E., Smith, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+physical+chromatin+associations+across+the+Xenopus+genome+by+chromatin+immunoprecipitation.">Investigating physical chromatin associations across the Xenopus genome by chromatin immunoprecipitation.</a> Cold Spring Harb Protoc. 2014 (5), (2014).</li><li>Ubbels, G. A., Hara, K., Koster, C. H., Kirschner, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+functional+role+of+the+cytoskeleton+in+determination+of+the+dorsoventral+axis+in+Xenopus+laevis+eggs.">Evidence for a functional role of the cytoskeleton in determination of the dorsoventral axis in Xenopus laevis eggs.</a> J Embryol Exp Morphol. 77, 15-37 (1983).</li><li>Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+and+memory-efficient+alignment+of+short+DNA+sequences+to+the+human+genome.">Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.</a> Genome Biol. 10 (3), R25 (2009).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Heinz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+combinations+of+lineage-determining+transcription+factors+prime+cis-regulatory+elements+required+for+macrophage+and+B+cell+identities.">Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities.</a> Mol Cell. 38 (4), 576-589 (2010).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Robinson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat Biotechnol. 29 (1), 24-26 (2011).</li><li>Thorvaldsdottir, H., Robinson, J. T., Mesirov, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+Genomics+Viewer+(IGV):+high-performance+genomics+data+visualization+and+exploration.">Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration.</a> Brief Bioinform. 14 (2), 178-192 (2013).</li><li>Imoto, S., Nolan, J., Bioinformatics Miyano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> 20 (9), 1453-1454 (2004).</li><li>Camacho, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BLAST+:+architecture+and+applications.">BLAST+: architecture and applications.</a> BMC Bioinformatics. 10, 421 (2009).</li><li>Conesa, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blast2GO:+a+universal+tool+for+annotation,+visualization+and+analysis+in+functional+genomics+research.">Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research.</a> Bioinformatics. 21 (18), 3674-3676 (2005).</li><li>Sive, H., Grainger, R., Harland, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Early development of Xenopus laevis: A laboratory manual. , (2000).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+evaluation+of+factors+influencing+ChIP-seq+fidelity.">Systematic evaluation of factors influencing ChIP-seq fidelity.</a> Nat Methods. 9 (6), 609-614 (2012).</li><li>Sharov, A. A., Ko, M. S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exhaustive+search+for+over-represented+DNA+sequence+motifs+with+CisFinder.">Exhaustive search for over-represented DNA sequence motifs with CisFinder.</a> DNA Res. 16 (5), 261-273 (2009).</li><li>Bailey, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MEME+SUITE:+tools+for+motif+discovery+and+searching.">MEME SUITE: tools for motif discovery and searching.</a> Nucl Acids Res. 37 (2), W202-W208 (2009).</li><li>Livak, K. J., Schmittgen, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2(-Delta+Delta+C(T))+Method.">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25 (4), 402-408 (2001).</li><li>Park, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq:+advantages+and+challenges+of+a+maturing+technology.">ChIP-seq: advantages and challenges of a maturing technology.</a> Nat Rev Genet. 10 (10), 669-680 (2009).</li><li>Gentsch, G. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+T-box+transcription+factor+profiling+reveals+joint+regulation+of+embryonic+neuromesodermal+bipotency.">In vivo T-box transcription factor profiling reveals joint regulation of embryonic neuromesodermal bipotency.</a> Cell Rep. 4 (6), 1185-1196 (2013).</li><li>Barabasi, A. L., Oltvai, Z. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Network+biology:+understanding+the+cell's+functional+organization.">Network biology: understanding the cell's functional organization.</a> Nat Rev Genet. 5 (2), 101-113 (2004).</li><li>Biggin, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+transcription+networks+as+highly+connected,+quantitative+continua.">Animal transcription networks as highly connected, quantitative continua.</a> Dev Cell. 21 (4), 611-626 (2011).</li><li>Nieuwkoop, P. D., Faber, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Normal table of Xenopus laevis (Daudin): a systematical and chronological survey of the development from the fertilized egg till the end of metamorphosis. , (1994).</li><li>Akkers, R. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+hierarchy+of+H3K4me3+and+H3K27me3+acquisition+in+spatial+gene+regulation+in+Xenopus+embryos.">A hierarchy of H3K4me3 and H3K27me3 acquisition in spatial gene regulation in Xenopus embryos.</a> Dev Cell. 17 (3), 425-434 (2009).</li><li>Yoon, S. J., Wills, A. E., Chuong, E., Gupta, R., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> HEB and E2A function as SMAD/FOXH1 cofactors. Genes Dev. 25 (15), 1654-1661 (2011).</li><li>Jallow, Z., Jacobi, U. G., Weeks, D. L., Dawid, I. B., Veenstra, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specialized+and+redundant+roles+of+TBP+and+a+vertebrate-specific+TBP+paralog+in+embryonic+gene+regulation+in+Xenopus.">Specialized and redundant roles of TBP and a vertebrate-specific TBP paralog in embryonic gene regulation in Xenopus.</a> Proc Natl Acad Sci U S A. 101 (37), 13525 (2004).</li><li>Buchholz, D. R., Paul, B. D., Shi, Y. -. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene-specific+changes+in+promoter+occupancy+by+thyroid+hormone+receptor+during+frog+metamorphosis.+Implications+for+developmental+gene+regulation.">Gene-specific changes in promoter occupancy by thyroid hormone receptor during frog metamorphosis. Implications for developmental gene regulation.</a> J Biol Chem. 280 (50), 41222-41228 (2005).</li><li>Wills, A. E., Guptaa, R., Chuonga, E., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+and+deep+sequencing+in+Xenopus+tropicalis+and+Xenopus+laevis.">Chromatin immunoprecipitation and deep sequencing in Xenopus tropicalis and Xenopus laevis.</a> Methods. 66 (3), 410-421 (2014).</li><li>Metz, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+formaldehyde-induced+modifications+in+proteins:+reactions+with+model+peptides.">Identification of formaldehyde-induced modifications in proteins: reactions with model peptides.</a> J Biol Chem. 279 (8), 6235-6243 (2004).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Res. 22 (9), 1813-1831 (2012).</li><li>Mazzoni, E. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell-based+mapping+of+developmental+transcriptional+programs.">Embryonic stem cell-based mapping of developmental transcriptional programs.</a> Nat Methods. 8 (12), 1056-1058 (2011).</li><li>Deal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+method+for+gene+expression+and+chromatin+profiling+of+individual+cell+types+within+a+tissue.">A simple method for gene expression and chromatin profiling of individual cell types within a tissue.</a> Dev Cell. 18 (6), 1030-1040 (2010).</li><li>Bonn, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue-specific+analysis+of+chromatin+state+identifies+temporal+signatures+of+enhancer+activity+during+embryonic+development.">Tissue-specific analysis of chromatin state identifies temporal signatures of enhancer activity during embryonic development.</a> Nat Genet. 44 (2), 148-156 (2012).</li></ol>

The authors declare that they have no competing financial interests.

Our protocol outlines how to make and analyze genome-wide chromatin profiles from Xenopus embryos. It covers every step from cross-linking proteins to endogenous loci in vivo to processing millions of reads representing enriched genomic sites in silico. Since increasing numbers of genome drafts are available, this protocol should be applicable to other model and non-model organisms. The most important experimental section, which sets this protocol apart from previous work8,31,33,34, is the post-fixation procedure to extract cross-linked nuclei. It facilitates efficient chromatin solubilisation and shearing and easy upscaling. Together with improved efficiencies of library preparation this protocol allows the construction of high-complexity ChIP-Seq libraries from half to two million cells expressing the chromatin-associated epitope of interest. For ChIP-qPCR experiments, a few ten thousand of these cells are normally enough to check for DNA enrichment at perhaps six distinct genomic loci. These numbers are conservative estimates, but may vary depending on protein expression level, antibody quality, cross-linking efficiency, and epitope accessibility. As a guide, a single Xenopus embryo contains about 4,000 cells at the mid-blastula stage (8.5 after Nieuwkoop and Faber29), 40,000 cells at the late gastrula stage (12) and 100,000 cells at the early tailbud stage (20).
The exact fixation time for efficient immunoprecipitation needs to be determined empirically by ChIP-qPCR (section 10). In general, longer fixation times are required if the experiment involves X. laevis embryos, early developmental stages, and weak (or indirect) DNA binding properties. However, it is not recommended fixing Xenopus embryos longer than 40 min, or processing more embryos than indicated (section 3), as chromatin shearing becomes less efficient. It is important not to use any glycine after fixation as this common step for quenching formaldehyde can make nuclear extraction from yolk-rich embryos very difficult. Currently, the reason for this is not known. It is conceivable that the formaldehyde-glycine adduct further reacts with N-terminal amino-groups or arginine residues35.
The antibody is key to any ChIP experiment and sufficient controls need to be carried out to show its specificity for the epitope of interest (see guidelines by Landt et al.36). If no ChIP-grade antibody is available, the introduction of corresponding epitope-tagged fusion proteins may be a legitimate alternative as these proteins can occupy endogeneous binding sites37. In this case, uninjected embryos are best to use as a negative control rather than a ChIP with non-specific serum. This strategy may also be applied if the protein of interest is expressed at low levels resulting in the poor recovery of enriched DNA.
As for making ChIP-Seq libraries, because of the low amount of DNA in use, it is recommended to opt for procedures that reduce the number of cleaning steps and to combine reactions to keep any loss of DNA at a minimum. The adaptors and primers need to be compatible with multiplex sequencing and the NGS platform (see Table of Specific Materials/Equipment). If using Y-adaptors (containing long single-stranded arms), it is critical to pre-amplify the library with three to five rounds of PCR before size-selecting DNA inserts (e.g., 100 to 300 bp) by gel electrophoresis. Single-stranded ends cause DNA fragments to migrate heterogeneously. Trial runs with various amounts of input DNA (e.g., 0.1, 0.5, 1, 2, 5, 10 and 20 ng) are recommended to determine the total number of PCR cycles (less than or equal to 18 cycles) required to make a size-selected library of 100 to 200 ng. Reducing the number of PCR cycles renders the sequencing of redundant reads less likely. Solid phase reversible immobilization beads are good cleaning up reagents to efficiently recover the DNA of interest and reliably remove any free adaptors and dimers from ligation and PCR reactions.
In terms of number, type and length of reads, around 20 to 30 million single-end reads of 36 bp is enough for most ChIP-Seq experiments to cover the whole Xenopus genome with sufficient depth. The most prevalent NGS machines are routinely capable of meeting these criteria. However, it may be beneficial to increase the number of reads if a broad distributions of reads is expected, as observed with histone modifications, rather than sharp peaks. For many ChIP-Seq experiments, 4 to 5 differently indexed libraries can be pooled and sequenced in one flow cell lane using a high-performance NGS machine. Sometimes is also advisable to extend the read length and sequence both ends of the DNA template (paired-end) to increase mappability when analyzing chromatin within repetitive genomic regions.
This protocol has been applied successfully to a wide variety of chromatin features such as transcription factors, signaling mediators and post-translational histone modifications. However, embryos acquire an increasing degree of cellular heterogeneity as they develop and chromatin profiles become harder to interpret. Promising steps have been made in Arabidopsis and Drosophila to tissue-specifically profile chromatin landscapes by extracting cell type-specific nuclei38,39. Our protocol includes a nuclear extraction step, which could pave the way for tissue-specific ChIP-Seq in other embryos.

The first attempts to characterize protein-DNA interactions in vivo were reported about 30 years ago in an effort to understand RNA polymerase-mediated gene transcription in bacteria and in the fruit fly1,2. Since then, the use of immunoprecipitation to enrich distinct chromatin features (ChIP) has been widely adopted to capture binding events and chromatin states with high efficiency3. Subsequently, with the emergence of powerful microarray technologies, this method led to the characterization of genome-wide chromatin landscapes4. More recently, chromatin profiling has become even more comprehensive and high-resolution, because millions of co-immunoprecipitated DNA templates can now be sequenced in parallel and mapped to the genome (ChIP-Seq)5. As increasing numbers of genome assemblies are available, ChIP-Seq is an attractive approach to learn more about the genome regulation that underlies biological processes. 
Here we provide a protocol to perform ChIP-Seq on yolk-rich embryos such as those of the frog Xenopus. Drafts of the genomes of both widely used Xenopus species&#8212;X. tropicalis and X. laevis&#8212;have now been released by the International Xenopus Genome Consortium6. The embryos of Xenopus species share many desirable features that facilitate and allow the interpretation of genome-wide chromatin studies, including the production of large numbers of high-quality embryos, the large size of the embryos themselves, and their external development. In addition, the embryos are amenable to classic and novel manipulations like cell lineage tracing, whole-mount in situ hybridisation, RNA overexpression, and TALEN/CRISPR-mediated knockout technology.
The following protocol builds on the work of Lee et al., Blythe et al. and Gentsch et al.7-9. Briefly, Xenopus embryos are formaldehyde-fixed at the developmental stage of interest to covalently bind (cross-link) proteins to their associated genomic DNA. After nuclear extraction, cross-linked chromatin is fragmented to focus subsequent sequencing on specific genomic binding or modification sites, and to minimize the contributions of flanking DNA sequences. Subsequently, the chromatin fragments are immunoprecipitated with a ChIP-grade antibody to enrich those containing the protein of interest. The co-immunoprecipitated DNA is stripped from the protein and purified before creating an indexed (paired-end) library for next-generation sequencing (NGS). At the end, simple command lines are offered for the post-sequencing analysis of ChIP-Seq data.

<table><tbody><tr><td>1/16 inch tapered microtip</td><td>Qsonica</td><td>4417</td><td>This microtip is compatible with Sonicator 3000 from Misonix and Q500/700 from Qsonica.</td></tr><tr><td>8 ml glass sample vial with cap</td><td>Wheaton</td><td>224884</td><td>8 ml clear glass sample vials for aqueous samples with 15-425 size phenolic rubber-lined screw caps.</td></tr><tr><td>Adaptor</td><td>e.g., IDT or Sigma</td><td>NA</td><td>TruSeq universal adaptor, 
AATGATACGGCGACCACCGAG&lt;br /&gt;
ATCTACACTCTTTCCCTACAC&lt;br /&gt;
GACGCTCTTCCGATC*T. TruSeq indexed adaptor, 
P-GATCGGAAGAGCACACGTC&lt;br /&gt;
TGAACTCCAGTCAC &amp;#8208;NNNNNN&amp;#8208;&lt;br /&gt;
ATCTCGTATGCCGTCT&lt;br /&gt;TCTGCTT*G. *, phosphorothioate bondphosphate group at 5&amp;#39; end. NNNNNN, index (see TruSeq ChIP Sample Preparation Guide for DNA sequence). Order adaptors HPLC purified. Adaptors can be prepared by combining equimolar amounts (each 100 &amp;#181;M) of the universal and the indexed adaptor and cooling them down slowly from 95 &amp;#176;C to room temperature. Use 1.5 pmol per ng of input DNA. Store at -20 &amp;#176;C.</td></tr><tr><td>b2g4pipe (software)</td><td>Blast2GO</td><td>non-commercial</td><td>http://www.blast2go.com/data/blast2go/b2g4pipe_v2.5.zip</td></tr><tr><td>BLAST+ (software)</td><td>Camacho et al.</td><td>non-commercial</td><td>http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastDocs&amp;amp; &lt;br /&gt;DOC_TYPE=Download</td></tr><tr><td>Bowtie (software)</td><td>Langmead et al.</td><td>non-commercial</td><td>http://bowtie-bio.sourceforge.net/index.shtml</td></tr><tr><td>cisFinder (software)</td><td>Sharov et al.</td><td>non-commercial</td><td>http://lgsun.grc.nia.nih.gov/CisFinder/</td></tr><tr><td>Chip for capillary electrophoresis</td><td>Agilent Technologies</td><td>5067-1504</td><td>Load this chip with 1 &amp;micro;l DNA for library quality control. Store at 4 &amp;deg;C.</td></tr><tr><td>Chip-based capillary electrophoresis system</td><td>Agilent Technologies</td><td>G2940CA</td><td>The Agilent 2100 BioAnalyzer is used to check the quality of ChIP-Seq libraries. Keep reagents at 4 &amp;deg;C.</td></tr><tr><td>ChIP-Seq library preparation kit (KAPA Hyper Prep Kit)</td><td>Kapa Biosystems</td><td>KK8504</td><td>Kit contains KAPA end repair and A-tailing enzyme mix, end Repair and A-tailing buffer, DNA ligase, ligation buffer, KAPA HiFi HotStart ReadyMix (2X), and KAPA library amplification primer mix (10X) (see also PCR primers). Adaptors are not included. Store at -20 &amp;deg;C.</td></tr><tr><td>ChIP-Seq library preparation kit (alternative, ThruPLEX-FD Prep Kit)</td><td>Rubicon Genomics</td><td>R40048</td><td>Kit uses their own stem-loop adaptors and primers. This kit eliminates intermediate purification steps and is as sensitive as the KAPA Hyper Prep Kit. Store at -20 &amp;deg;C.</td></tr><tr><td>Cluster3 (software)</td><td>de Hoon et al.</td><td>non-commercial</td><td>http://bonsai.hgc.jp/~mdehoon/software/cluster</td></tr><tr><td>FastQC (software)</td><td>Simon Andrews</td><td>non-commercial</td><td>http://www.bioinformatics.babraham.ac.uk/projects/fastqc</td></tr><tr><td>Fluorometer</td><td>life technologies</td><td>Q32866</td><td>Qubit 2.0 Fluorometer</td></tr><tr><td>Fluorometer reagents</td><td>life technologies</td><td>Q32851</td><td>The kit provides concentrated assay reagent, dilution buffer, and pre-diluted DNA standards for the Qubit fluorometer. Store DNA standards at 4 &amp;deg;C, buffer and dye at room temperature.</td></tr><tr><td>Formaldehyde</td><td>Sigma</td><td>F8775-4X25ML</td><td>Formaldehyde solution, for molecular biology, 36.5-38% in H2O, stabilised with 10-15% methanol. Store at room temperature. CAUTION: Formaldehyde is corrosive and highly toxic.</td></tr><tr><td>Gel (E-Gel EX agarose , 2%)</td><td>life technologies</td><td>G4010</td><td>Pre-cast gel with 11 wells, openable format. Leave one lane between ladder and library empty to avoid cross-contamination. Store gels at room temperature.</td></tr><tr><td>Gel electrophoresis system</td><td>life technologies</td><td>G6465</td><td>E-Gel iBase and E-Gel Safe Imager combo kit for size-selecting ChIP-Seq libraries.</td></tr><tr><td>Gel extraction kit</td><td>Qiagen</td><td>28706</td><td>Store all reagents at room temperature. Use 500 &amp;micro;l of QG buffer per 100 mg of 2% agarose gel slice to extract DNA. Use MinElute columns (from MinElute PCR purification kit) to elute DNA twice.</td></tr><tr><td>HOMER (software)</td><td>Chris Benner</td><td>non-commercial</td><td>http://homer.salk.edu/homer/index.html</td></tr><tr><td>Hybridization oven</td><td>Techne</td><td>FHB1D</td><td>Hybridizer HB-1D</td></tr><tr><td>IGV (software)</td><td>Robinson et al.</td><td>non-commercial</td><td>http://www.broadinstitute.org/igv/home</td></tr><tr><td>Illumina CASAVA-1.8 quality filter (software)</td><td>Assaf Gordon</td><td>non-commercial</td><td>http://cancan.cshl.edu/labmembers/gordon/fastq_illumina_filter</td></tr><tr><td>Java TreeView (software)</td><td>Alok Saldanha</td><td>non-commercial</td><td>http://jtreeview.sourceforge.net</td></tr><tr><td>Laboratory jack</td><td>Edu-Lab</td><td>CH0642</td><td>This jack is used to elevate sample in sound enclosure for sonication.</td></tr><tr><td>Ladder, 100 bp</td><td>New England BioLabs</td><td>N3231</td><td>Keep 1x solution at room temperature. Store stock at -20 &amp;deg;C.</td></tr><tr><td>Ladder, 1 kb</td><td>New England BioLabs</td><td>N3232</td><td>Keep 1x solution at room temperature. Store stock at -20 &amp;deg;C.</td></tr><tr><td>Low-retention 1.5-ml microcentrifuge tubes</td><td>life technologies</td><td>AM12450</td><td>nonstick, RNase-free microfuge tubes, 1.5 ml</td></tr><tr><td>MACS2 (software)</td><td>Tao Liu</td><td>non-commercial</td><td>https://github.com/taoliu/MACS</td></tr><tr><td>Magnetic beads</td><td>life technologies</td><td>11201D</td><td>These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-mouse IgG covalently bound to the bead surface. Store at 4 &amp;deg;C.</td></tr><tr><td>Magnetic beads</td><td>life technologies</td><td>11203D</td><td>These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-rabbit IgG covalently bound to the bead surface. Store at 4 &amp;deg;C.</td></tr><tr><td>Magnetic beads</td><td>life technologies</td><td>10001D</td><td>These Dynabeads are superparamagnetic beads with recombinant protein A covalently bound to the bead surface. Store at 4 &amp;deg;C.</td></tr><tr><td>Magnetic beads</td><td>life technologies</td><td>10003D</td><td>These Dynabeads are superparamagnetic beads with recombinant protein G covalently bound to the bead surface. Store at 4 &amp;deg;C.</td></tr><tr><td>Magnetic rack</td><td>life technologies</td><td>12321D</td><td>DynaMag-2 magnet</td></tr><tr><td>MEME</td><td>Bailey et al.</td><td>non-commercial</td><td>http://meme.nbcr.net/meme/</td></tr><tr><td>Na3VO4</td><td>New England BioLabs</td><td>P0758</td><td>Sodium orthovanadate (100 mM) is a commonly used general inhibitor for protein phosphotyrosyl phosphatases. Store at -20 &amp;deg;C.</td></tr><tr><td>NaF</td><td>New England BioLabs</td><td>P0759</td><td>Sodium fluoride (500 mM) is commonly used as general inhibitor of phosphoseryl and phosphothreonyl phosphatases. Store at -20 &amp;deg;C.</td></tr><tr><td>NGS machine</td><td>Illumina</td><td>SY-301-1301</td><td>Genome Analyzer IIx</td></tr><tr><td>NGS machine (high performance)</td><td>Illumina</td><td>SY-401-2501</td><td>HiSeq</td></tr><tr><td>Normal serum (antibody control)</td><td>Santa Cruz Biotechnology</td><td>sc-2028</td><td>Use as control for goat polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &amp;deg;C.</td></tr><tr><td>Normal serum (antibody control)</td><td>Santa Cruz Biotechnology</td><td>sc-2025</td><td>Use as control for mouse polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &amp;deg;C.</td></tr><tr><td>Normal serum (antibody control)</td><td>Santa Cruz Biotechnology</td><td>sc-2027</td><td>Use as control for rabbit polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &amp;deg;C.</td></tr><tr><td>Nucleic acid staining solution</td><td>iNtRON</td><td>21141</td><td>Use RedSafe nucleic acid staining solution at 1:50,000. Store at room temperature.</td></tr><tr><td>Orange G</td><td>Sigma</td><td>O3756-25G</td><td>1-Phenylazo-2-naphthol-6,8-disulfonic acid disodium salt. Store at 4 &amp;deg;C.</td></tr><tr><td>PCR primers</td><td>e.g., IDT or Sigma</td><td></td><td>Primers to enrich adaptor-ligated DNA fragments by PCR: AATGATACGGCGACCACCGA*G and CAAGCAGAAGACGGCATACGA*G, phosphorothioate bond. Primers designed by Ethan Ford. Combine primers at 5 &amp;micro;M each. Use 5 &amp;micro;l in a 50 &amp;micro;l PCR reaction. Store at -20 &amp;deg;C.</td></tr><tr><td>MinElute PCR purification kit&amp;nbsp;</td><td>Qiagen</td><td>28006</td><td>for purification of ChIP-qPCR and shearing test samples. Store MinElute spin columns at 4 &amp;deg;C, all other buffers and collection tubes at room temperature.</td></tr><tr><td>Phenol:chloroform:isoamyl alcohol (25:24:1, pH 7.9)</td><td>life technologies</td><td>AM9730</td><td>Phenol:Chloroform:IAA (25:24:1) is premixed and supplied at pH 6.6. Use provided Tris alkaline buffer to raise pH to 7.9. Store at 4 &amp;deg;C. CAUTION: phenol:chloroform:isoamyl alcohol is corrosive, highly toxic and combustible.</td></tr><tr><td>Primer3 (software)</td><td>Steve Rozen &amp;amp; Helen Skaletsky</td><td>non-commercial</td><td>http://biotools.umassmed.edu/bioapps/primer3_www.cgi</td></tr><tr><td>Protease inhibitor tablets</td><td>Roche</td><td>11836170001</td><td>cOmplete, Mini, EDTA-free. Use 1 tablet per 10 ml. Store at 4 &amp;deg;C.</td></tr><tr><td>Protease inhibitor tablets</td><td>Roche</td><td>11873580001</td><td>cOmplete, EDTA-free. Use 1 tablet per 50 ml. Store at 4 &amp;deg;C.</td></tr><tr><td>Proteinase K</td><td>life technologies</td><td>AM2548</td><td>proteinase K solution (20 &amp;micro;g/&amp;micro;l). Store at -20 &amp;deg;C.</td></tr><tr><td>RNase A</td><td>life technologies</td><td>12091-039</td><td>RNase A (20 &amp;micro;g/&amp;micro;l). Store at room temperature.</td></tr><tr><td>Rotator</td><td>Stuart</td><td>SB3</td><td>Rotator SB3</td></tr><tr><td>SAMtools (software)</td><td>Li et al.</td><td>non-commercial</td><td>http://samtools.sourceforge.neta</td></tr><tr><td>Solid phase reversible immobilisation beads</td><td>Beckman Coulter</td><td>A63882</td><td>The Agencourt AMPure XP beads are used to minimise adaptor dimer contamination in ChIP-Seq libraries. Store at 4 &amp;deg;C.</td></tr><tr><td>Sonicator 3000</td><td>Misonix/Qsonica</td><td></td><td>Newer models are now available. Q125, Q500 or Q700 are all suitable for shearing crosslinked chromatin.</td></tr><tr><td>Sound enclosure</td><td>Misonix/Qsonica</td><td></td><td>optional: follow the manufacturer&#039;s recommendation to obtain the correct sound enclosure.</td></tr><tr><td>Thermomixer</td><td>eppendorf</td><td>22670000</td><td>Thermomixer for 24 x 1.5 mL tubes. Precise temperature control from 4 &amp;deg;C above room temperature to 99 &amp;deg;C.</td></tr></tbody></table>

genome-wide snapshot of chromatin regulators and states in xenopus embryos by chip-seq

The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and organ formation during development. Determining the locations and levels of such chromatin features in vivo will provide valuable information about the spatio-temporal regulation of genomic elements, and will support aspirations to mimic embryonic tissue development in vitro. The most commonly used method for genome-wide and high-resolution profiling is chromatin immunoprecipitation followed by next-generation sequencing (ChIP-Seq). This protocol outlines how yolk-rich embryos such as those of the frog Xenopus can be processed for ChIP-Seq experiments, and it offers simple command lines for post-sequencing analysis. Because of the high efficiency with which the protocol extracts nuclei from formaldehyde-fixed tissue, the method allows easy upscaling to obtain enough ChIP material for genome-wide profiling. Our protocol has been used successfully to map various DNA-binding proteins such as transcription factors, signaling mediators, components of the transcription machinery, chromatin modifiers and post-translational histone modifications, and for this to be done at various stages of embryogenesis. Lastly, this protocol should be widely applicable to other model and non-model organisms as more and more genome assemblies become available.

Equivalent results to those presented here are expected if the protocol is well executed and the antibody in use is of ChIP-grade quality (see discussion). This protocol allows the extraction of nuclei from formaldehyde-fixed Xenopus embryos and the efficient shearing of chromatin by sonication (Figure 1A-C). Sheared chromatin shows an asymmetric distribution of DNA fragments mainly ranging from 100 to 1,000 bp and peaking between 300 and 500 bp (Figure 1C). A minimal 50 pg of immunoprecipitated DNA is required to successfully make an indexed paired-end ChIP-Seq library with similarly sized DNA inserts (Figure 2A). The library should be largely devoid of adaptor dimers, which can be seen on the electropherogram at approximately 120 bp.
Upon sequencing-by-synthesis, pre-processed reads are mapped to the genome (Figure 2B, C). In a successful experiment with X. tropicalis embryos, normally 50 to 70% of single-end reads of 40 bp can be mapped uniquely to the genome assembly of v7.1 with maximally two mismatches. While input reads align quite uniformly across the genome, the alignment of ChIP reads results in strand-specific enrichments that flank the chromatin feature of interest. This is because all fragments are sequenced from the 5&#8217; end (Figure 2C)25. Extending the alignment in reading direction to an average fragment size produces accurate profiles for single chromatin features such as transcription factor binding events. These DNA occupancies appear as peaks when visualized in IGV or any other compatible genome browser. Peak callers like MACS are used to determine the location of these peaks (Figure 3A). This way tens of thousands of binding sites have been determined in the X. tropicalis genome for T-box transcription factors such as VegT26. ChIP-qPCR experiments should confirm the local enrichment found by ChIP-Seq (Figure 3B).
ChIP-Seq experiments allow exploring genome-wide characteristics of chromatin features. For example, calculating the read distribution over genomic elements such as transcription start and termination sites may highlight any spatial binding preferences around genes (Figure 3C). Similarly, a heatmap of read distributions at peak locations is used to compare different chromatin features at a genome-wide scale (Figure 3D). Certain transcription factors bind DNA sequence-specifically. De novo motif analysis of genomic DNA underlying peaks can retrieve this kind of information including co-enriched motifs of potential co-factors (Figure 3E). The great majority of target genes show DNA occupancy at a lower rather than higher level (Figure 3F). This scale-free feature seems to be quite common among transcription factors and suggests that only a small fraction of target genes are directly regulated with biological relevance27,28. The analysis of enriched GO terms or other attributes such as the differential expression of target genes may further reveal insights into the biological function of the chromatin feature in the Xenopus embryo (Figure 3G).
<img alt="Figure 1" src="/files/ftp_upload/52535/52535fig1highres.jpg" /> 
Figure 1.&#160;Chromatin immunoprecipitation procedure for Xenopus embryos. (A) Embryos are formaldehyde-fixed at the developmental stage of interest to covalently bind (cross-link) any proteins associated with genomic DNA. Upon nuclear extraction (B), cross-linked chromatin is fragmented to narrow down genomic DNA binding or chromatin modification sites by minimizing the flanking DNA sequence (C). Subsequently, the chromatin fragments are immunoprecipitated with a ChIP-grade antibody to enrich those containing the epitope of interest (D). The co-immunoprecipitated DNA is stripped off the protein and purified (E) before creating the ChIP fragment library for NGS (Figure 2). <a href="https://www.jove.com/files/ftp_upload/52535/52535fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/52535/52535fig2highres.jpg" /> 
Figure 2.&#160;ChIP-Seq library preparation, sequencing-by-synthesis, mapping and peak calling. (A) The electropherogram displays a good ChIP-Seq library with DNA templates of 250 to 450 bp. These templates entail the DNA insert of interest flanked by the universal (58 bp) and the indexed (63 bp) adaptor. (B) Millions of clusters, with each cluster containing identical templates, are sequenced base by base in the presence of all four nucleotides possessing reversible, distinct fluorophore and identical termination properties. Fluorescent images are processed in real time to call corresponding bases, which ultimately are assembled into reads. (C) Only reads that map uniquely to the Xenopus genome are kept. As all fragments are sequenced from the 5&#8217; end, the mapping of ChIP reads results in strand-specific peaks that flank the chromatin feature of interest. Thereby, peak callers detect the enrichment that originates from immunoprecipitation and extend the reads to an average fragment length to accurately localize chromatin features. <a href="https://www.jove.com/files/ftp_upload/52535/52535fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/52535/52535fig3highres.jpg" /> 
Figure 3.&#160;An example of post-sequencing analysis and data visualisation by means of the zygotic T-box transcription factor VegT (zVegT). All read counts shown here are normalised to 10 million uniquely mapped and non-redundant reads. (A) Excerpt of the genome-wide profile of zVegT binding in X. tropicalis gastrula embryos (stage 11 to 12.5 after Nieuwkoop and Faber29). Each peak, a pile-up of extended reads, represents one binding site. These peaks are called by MACS2 with a false discovery rate (FDR) of less than 1%. Each mesp gene shows very proximal and upstream zVegT binding, but only mespa and mespb are expressed by that stage (RNA-Seq data30). (B) DNA occupancy levels of zVegT as determined by ChIP-qPCR at several loci (including a non-bound region 0.5 kb upstream of &#946;-actin) confirm the specific enrichment found by ChIP-Seq. Compare results for mespa with peak called (red bar) in (A). The DNA occupancy level is visualized as a percentage of input for both, the ChIP with the VegT antibody (rabbit polyclonal of IgG isotype) and the ChIP with the antibody control (normal rabbit IgG). Error bars reflect the standard deviation of two biological replicates. (C) Metagene analysis shows preferential zVegT binding (tags binned over 25 bp) to the promoter relative to any other genomic region around and within gene bodies. (D) Heatmap shows k-mean clustered (k=5) DNA occupancy levels (tags binned over 25 bp) of zVegT and Smad2/Smad3 (ChIP-Seq data31) relative to all zVegT-bound regions at gastrula stage. The heatmap is log2 based and centred at 5 tags per bp. (E) De novo motif analysis discovers the canonical T-box transcription factor binding motif in 38% of zVegT-bound regions if the underlying motif score is normalised to a 5% discovery rate in background sequences. The density map shows highest enrichment for the T-box motif in the centre of zVegT binding sites, whereas the canonical Smad2/Smad3 binding motif is hardly enriched. (F) Histogram shows DNA occupancy levels of zVegT, which are calculated for each target gene from all peaks (+/- 200 bp) between 5 kb upstream [-] and 1 kb downstream [+] of corresponding transcription start sites. (G) Top 300 genes with highest DNA occupancy levels within -5 kb and +1 kb are enriched for biological processes of early embryonic development. These GO terms are in line with the putative function of zVegT. The FDR is based on a two-tailed Fisher&#8217;s exact test and corrected for multiple testing. <a href="https://www.jove.com/files/ftp_upload/52535/52535fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq at JoVE.com

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

The question of how chromatin regulators and chromatin states affect the genome in vivo is key to our understanding of how early cell fate decisions are made in the developing embryo. ChIP-Seq&#8212;the most popular approach to investigate chromatin features at a global level&#8212;is outlined here for Xenopus embryos.

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and ...

genome-wide-snapshot-chromatin-regulators-states-xenopus-embryos-chip

Research

JoVE Journal

Developmental Biology

12.4K Views.  MRC National Institute for Medical Research.  De vraag hoe chromatine toezichthouders en chromatine staten van invloed op het genoom in vivo is de sleutel tot ons begrip van hoe vroeg lot van de cel beslissingen worden genomen in het zich ontwikkelende embryo. ChIP-Seq-de meest populaire benadering van chromatine functies onderzoeken op mondiaal niveau wordt hier geschetst voor Xenopus embryo. 

Video: Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

Chromatin Immunoprecipitation (ChIP) Protocol for Low-abundance Embryonic Samples

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, transcription factors, or chromatin-modifying enzymes at a given locus or on a genome-wide scale. The combination of ChIP assays with next-generation sequencing (i.e., ChIP-Seq) is a powerful approach to globally uncover gene regulatory networks and to improve the functional annotation of genomes, especially of non-coding regulatory sequences. ChIP protocols normally require large amounts of cellular material, thus precluding the applicability of this method to investigating rare cell types or small tissue biopsies. In order to make the ChIP assay compatible with the amount of biological material that can typically be obtained in vivo during early vertebrate embryogenesis, we describe here a simplified ChIP protocol in which the number of steps required to complete the assay were reduced to minimize sample loss. This ChIP protocol has been successfully used to investigate different histone modifications in various embryonic chicken and adult mouse tissues using low to medium cell numbers (5 x 104 - 5 x 105 cells). Importantly, this protocol is compatible with ChIP-seq technology using standard library preparation methods, thus providing global epigenomic maps in highly relevant embryonic tissues.

Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples

Here, we describe a chromatin immunoprecipitation (ChIP) and ChIP-seq library preparation protocol to generate global epigenomic profiles from low-abundance chicken embryonic samples.

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, ...

Genetics

Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq

Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq) is a method used for the identification of open (accessible) regions of chromatin. These regions represent regulatory DNA elements (e.g., promoters, enhancers, locus control regions, insulators) to which transcription factors bind. Mapping the accessible chromatin landscape is a powerful approach for uncovering active regulatory elements across the genome. This information serves as an unbiased approach for discovering the network of relevant transcription factors and mechanisms of chromatin structure that govern gene expression programs. ATAC-seq is a robust and sensitive alternative to DNase I hypersensitivity analysis coupled with next-generation sequencing (DNase-seq) and formaldehyde-assisted isolation of regulatory elements (FAIRE-seq) for genome-wide analysis of chromatin accessibility and to the sequencing of micrococcal nuclease-sensitive sites (MNase-seq) to determine nucleosome positioning. We present a detailed ATAC-seq protocol optimized for human primary immune cells i.e. CD4+ lymphocytes (T helper 1 (Th1) and Th2 cells). This comprehensive protocol begins with cell harvest, then describes the molecular procedure of chromatin tagmentation, sample preparation for next-generation sequencing, and also includes methods and considerations for the computational analyses used to interpret the results. Moreover, to save time and money, we introduced quality control measures to assess the ATAC-seq library prior to sequencing. Importantly, the principles presented in this protocol allow its adaptation to other human immune and non-immune primary cells and cell lines. These guidelines will also be useful for laboratories which are not proficient with next-generation sequencing methods.

Assay for Transposase-Accessible Chromatin coupled with high-throughput sequencing (ATAC-seq) is a genome-wide method to uncover accessible chromatin. This is a step-by-step ATAC-seq protocol, from molecular to the final computational analysis, optimized for human lymphocytes (Th1/Th2). This protocol can be adopted by researchers without prior experience in next-generation sequencing methods.

Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq) is a method used for the identification of open (accessible) regions ...

An Integrated Platform for Genome-wide Mapping of Chromatin States Using High-throughput ChIP-sequencing in Tumor Tissues

Histone modifications constitute a major component of the epigenome and play important regulatory roles in determining the transcriptional status of associated loci. In addition, the presence of specific modifications has been used to determine the position and identity non-coding functional elements such as enhancers. In recent years, chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq) has become a powerful tool in determining the genome-wide profiles of individual histone modifications. However, it has become increasingly clear that the combinatorial patterns of chromatin modifications, referred to as Chromatin States, determine the identity and nature of the associated genomic locus. Therefore, workflows consisting of robust high-throughput (HT) methodologies for profiling a number of histone modification marks, as well as computational analyses pipelines capable of handling myriads of ChIP-Seq profiling datasets, are needed for comprehensive determination of epigenomic states in large number of samples. The HT-ChIP-Seq workflow presented here consists of two modules: 1) an experimental protocol for profiling several histone modifications from small amounts of tumor samples and cell lines in a 96-well format; and 2) a computational data analysis pipeline that combines existing tools to compute both individual mark occupancy and combinatorial chromatin state patterns. Together, these two modules facilitate easy processing of hundreds of ChIP-Seq samples in a fast and efficient manner. The workflow presented here is used to derive chromatin state patterns from 6 histone mark profiles in melanoma tumors and cell lines. Overall, we present a comprehensive ChIP-seq workflow that can be applied to dozens of human tumor samples and cancer cell lines to determine epigenomic aberrations in various malignancies.

Here, we describe an optimized high-throughput ChIP-sequencing protocol and computational analyses pipeline for the determination of genome-wide chromatin state patterns from frozen tumor tissues and cell lines.

Histone modifications constitute a major component of the epigenome and play important regulatory roles in determining the transcriptional status of ...

Cancer Research

Generation of Genome-wide Chromatin Conformation Capture Libraries from Tightly Staged Early Drosophila Embryos

Investigating the three-dimensional architecture of chromatin offers invaluable insight into the mechanisms of gene regulation. Here, we describe a protocol for performing the chromatin conformation capture technique in situ Hi-C on staged Drosophila melanogaster embryo populations. The result is a sequencing library that allows the mapping of all chromatin interactions that occur in the nucleus in a single experiment. Embryo sorting is done manually using a fluorescent stereo microscope and a transgenic fly line containing a nuclear marker. Using this technique, embryo populations from each nuclear division cycle, and with defined cell cycle status, can be obtained with very high purity. The protocol may also be adapted to sort older embryos beyond gastrulation. Sorted embryos are used as inputs for in situ Hi-C. All experiments, including sequencing library preparation, can be completed in five days. The protocol has low input requirements and works reliably using 20 blastoderm stage embryos as input material. The end result is a sequencing library for next generation sequencing. After sequencing, the data can be processed into genome-wide chromatin interaction maps that can be analyzed using a wide range of available tools to gain information about topologically associating domain (TAD) structure, chromatin loops, and chromatin compartments during Drosophila development.

Generation of Genome-wide Chromatin Conformation Capture Libraries from Tightly Staged Early Drosophila Embryos

This work describes a protocol for the generation of high resolution in situ Hi-C libraries from tightly staged pre-gastrulation Drosophila melanogaster embryos.

Investigating the three-dimensional architecture of chromatin offers invaluable insight into the mechanisms of gene regulation. Here, we describe a ...

Epigenetic Regulation of Cardiac Differentiation of Embryonic Stem Cells and Tissues

Specific gene transcription is a key biological process that underlies cell fate decision during embryonic development. The biological process is mediated by transcription factors which bind genomic regulatory regions including enhancers and promoters of cardiac constitutive genes. DNA is wrapped around histones that are subjected to chemical modifications. Modifications of histones further lead to repressed, activated or poised gene transcription, thus bringing another level of fine tuning regulation of gene transcription. Embryonic Stem cells (ES cells) recapitulate within embryoid bodies (i.e., cell aggregates) or in 2D culture the early steps of cardiac development. They provide in principle enough material for chromatin immunoprecipitation (ChIP), a technology broadly used to identify gene regulatory regions. Furthermore, human ES cells represent a human cell model of cardiogenesis. At later stages of development, mouse embryonic tissues allow for investigating specific epigenetic landscapes required for determination of cell identity. Herein, we describe protocols of ChIP, sequential ChIP followed by PCR or ChIP-sequencing using ES cells, embryoid bodies and cardiac specific embryonic regions. These protocols allow to investigating the epigenetic regulation of cardiac gene transcription.

A fine tuning regulation of gene transcription underlies embryonic cell fate decision. Herein, we describe chromatin immunoprecipitation assays used to investigate epigenetic regulation of both cardiac differentiation of stem cells and cardiac development of mouse embryos.

Specific gene transcription is a key biological process that underlies cell fate decision during embryonic development. The biological process is mediated ...

Chromatin Immunoprecipitation from Human Embryonic Stem Cells

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are characterized by two fundamental properties: self-renewal and multipotency that allows a stem cell to differentiate into virtually any cell type 1. The progression stem cell to differentiated cell is characterized by loss of multipotency, structural and morphological changes and the hierarchic activity of transcription factors and signaling molecules, whose activities establish and maintain cell-type specific gene expression patterns. At the molecular level, cell differentiation involves dynamic changes of the structure and composition of chromatin and the detection of those dynamic changes can provide valuable insights into the functional features of stem cells and the cell differentiation process 2,3. Chromatin is a highly compacted DNA-protein complex that forms when cells package chromosomal DNA with proteins, mainly histones 4. Stemcellness and cell differentiation has been correlated with the presence of specific arrays of regulatory proteins such as epigenetic factors, histone variants, and transcription factors 2,3,5.
 Chromatin immunoprecipitation (ChIP) provides a valuable method to monitor the presence of RNA, proteins, and protein modifications in chromatin 6,7. The comparison of chromatin from different cell types can elucidate dynamic changes in protein-chromatin associations that occur during cell differentiation.
Chromatin immunoprecipitation involves the purification of in vivo cross-linked chromatin. The isolated chromatin is reduced to smaller fragments by enzymatic digestion or mechanical force. Chromatin fragments are precipitated using specific antibodies to target proteins or protein and DNA modifications. The precipitated DNA or RNA is purified and used as a template for PCR or DNA microarray based assays. Prerequisites for a successful ChIP are high quality antibodies to the desired antigen and the availability of chromatin from control cells that do not express the target molecule. ChIP can correlate the presence of proteins, protein and RNA modifications, and RNA with specific target DNA, and depending on the choice of outread tool, detects the association of target molecules at specific target genes or in the context of an entire genome. The comparison of the distribution of proteins in the chromatin of differentiating cells can elucidate the dynamic changes of chromatin composition that coincide with the progression of cells along a cell lineage.

The differentiation of ESC coincides with cell-type specific changes in the structure and composition of chromatin. The detection of those changes provides valuable insights into the mechanisms that define stemcellness and cell differentiation. Chromatin immunoprecipitation (ChIP) represents a valuable method to dissect the molecular mechanisms underlying stem cell differentiation.

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are ...

Biology

High-Resolution Mapping of Protein-DNA Interactions in Mouse Stem Cell-Derived Neurons using Chromatin Immunoprecipitation-Exonuclease (ChIP-Exo)

Identification of specific protein-DNA interactions on the genome is important for understanding gene regulation. Chromatin immunoprecipitation coupled with high-throughput sequencing (ChIP-seq) is widely used to identify genome-wide binding locations of DNA-binding proteins. However, the ChIP-seq method is limited by its heterogeneity in length of sonicated DNA fragments and non-specific background DNA, resulting in low mapping resolution and uncertainty in DNA-binding sites. To overcome these limitations, the combination of ChIP with exonuclease digestion (ChIP-exo) utilizes 5&#8217; to 3&#8217; exonuclease digestion to trim the heterogeneously sized immunoprecipitated DNA to the protein-DNA crosslinking site. Exonuclease treatment also eliminates non-specific background DNA. The library-prepared and exonuclease-digested DNA can be sent for high-throughput sequencing. The ChIP-exo method allows for near base-pair mapping resolution with greater detection sensitivity and reduced background signal. An optimized ChIP-exo protocol for mammalian cells and next-generation sequencing is described below.

High-Resolution Mapping of Protein-DNA Interactions in Mouse Stem Cell-Derived Neurons using Chromatin Immunoprecipitation-Exonuclease ChIP-Exo

Precise determination of protein-binding locations across the genome is important for understanding gene regulation. Here we describe a&#160;genomic mapping method that treats chromatin-immunoprecipitated DNA with exonuclease digestion (ChIP-exo) followed by high-throughput sequencing. This method detects protein-DNA interactions with near base-pair mapping resolution and high signal-to-noise ratio in mammalian neurons.

Identification of specific protein-DNA interactions on the genome is important for understanding gene regulation. Chromatin immunoprecipitation coupled ...

CARIP-Seq and ChIP-Seq: Methods to Identify Chromatin-Associated RNAs and Protein-DNA Interactions in Embryonic Stem Cells

Embryonic stem (ES) cell self-renewal&#160;and differentiation is governed by extrinsic signals and intrinsic networks of transcription factors, epigenetic regulators, and post-translation modifications of histones that combinatorially influence the gene expression state of nearby genes. RNA has also been shown to interact with various proteins to regulate chromatin dynamics&#160;and gene expression. Chromatin-associated RNA immunoprecipitation (CARIP) followed by next-generation sequencing (CARIP-Seq) is a novel method to survey RNAs associated with chromatin proteins, while chromatin immunoprecipitation followed by next-generation sequencing (ChIP-Seq) is a powerful genomics technique to map the location of post-translational modification of histones, transcription factors, and epigenetic modifiers on a global-scale in ES cells. Here, we describe methods to perform CARIP-Seq and ChIP-Seq, including library construction for next-generation sequencing, to generate global chromatin-associated RNA and epigenomic maps in ES cells.

Here, we describe methods to perform ChIP-Seq and CARIP-Seq, including library preparation for next-generation sequencing, to generate global epigenomic and chromatin-associated RNA maps in ES cells.

Embryonic stem (ES) cell self-renewal&#160;and differentiation is governed by extrinsic signals and intrinsic networks of transcription factors, ...

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly offer whole-genome coverage, where combining chromatin immunoprecipitation (ChIP) and massively parallel sequencing can be utilized to identify the repertoire of mammalian DNA sequences bound by transcription factors in vivo. "Next-generation" genome sequencing technologies provide 1-2 orders of magnitude increase in the amount of sequence that can be cost-effectively generated over older technologies thus allowing for ChIP-seq methods to directly provide whole-genome coverage for effective profiling of mammalian protein-DNA interactions.
For successful ChIP-seq approaches, one must generate high quality ChIP DNA template to obtain the best sequencing outcomes. The description is based around experience with the protein product of the gene most strongly implicated in the pathogenesis of type 2 diabetes, namely the transcription factor transcription factor 7-like 2 (TCF7L2). This factor has also been implicated in various cancers.
Outlined is how to generate high quality ChIP DNA template derived from the colorectal carcinoma cell line, HCT116, in order to build a high-resolution map through sequencing to determine the genes bound by TCF7L2, giving further insight in to its key role in the pathogenesis of complex traits.

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

The combination of chromatin immunoprecipitation and ultra-high-throughput sequencing (ChIP-seq) can identify and map protein-DNA interactions in a given tissue or cell line. Outlined is how to generate a high quality ChIP template for subsequent sequencing, using experience with the transcription factor TCF7L2 as an example.

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

Single-Cell Factor Localization on Chromatin using Ultra-Low Input Cleavage Under Targets and Release using Nuclease

Determining the binding locations of a protein on chromatin is essential for understanding its function and potential regulatory targets. Chromatin Immunoprecipitation (ChIP) has been the gold standard for determining protein localization for over 30 years and is defined by the use of an antibody to pull out the protein of interest from sonicated or enzymatically digested chromatin. More recently, antibody tethering techniques have become popular for assessing protein localization on chromatin due to their increased sensitivity. Cleavage Under Targets &amp; Release Under Nuclease (CUT&amp;RUN) is the genome-wide derivative of Chromatin Immunocleavage (ChIC) and utilizes recombinant Protein A tethered to micrococcal nuclease (pA-MNase) to identify the IgG constant region of the antibody targeting a protein of interest, therefore enabling site-specific cleavage of the DNA flanking the protein of interest. CUT&amp;RUN can be used to profile histone modifications, transcription factors, and other chromatin-binding proteins such as nucleosome remodeling factors. Importantly, CUT&amp;RUN can be used to assess the localization of either euchromatic- or heterochromatic-associated proteins and histone modifications. For these reasons, CUT&amp;RUN is a powerful method for determining the binding profiles of a wide range of proteins. Recently, CUT&amp;RUN has been optimized for transcription factor profiling in low populations of cells and single cells and the optimized protocol has been termed ultra-low input CUT&amp;RUN (uliCUT&amp;RUN). Here, a detailed protocol is presented for single-cell factor profiling using uliCUT&amp;RUN in a manual 96-well format.

CUT&#38;RUN and its variants can be used to determine protein occupancy on chromatin. This protocol describes how to determine protein localization on chromatin using single-cell uliCUT&#38;RUN.

Determining the binding locations of a protein on chromatin is essential for understanding its function and potential regulatory targets. Chromatin ...

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

Samenvatting

Meer video's verkennen