We thank Chris Benner for implementing the X. tropicalis genome (xenTro2, xenTro2r) into HOMER and the Gilchrist lab for discussions on post-sequencing analysis. I.P. assisted the GO term analysis. G.E.G and J.C.S. were supported by the Wellcome Trust and are now supported by the Medical Research Council (program number U117597140).

<ol>
	<li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detecting+protein-DNA+interactions+in+vivo:+distribution+of+RNA+polymerase+on+specific+bacterial+genes.">Detecting protein-DNA interactions in vivo: distribution of RNA polymerase on specific bacterial genes.</a> Proc Natl Acad Sci U S A. 81 (14), 4275-4279 (1984).</li><li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+interactions+of+RNA+polymerase+II+with+genes+of+Drosophila+melanogaster.">In vivo interactions of RNA polymerase II with genes of Drosophila melanogaster.</a> Mol Cell Biol. 5 (8), 2009-2018 (1985).</li><li>Solomon, M. J., Larsen, P. L., Varshavsky, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+protein-DNA+interactions+in+vivo+with+formaldehyde:+evidence+that+histone+H4+is+retained+on+a+highly+transcribed+gene.">Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 is retained on a highly transcribed gene.</a> Cell. 53 (6), 937-947 (1988).</li><li>Ren, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+location+and+function+of+DNA+binding+proteins.">Genome-wide location and function of DNA binding proteins.</a> Science. 290 (5500), 2306-2309 (2000).</li><li>Johnson, D., Mortazavi, A., Myers, R., Wold, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+in+vivo+protein-DNA+interactions.">Genome-wide mapping of in vivo protein-DNA interactions.</a> Science. 316 (5830), 1497-1502 (2007).</li><li>Hellsten, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genome+of+the+Western+clawed+frog+Xenopus+tropicalis.">The genome of the Western clawed frog Xenopus tropicalis.</a> Science. 328 (5978), 633-636 (2010).</li><li>Lee, T. I., Johnstone, S. E., Young, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+and+microarray-based+analysis+of+protein+location.">Chromatin immunoprecipitation and microarray-based analysis of protein location.</a> Nature Protocols. 1 (2), 729-748 (2006).</li><li>Blythe, S. A., Reid, C. D., Kessler, D. S., Klein, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+in+early+Xenopus+laevis+embryos.">Chromatin immunoprecipitation in early Xenopus laevis embryos.</a> Dev Dyn. 238 (6), 1422-1432 (2009).</li><li>Gentsch, G. E., Smith, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+physical+chromatin+associations+across+the+Xenopus+genome+by+chromatin+immunoprecipitation.">Investigating physical chromatin associations across the Xenopus genome by chromatin immunoprecipitation.</a> Cold Spring Harb Protoc. 2014 (5), (2014).</li><li>Ubbels, G. A., Hara, K., Koster, C. H., Kirschner, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+functional+role+of+the+cytoskeleton+in+determination+of+the+dorsoventral+axis+in+Xenopus+laevis+eggs.">Evidence for a functional role of the cytoskeleton in determination of the dorsoventral axis in Xenopus laevis eggs.</a> J Embryol Exp Morphol. 77, 15-37 (1983).</li><li>Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+and+memory-efficient+alignment+of+short+DNA+sequences+to+the+human+genome.">Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.</a> Genome Biol. 10 (3), R25 (2009).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Heinz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+combinations+of+lineage-determining+transcription+factors+prime+cis-regulatory+elements+required+for+macrophage+and+B+cell+identities.">Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities.</a> Mol Cell. 38 (4), 576-589 (2010).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Robinson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat Biotechnol. 29 (1), 24-26 (2011).</li><li>Thorvaldsdottir, H., Robinson, J. T., Mesirov, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+Genomics+Viewer+(IGV):+high-performance+genomics+data+visualization+and+exploration.">Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration.</a> Brief Bioinform. 14 (2), 178-192 (2013).</li><li>Imoto, S., Nolan, J., Bioinformatics Miyano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> 20 (9), 1453-1454 (2004).</li><li>Camacho, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BLAST+:+architecture+and+applications.">BLAST+: architecture and applications.</a> BMC Bioinformatics. 10, 421 (2009).</li><li>Conesa, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blast2GO:+a+universal+tool+for+annotation,+visualization+and+analysis+in+functional+genomics+research.">Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research.</a> Bioinformatics. 21 (18), 3674-3676 (2005).</li><li>Sive, H., Grainger, R., Harland, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Early development of Xenopus laevis: A laboratory manual. , (2000).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+evaluation+of+factors+influencing+ChIP-seq+fidelity.">Systematic evaluation of factors influencing ChIP-seq fidelity.</a> Nat Methods. 9 (6), 609-614 (2012).</li><li>Sharov, A. A., Ko, M. S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exhaustive+search+for+over-represented+DNA+sequence+motifs+with+CisFinder.">Exhaustive search for over-represented DNA sequence motifs with CisFinder.</a> DNA Res. 16 (5), 261-273 (2009).</li><li>Bailey, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MEME+SUITE:+tools+for+motif+discovery+and+searching.">MEME SUITE: tools for motif discovery and searching.</a> Nucl Acids Res. 37 (2), W202-W208 (2009).</li><li>Livak, K. J., Schmittgen, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2(-Delta+Delta+C(T))+Method.">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25 (4), 402-408 (2001).</li><li>Park, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq:+advantages+and+challenges+of+a+maturing+technology.">ChIP-seq: advantages and challenges of a maturing technology.</a> Nat Rev Genet. 10 (10), 669-680 (2009).</li><li>Gentsch, G. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+T-box+transcription+factor+profiling+reveals+joint+regulation+of+embryonic+neuromesodermal+bipotency.">In vivo T-box transcription factor profiling reveals joint regulation of embryonic neuromesodermal bipotency.</a> Cell Rep. 4 (6), 1185-1196 (2013).</li><li>Barabasi, A. L., Oltvai, Z. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Network+biology:+understanding+the+cell's+functional+organization.">Network biology: understanding the cell's functional organization.</a> Nat Rev Genet. 5 (2), 101-113 (2004).</li><li>Biggin, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+transcription+networks+as+highly+connected,+quantitative+continua.">Animal transcription networks as highly connected, quantitative continua.</a> Dev Cell. 21 (4), 611-626 (2011).</li><li>Nieuwkoop, P. D., Faber, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Normal table of Xenopus laevis (Daudin): a systematical and chronological survey of the development from the fertilized egg till the end of metamorphosis. , (1994).</li><li>Akkers, R. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+hierarchy+of+H3K4me3+and+H3K27me3+acquisition+in+spatial+gene+regulation+in+Xenopus+embryos.">A hierarchy of H3K4me3 and H3K27me3 acquisition in spatial gene regulation in Xenopus embryos.</a> Dev Cell. 17 (3), 425-434 (2009).</li><li>Yoon, S. J., Wills, A. E., Chuong, E., Gupta, R., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> HEB and E2A function as SMAD/FOXH1 cofactors. Genes Dev. 25 (15), 1654-1661 (2011).</li><li>Jallow, Z., Jacobi, U. G., Weeks, D. L., Dawid, I. B., Veenstra, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specialized+and+redundant+roles+of+TBP+and+a+vertebrate-specific+TBP+paralog+in+embryonic+gene+regulation+in+Xenopus.">Specialized and redundant roles of TBP and a vertebrate-specific TBP paralog in embryonic gene regulation in Xenopus.</a> Proc Natl Acad Sci U S A. 101 (37), 13525 (2004).</li><li>Buchholz, D. R., Paul, B. D., Shi, Y. -. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene-specific+changes+in+promoter+occupancy+by+thyroid+hormone+receptor+during+frog+metamorphosis.+Implications+for+developmental+gene+regulation.">Gene-specific changes in promoter occupancy by thyroid hormone receptor during frog metamorphosis. Implications for developmental gene regulation.</a> J Biol Chem. 280 (50), 41222-41228 (2005).</li><li>Wills, A. E., Guptaa, R., Chuonga, E., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+and+deep+sequencing+in+Xenopus+tropicalis+and+Xenopus+laevis.">Chromatin immunoprecipitation and deep sequencing in Xenopus tropicalis and Xenopus laevis.</a> Methods. 66 (3), 410-421 (2014).</li><li>Metz, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+formaldehyde-induced+modifications+in+proteins:+reactions+with+model+peptides.">Identification of formaldehyde-induced modifications in proteins: reactions with model peptides.</a> J Biol Chem. 279 (8), 6235-6243 (2004).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Res. 22 (9), 1813-1831 (2012).</li><li>Mazzoni, E. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell-based+mapping+of+developmental+transcriptional+programs.">Embryonic stem cell-based mapping of developmental transcriptional programs.</a> Nat Methods. 8 (12), 1056-1058 (2011).</li><li>Deal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+method+for+gene+expression+and+chromatin+profiling+of+individual+cell+types+within+a+tissue.">A simple method for gene expression and chromatin profiling of individual cell types within a tissue.</a> Dev Cell. 18 (6), 1030-1040 (2010).</li><li>Bonn, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue-specific+analysis+of+chromatin+state+identifies+temporal+signatures+of+enhancer+activity+during+embryonic+development.">Tissue-specific analysis of chromatin state identifies temporal signatures of enhancer activity during embryonic development.</a> Nat Genet. 44 (2), 148-156 (2012).</li></ol>

The authors declare that they have no competing financial interests.

Notre protocole décrit comment faire et d&#39;analyser les profils de la chromatine génome entier à partir d&#39;embryons de xénope. Il couvre toutes les étapes à partir de protéines de réticulation pour les loci endogènes in vivo pour traiter des millions de lectures représentant des sites génomiques enrichies en silico. Depuis nombre croissant de projets de génome sont disponibles, ce protocole devrait être applicable à d&#39;autres organismes modèles et non-modèle. La partie expérimentale la plus importante, qui établit ce protocole en dehors du travail précédente 8,31,33,34, est la procédure post-fixation pour extraire des noyaux réticulés. Il facilite efficace solubilisation de la chromatine et cisaillement et upscaling facile. Ensemble, avec des rendements améliorés de préparation bibliothèque ce protocole permet la construction de bibliothèques ChIP-Seq haute complexité de la moitié aux deux millions de cellules exprimant l&#39;épitope de la chromatine associée d&#39;intérêt. Pour les expériences ChIP-qPCR, quelques dix mille de ces cellules sont normalement assezde vérifier pour l&#39;enrichissement de l&#39;ADN à peut-être six loci génomiques distincts. Ces chiffres sont des estimations prudentes, mais peut varier selon le niveau d&#39;expression de protéines, la qualité d&#39;anticorps, l&#39;efficacité et l&#39;accessibilité épitope de réticulation. Comme un guide, un seul embryon de Xenopus contient environ 4000 cellules au stade mi-blastula (8,5 après Nieuwkoop et Faber 29), 40 000 cellules à la fin du stade gastrula (12) et 100 000 cellules au stade de bourgeon caudal tôt (20). Le temps de fixation exacte pour immunoprécipitation efficace doit être déterminée empiriquement par Chip-qPCR (article 10). En général, plus temps de fixation sont nécessaires si l&#39;expérience implique X. laevis embryons, premiers stades de développement, et des propriétés de liaison d&#39;ADN faibles (ou indirects). Cependant, il ne est pas recommandé de fixation Xenopus embryons plus de 40 min, ou le traitement de plus d&#39;embryons que indiqué (section 3), la chromatine cisaillement devient moins efficace. Il est important de ne pasà utiliser toute la glycine après fixation que cette étape commune pour trempe formaldéhyde peut faire l&#39;extraction nucléaire à partir d&#39;embryons jaune riche très difficiles. Actuellement, la raison de cela ne est pas connue. Il est concevable que le produit d&#39;addition formaldéhyde-glycine réagit en outre avec des groupes amino ou 35 résidus d&#39;arginine N-terminale. L&#39;anticorps est la clé de toute expérience de la puce et des contrôles suffisants doivent être menées pour montrer sa spécificité pour l&#39;épitope d&#39;intérêt (voir les lignes directrices par Landt et al. 36). Si aucun anticorps ChIP qualité est disponible, l&#39;introduction de protéines de fusion de marquage épitopique correspondant peut être une alternative légitime que ces protéines peuvent occuper endogène sites de liaison 37. Dans ce cas, les embryons non-injecté sont les meilleurs à utiliser comme contrôle négatif plutôt que d&#39;une puce avec du sérum non spécifique. Cette stratégie peut également être appliquée si la protéine d&#39;intérêt est exprimée à faibles niveaux résultant de la mauvaise récupération des enriADN CHED. Comme pour la fabrication de bibliothèques ChIP-Seq, en raison de la faible quantité d&#39;ADN en cours d&#39;utilisation, il est recommandé d&#39;opter pour des procédures qui réduisent le nombre d&#39;étapes de nettoyage et de combiner des réactions de garder toute perte d&#39;ADN au minimum. Les adaptateurs et les amorces doivent être compatibles avec le séquençage multiplex et la plate-forme NGS (voir le tableau de matériaux spécifiques / Équipement). Si l&#39;on utilise des adaptateurs en Y (contenant de longs bras simple brin), il est essentiel d&#39;effectuer une pré-amplifier la bibliothèque de trois à cinq cycles de PCR avant inserts d&#39;ADN grandeur de sélection (par ex., 100 à 300 pb) par électrophorèse sur gel. Extrémités simple brin causent des fragments d&#39;ADN de migrer hétérogène. Essai fonctionne avec différentes quantités d&#39;ADN d&#39;entrée (par exemple, 0,1, 0,5, 1, 2, 5, 10 et 20 ng) sont recommandés pour déterminer le nombre total de cycles de PCR (inférieur ou égal à 18 cycles) nécessaire pour effectuer une taille Sélectionnée bibliothèque de 100 à 200 ng. Réduire le nombre de cycles de PCR rend le séquençage de Redundant lit moins probable. Phase solide perles d&#39;immobilisation sont réversibles bonne nettoyage réactifs de récupérer efficacement l&#39;ADN d&#39;intérêt et fiable retirez les cartes gratuites et des dimères de ligature et les réactions PCR. En termes de nombre, le type et la durée de lit, autour de 20 à 30 millions seule fin lit de 36 pb est suffisant pour la plupart des expériences de ChIP-Seq pour couvrir l&#39;ensemble du génome de Xenopus avec la profondeur suffisante. Les machines de l&#39;END les plus fréquentes sont régulièrement capables de répondre à ces critères. Cependant, il peut être avantageux d&#39;augmenter le nombre de lectures si un larges distributions de lit est prévu, comme observé avec les modifications des histones, plutôt que des pics nets. Pour de nombreuses expériences de ChIP-Seq, 4-5 bibliothèques différemment indexées peuvent être regroupées et séquencées dans un flux voie de cellule en utilisant un haute performance NGS machine. Parfois est également conseillé de prolonger la durée de lecture et la séquence deux extrémités de la matrice d&#39;ADN (jumelé-end) pour augmenter cartographiabilité wpoule analyse chromatine au sein des régions génomiques répétitives. Ce protocole a été appliqué avec succès à une large variété de fonctions de la chromatine tels que les facteurs de transcription, des médiateurs de signalisation et des modifications des histones post-traductionnelles. Cependant, les embryons acquérir un degré croissant d&#39;hétérogénéité cellulaire dans l&#39;élaboration de profils de la chromatine et deviennent plus difficiles à interpréter. Des mesures prometteuses ont été faites chez Arabidopsis et Drosophila aux paysages chromatine tissus spécifiquement profil en extrayant cellulaires noyaux spécifiques de type 38,39. Notre protocole comprend une étape d&#39;extraction nucléaire, qui pourrait ouvrir la voie à tissu-spécifique ChIP-Seq dans d&#39;autres embryons.

The first attempts to characterize protein-DNA interactions in vivo were reported about 30 years ago in an effort to understand RNA polymerase-mediated gene transcription in bacteria and in the fruit fly1,2. Since then, the use of immunoprecipitation to enrich distinct chromatin features (ChIP) has been widely adopted to capture binding events and chromatin states with high efficiency3. Subsequently, with the emergence of powerful microarray technologies, this method led to the characterization of genome-wide chromatin landscapes4. More recently, chromatin profiling has become even more comprehensive and high-resolution, because millions of co-immunoprecipitated DNA templates can now be sequenced in parallel and mapped to the genome (ChIP-Seq)5. As increasing numbers of genome assemblies are available, ChIP-Seq is an attractive approach to learn more about the genome regulation that underlies biological processes. 
Here we provide a protocol to perform ChIP-Seq on yolk-rich embryos such as those of the frog Xenopus. Drafts of the genomes of both widely used Xenopus species&#8212;X. tropicalis and X. laevis&#8212;have now been released by the International Xenopus Genome Consortium6. The embryos of Xenopus species share many desirable features that facilitate and allow the interpretation of genome-wide chromatin studies, including the production of large numbers of high-quality embryos, the large size of the embryos themselves, and their external development. In addition, the embryos are amenable to classic and novel manipulations like cell lineage tracing, whole-mount in situ hybridisation, RNA overexpression, and TALEN/CRISPR-mediated knockout technology.
The following protocol builds on the work of Lee et al., Blythe et al. and Gentsch et al.7-9. Briefly, Xenopus embryos are formaldehyde-fixed at the developmental stage of interest to covalently bind (cross-link) proteins to their associated genomic DNA. After nuclear extraction, cross-linked chromatin is fragmented to focus subsequent sequencing on specific genomic binding or modification sites, and to minimize the contributions of flanking DNA sequences. Subsequently, the chromatin fragments are immunoprecipitated with a ChIP-grade antibody to enrich those containing the protein of interest. The co-immunoprecipitated DNA is stripped from the protein and purified before creating an indexed (paired-end) library for next-generation sequencing (NGS). At the end, simple command lines are offered for the post-sequencing analysis of ChIP-Seq data.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>1/16 inch tapered microtip</td>
			<td>Qsonica</td>
			<td>4417</td>
			<td>This microtip is compatible with Sonicator 3000 from Misonix and Q500/700 from Qsonica.</td>
		</tr>
		<tr>
			<td>8 ml glass sample vial with cap</td>
			<td>Wheaton</td>
			<td>224884</td>
			<td>8 ml clear glass sample vials for aqueous samples with 15-425 size phenolic rubber-lined screw caps.</td>
		</tr>
		<tr>
			<td>Adaptor</td>
			<td>IDT or Sigma</td>
			<td>NA</td>
			<td>TruSeq universal adaptor, 
AATGATACGGCGACCACCGAG 
ATCTACACTCTTTCCCTACAC 
GACGCTCTTCCGATC*T. TruSeq indexed adaptor, 
P-GATCGGAAGAGCACACGTC 
TGAACTCCAGTCAC &#8208;NNNNNN&#8208; 
ATCTCGTATGCCGTCT TCTGCTT*G. *, phosphorothioate bondphosphate group at 5&#39; end. NNNNNN, index (see TruSeq ChIP Sample Preparation Guide for DNA sequence). Order adaptors HPLC purified. Adaptors can be prepared by combining equimolar amounts (each 100 &#181;M) of the universal and the indexed adaptor and cooling them down slowly from 95 &#176;C to room temperature. Use 1.5 pmol per ng of input DNA. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>b2g4pipe (software)</td>
			<td>Blast2GO</td>
			<td>non-commercial</td>
			<td>http://www.blast2go.com/data/blast2go/b2g4pipe_v2.5.zip</td>
		</tr>
		<tr>
			<td>BLAST+ (software)</td>
			<td>Camacho et al.</td>
			<td>non-commercial</td>
			<td>http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastDocs&#38;DOC_TYPE=Download</td>
		</tr>
		<tr>
			<td>Bowtie (software)</td>
			<td>Langmead et al.</td>
			<td>non-commercial</td>
			<td>http://bowtie-bio.sourceforge.net/index.shtml</td>
		</tr>
		<tr>
			<td>cisFinder (software)</td>
			<td>Sharov et al.</td>
			<td>non-commercial</td>
			<td>http://lgsun.grc.nia.nih.gov/CisFinder/</td>
		</tr>
		<tr>
			<td>Chip for capillary electrophoresis</td>
			<td>Agilent Technologies</td>
			<td>5067-1504</td>
			<td>Load this chip with 1 &#181;l DNA for library quality control. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Chip-based capillary electrophoresis system</td>
			<td>Agilent Technologies</td>
			<td>G2940CA</td>
			<td>The Agilent 2100 BioAnalyzer is used to check the quality of ChIP-Seq libraries. Keep reagents at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>ChIP-Seq library preparation kit (KAPA Hyper Prep Kit)</td>
			<td>Kapa Biosystems</td>
			<td>KK8504</td>
			<td>Kit contains KAPA end repair and A-tailing enzyme mix, end Repair and A-tailing buffer, DNA ligase, ligation buffer, KAPA HiFi HotStart ReadyMix (2X), and KAPA library amplification primer mix (10X) (see also PCR primers). Adaptors are not included. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>ChIP-Seq library preparation kit (alternative, ThruPLEX-FD Prep Kit)</td>
			<td>Rubicon Genomics</td>
			<td>R40048</td>
			<td>Kit uses their own stem-loop adaptors and primers. This kit eliminates intermediate purification steps and is as sensitive as the KAPA Hyper Prep Kit. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Cluster3 (software)</td>
			<td>de Hoon et al.</td>
			<td>non-commercial</td>
			<td>http://bonsai.hgc.jp/~mdehoon/software/cluster</td>
		</tr>
		<tr>
			<td>FastQC (software)</td>
			<td>Simon Andrews</td>
			<td>non-commercial</td>
			<td>http://www.bioinformatics.babraham.ac.uk/projects/fastqc</td>
		</tr>
		<tr>
			<td>Fluorometer</td>
			<td>life technologies</td>
			<td>Q32866</td>
			<td>Qubit 2.0 Fluorometer</td>
		</tr>
		<tr>
			<td>Fluorometer reagents</td>
			<td>life technologies</td>
			<td>Q32851</td>
			<td>The kit provides concentrated assay reagent, dilution buffer, and pre-diluted DNA standards for the Qubit fluorometer. Store DNA standards at 4 &#176;C, buffer and dye at room temperature.</td>
		</tr>
		<tr>
			<td>Formaldehyde</td>
			<td>Sigma</td>
			<td>F8775-4X25ML</td>
			<td>Formaldehyde solution, for molecular biology, 36.5-38% in H2O, stabilised with 10-15% methanol. Store at room temperature. CAUTION: Formaldehyde is corrosive and highly toxic.</td>
		</tr>
		<tr>
			<td>Gel (E-Gel EX agarose , 2%)</td>
			<td>life technologies</td>
			<td>G4010</td>
			<td>Pre-cast gel with 11 wells, openable format. Leave one lane between ladder and library empty to avoid cross-contamination. Store gels at room temperature.</td>
		</tr>
		<tr>
			<td>Gel electrophoresis system</td>
			<td>life technologies</td>
			<td>G6465</td>
			<td>E-Gel iBase and E-Gel Safe Imager combo kit for size-selecting ChIP-Seq libraries.</td>
		</tr>
		<tr>
			<td>Gel extraction kit</td>
			<td>Qiagen</td>
			<td>28706</td>
			<td>Store all reagents at room temperature. Use 500 &#181;l of QG buffer per 100 mg of 2% agarose gel slice to extract DNA. Use MinElute columns (from MinElute PCR purification kit) to elute DNA twice.</td>
		</tr>
		<tr>
			<td>HOMER (software)</td>
			<td>Chris Benner</td>
			<td>non-commercial</td>
			<td>http://homer.salk.edu/homer/index.html</td>
		</tr>
		<tr>
			<td>Hybridization oven</td>
			<td>Techne</td>
			<td>FHB1D</td>
			<td>Hybridizer HB-1D</td>
		</tr>
		<tr>
			<td>IGV (software)</td>
			<td>Robinson et al.</td>
			<td>non-commercial</td>
			<td>http://www.broadinstitute.org/igv/home</td>
		</tr>
		<tr>
			<td>Illumina CASAVA-1.8 quality filter (software)</td>
			<td>Assaf Gordon</td>
			<td>non-commercial</td>
			<td>http://cancan.cshl.edu/labmembers/gordon/fastq_illumina_filter</td>
		</tr>
		<tr>
			<td>Java TreeView (software)</td>
			<td>Alok Saldanha</td>
			<td>non-commercial</td>
			<td>http://jtreeview.sourceforge.net</td>
		</tr>
		<tr>
			<td>Laboratory jack</td>
			<td>Edu-Lab</td>
			<td>CH0642</td>
			<td>This jack is used to elevate sample in sound enclosure for sonication.</td>
		</tr>
		<tr>
			<td>Ladder, 100 bp</td>
			<td>New England BioLabs</td>
			<td>N3231</td>
			<td>Keep 1x solution at room temperature. Store stock at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Ladder, 1 kb</td>
			<td>New England BioLabs</td>
			<td>N3232</td>
			<td>Keep 1x solution at room temperature. Store stock at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Low-retention 1.5-ml microcentrifuge tubes</td>
			<td>life technologies</td>
			<td>AM12450</td>
			<td>nonstick, RNase-free microfuge tubes, 1.5 ml</td>
		</tr>
		<tr>
			<td>MACS2 (software)</td>
			<td>Tao Liu</td>
			<td>non-commercial</td>
			<td>https://github.com/taoliu/MACS</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>11201D</td>
			<td>These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-mouse IgG covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>11203D</td>
			<td>These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-rabbit IgG covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>10001D</td>
			<td>These Dynabeads are superparamagnetic beads with recombinant protein A covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic beads</td>
			<td>life technologies</td>
			<td>10003D</td>
			<td>These Dynabeads are superparamagnetic beads with recombinant protein G covalently bound to the bead surface. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Magnetic rack</td>
			<td>life technologies</td>
			<td>12321D</td>
			<td>DynaMag-2 magnet</td>
		</tr>
		<tr>
			<td>MEME</td>
			<td>Bailey et al.</td>
			<td>non-commercial</td>
			<td>http://meme.nbcr.net/meme/</td>
		</tr>
		<tr>
			<td>Na3VO4</td>
			<td>New England BioLabs</td>
			<td>P0758</td>
			<td>Sodium orthovanadate (100 mM) is a commonly used general inhibitor for protein phosphotyrosyl phosphatases. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>NaF</td>
			<td>New England BioLabs</td>
			<td>P0759</td>
			<td>Sodium fluoride (500 mM) is commonly used as general inhibitor of phosphoseryl and phosphothreonyl phosphatases. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>NGS machine</td>
			<td>Illumina</td>
			<td>SY-301-1301</td>
			<td>Genome Analyzer IIx</td>
		</tr>
		<tr>
			<td>NGS machine (high performance)</td>
			<td>Illumina</td>
			<td>SY-401-2501</td>
			<td>HiSeq</td>
		</tr>
		<tr>
			<td>Normal serum (antibody control)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2028</td>
			<td>Use as control for goat polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Normal serum (antibody control)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2025</td>
			<td>Use as control for mouse polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Normal serum (antibody control)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2027</td>
			<td>Use as control for rabbit polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Nucleic acid staining solution</td>
			<td>iNtRON</td>
			<td>21141</td>
			<td>Use RedSafe nucleic acid staining solution at 1:50,000. Store at room temperature.</td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Sigma</td>
			<td>O3756-25G</td>
			<td>1-Phenylazo-2-naphthol-6,8-disulfonic acid disodium salt. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>PCR primers</td>
			<td>e.g., IDT or Sigma</td>
			<td>NA</td>
			<td>Primers to enrich adaptor-ligated DNA fragments by PCR: AATGATACGGCGACCACCGA*G and CAAGCAGAAGACGGCATACGA*G, phosphorothioate bond. Primers designed by Ethan Ford. Combine primers at 5 &#181;M each. Use 5 &#181;l in a 50 &#181;l PCR reaction. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>MinElute PCR purification kit&#160;</td>
			<td>Qiagen</td>
			<td>28006</td>
			<td>for purification of ChIP-qPCR and shearing test samples. Store MinElute spin columns at 4 &#176;C, all other buffers and collection tubes at room temperature.</td>
		</tr>
		<tr>
			<td>Phenol:chloroform:isoamyl alcohol (25:24:1, pH 7.9)</td>
			<td>life technologies</td>
			<td>AM9730</td>
			<td>Phenol:Chloroform:IAA (25:24:1) is premixed and supplied at pH 6.6. Use provided Tris alkaline buffer to raise pH to 7.9. Store at 4 &#176;C. CAUTION: phenol:chloroform:isoamyl alcohol is corrosive, highly toxic and combustible.</td>
		</tr>
		<tr>
			<td>Primer3 (software)</td>
			<td>Steve Rozen &#38; Helen Skaletsky</td>
			<td>non-commercial</td>
			<td>http://biotools.umassmed.edu/bioapps/primer3_www.cgi</td>
		</tr>
		<tr>
			<td>Protease inhibitor tablets</td>
			<td>Roche</td>
			<td>11836170001</td>
			<td>cOmplete, Mini, EDTA-free. Use 1 tablet per 10 ml. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Protease inhibitor tablets</td>
			<td>Roche</td>
			<td>11873580001</td>
			<td>cOmplete, EDTA-free. Use 1 tablet per 50 ml. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>life technologies</td>
			<td>AM2548</td>
			<td>proteinase K solution (20 &#181;g/&#181;l). Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>RNase A</td>
			<td>life technologies</td>
			<td>12091-039</td>
			<td>RNase A (20 &#181;g/&#181;l). Store at room temperature.</td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Stuart</td>
			<td>SB3</td>
			<td>Rotator SB3</td>
		</tr>
		<tr>
			<td>SAMtools (software)</td>
			<td>Li et al.</td>
			<td>non-commercial</td>
			<td>http://samtools.sourceforge.neta</td>
		</tr>
		<tr>
			<td>Solid phase reversible immobilisation beads</td>
			<td>Beckman Coulter</td>
			<td>A63882</td>
			<td>The Agencourt AMPure XP beads are used to minimise adaptor dimer contamination in ChIP-Seq libraries. Store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>Sonicator 3000</td>
			<td>Misonix/Qsonica</td>
			<td>NA</td>
			<td>Newer models are now available. Q125, Q500 or Q700 are all suitable for shearing crosslinked chromatin.</td>
		</tr>
		<tr>
			<td>Sound enclosure</td>
			<td>Misonix/Qsonica</td>
			<td>NA</td>
			<td>optional: follow the manufacturer&#39;s recommendation to obtain the correct sound enclosure.</td>
		</tr>
		<tr>
			<td>Thermomixer</td>
			<td>eppendorf</td>
			<td>22670000</td>
			<td>Thermomixer for 24 x 1.5 mL tubes. Precise temperature control from 4 &#176;C above room temperature to 99 &#176;C.</td>
		</tr>
	</tbody>
</table>

genome-wide snapshot of chromatin regulators and states in xenopus embryos by chip-seq

The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and organ formation during development. Determining the locations and levels of such chromatin features in vivo will provide valuable information about the spatio-temporal regulation of genomic elements, and will support aspirations to mimic embryonic tissue development in vitro. The most commonly used method for genome-wide and high-resolution profiling is chromatin immunoprecipitation followed by next-generation sequencing (ChIP-Seq). This protocol outlines how yolk-rich embryos such as those of the frog Xenopus can be processed for ChIP-Seq experiments, and it offers simple command lines for post-sequencing analysis. Because of the high efficiency with which the protocol extracts nuclei from formaldehyde-fixed tissue, the method allows easy upscaling to obtain enough ChIP material for genome-wide profiling. Our protocol has been used successfully to map various DNA-binding proteins such as transcription factors, signaling mediators, components of the transcription machinery, chromatin modifiers and post-translational histone modifications, and for this to be done at various stages of embryogenesis. Lastly, this protocol should be widely applicable to other model and non-model organisms as more and more genome assemblies become available.

Des résultats équivalents à ceux présentés ici sont attendus si le protocole est bien exécuté et l&#39;anticorps en cours d&#39;utilisation est de qualité ChIP qualité (voir la discussion). Ce protocole permet l&#39;extraction des noyaux d&#39;embryons de Xenopus fixés au formaldehyde et le cisaillement efficace de la chromatine par sonication (figure 1A-C). Chromatine rasé montre une distribution asymétrique des fragments d&#39;ADN principalement allant de 100 à 1000 pb et un pic entre 300 et 500 pb (figure 1C). Un minimum de 50 pg d&#39;ADN immunoprécipité est tenu de faire avec succès un jumelé fin bibliothèque de ChIP-Seq indexées avec des inserts d&#39;ADN de taille similaire (figure 2A). La bibliothèque devrait être largement dépourvue de dimères de l&#39;adaptateur, qui peut être vu sur le électrophérogramme à environ 120 pb. Après séquençage par synthèse, pré-traitée lit sont mappés au génome (figure 2B, C). Dans une expérience réussie avec <em&gt; X. embryons tropicalis, normalement 50 à 70% de mono-lit extrémité de 40 pb peut être mappée de manière unique à l&#39;ensemble du génome de v7.1 avec au maximum deux mésappariements. Bien entrée lit aligner uniformément sur tout le génome, l&#39;alignement de la puce à lit résultats enrichissement spécifique brin qui flanquent la fonction de la chromatine d&#39;intérêt. Ce est parce que tous les fragments sont séquencés de l&#39;extrémité 5 &#39;(figure 2C) 25. Extension de l&#39;alignement à la lecture de la direction à une taille moyenne de fragment produit des profils précis pour les éléments de la chromatine simples tels que les événements de liaison du facteur de transcription. Ces occupations d&#39;ADN apparaissent comme des pics lorsque visualisée dans IGV ou tout autre navigateur compatible génome. Appelants pointe comme MACS sont utilisés pour déterminer l&#39;emplacement de ces pics (figure 3A). De cette façon, des dizaines de milliers de sites de liaison ont été déterminées dans le X. tropicalis génome pour T-box facteurs de transcription tels que Vegt 26. ChIP-qPCR expéments devraient confirmer l&#39;enrichissement locale trouvée par ChIP-Seq (figure 3B). expériences de ChIP-Seq permettent d&#39;explorer les caractéristiques de l&#39;ensemble du génome de caractéristiques de la chromatine. Par exemple, calculer la répartition de lecture sur les éléments génomiques telles que le démarrage de la transcription et de sites de terminaison peut mettre en évidence les préférences contraignantes spatiales autour de gènes (figure 3C). De même, un heatmap des distributions de lecture à des endroits de pointe est utilisé pour comparer différentes caractéristiques de la chromatine à l&#39;échelle du génome entier (Figure 3D). Certains facteurs de transcription se lient séquence d&#39;ADN spécifiquement. De novo analyse de motif de pics sous-jacentes de l&#39;ADN génomique peut récupérer ce genre d&#39;information, y compris les motifs de co-enrichi de co-facteurs potentiels (Figure 3E). La grande majorité des gènes cibles montrent ADN occupation à un plus bas plutôt que niveau plus élevé (figure 3F). Cette fonctionnalité sans échelle semble être assez fréquent chez les trfacteurs de anscription et suggère que seule une petite fraction de gènes cibles sont directement réglé avec pertinence biologique 27,28. L&#39;analyse des termes de GO enrichis ou d&#39;autres attributs tels que l&#39;expression différentielle des gènes cibles peut en outre révéler un aperçu de la fonction biologique de la fonction de la chromatine dans l&#39;embryon de Xenopus (figure 3G). <img alt="Figure 1" src="/files/ftp_upload/52535/52535fig1highres.jpg" /> Figure 1. La chromatine procédure d&#39;immunoprécipitation pour les embryons de Xenopus. (A) Les embryons sont le formaldéhyde-fixe au stade de développement de l&#39;intérêt pour lier de manière covalente (réticulation) des protéines associées à l&#39;ADN génomique. Lors de l&#39;extraction nucléaire (B), la chromatine réticulé est fragmentée pour affiner l&#39;ADN génomique de liaison ou les sites de modification de la chromatine en minimisant le DN d&#39;accompagnementUne séquence (C). Par la suite, les fragments de chromatine sont immunoprécipités avec un anticorps ChIP de qualité pour enrichir ceux contenant l&#39;épitope d&#39;intérêt (D). L&#39;ADN de co-immunoprécipitée est enlevé la protéine et purifié (E) avant de créer la banque de fragments de puce pour NGS (Figure 2). <a href="https://www.jove.com/files/ftp_upload/52535/52535fig1large.jpg" target="_blank">Se il vous plaît cliquer ici pour voir une version plus grande de cette figure.</a> <img alt="Figure 2" src="/files/ftp_upload/52535/52535fig2highres.jpg" /> Figure 2. Préparation de la bibliothèque ChIP-Seq, le séquençage par synthèse, la cartographie et les appels de pointe. (A) Le électrophérogramme affiche une bonne bibliothèque de ChIP-Seq avec des modèles d&#39;ADN de 250 à 450 pb. Ces modèles comportent l&#39;insert d&#39;ADN d&#39;intérêt flanquée par le universel (58 pb) et la (63 pb) indexé adaptateur (B). </strong&gt; Des millions de grappes, avec chaque groupe contenant des modèles identiques, sont la base séquencée par la base, en présence des quatre nucléotides possédant réversible, fluorophore distincte et propriétés de terminaison identiques. Images fluorescentes sont traitées en temps réel pour appeler bases correspondantes, qui sont finalement assemblés en lit. (C) ne lit que cette carte unique pour le génome de Xenopus sont conservés. Comme tous les fragments sont séquences à partir de l&#39;extrémité 5 &#39;, la mise en correspondance de résultats en lit ChIP pics spécifiques à brin qui flanquent la fonction de la chromatine d&#39;intérêt. Ainsi, les appelants pointe détectent l&#39;enrichissement qui provient immunoprécipitation et d&#39;étendre le lit à une longueur moyenne des fragments de localiser avec précision les caractéristiques de la chromatine. <a href="https://www.jove.com/files/ftp_upload/52535/52535fig2large.jpg" target="_blank">Se il vous plaît cliquer ici pour voir une version plus grande de cette figure.</a> <img aLT = &quot;Figure 3&quot; src = &quot;/ files / ftp_upload / 52535 / 52535fig3highres.jpg&quot; /&gt; Figure 3. Un exemple d&#39;analyse post-séquençage et la visualisation de données au moyen du facteur T-boîte de zygotique transcription Vegt (zVegT). Tous lire chiffres indiqués ici sont normalisés à 10 millions cartographié de façon unique et non redondant lectures. (A) Extrait du profil de l&#39;ensemble du génome de zVegT obligatoire dans X. Les embryons de tropicalis (stade 11 à 12,5 après Nieuwkoop et Faber 29). Chaque pic, un carambolage de lit étendu, représente un site de liaison. Ces pics sont appelés par MACS2 avec un taux de fausse découverte (FDR) de moins de 1%. Chaque gène MESP montre liaison zVegT très proximale et en amont, mais seulement mespa et mespb sont exprimés à ce stade (données d&#39;ARN-Seq 30). (B) le taux d&#39;occupation de l&#39;ADN de zVegT tel que déterminé par ChIP-qPCR à plusieurs loci (y compris un non région liØe 0,5 kb en amont du β-actine) confirm l&#39;enrichissement spécifique trouvée par ChIP-Seq. Comparer les résultats pour mespa avec un pic appelé (barre rouge) dans (A). Le taux d&#39;occupation de l&#39;ADN est visualisé en tant que pourcentage de l&#39;entrée à la fois, la puce avec l&#39;anticorps Vegt (polyclonal de lapin d&#39;isotype IgG) et la puce avec l&#39;anticorps de contrôle (IgG de lapin normal). Les barres d&#39;erreur reflètent l&#39;écart type de deux répétitions biologiques. (C) metagene analyse montre liaison zVegT préférentiel (balises binned plus de 25 pb) au promoteur par rapport à toute autre région génomique autour et au sein des organes de gènes. (D) Heatmap montre k-moyenne cluster niveaux (k = 5) d&#39;occupation d&#39;ADN (tags binned plus de 25 pb) et du zVegT Smad2 / Smad3 (données de la puce-Seq 31) par rapport à toutes les régions zVegT-liés au stade de la gastrula. Le heatmap est log 2 basé et centré à 5 étiquettes par pb. (E) De novo analyse de motif découvre le motif de liaison canonique T-box facteur de transcription dans 38% des zVegT-régions à destination si le score de motif sous-jacent est normalisée à un taux de découverte de 5% dans les séquences de fond. La carte de densité montre plus haut enrichissement pour le motif T-box dans le centre de sites de liaison zVegT, alors que le motif de liaison Smad2 / Smad3 canonique est peu enrichi. (F) de l&#39;histogramme montre les taux d&#39;occupation de l&#39;ADN de zVegT, qui sont calculées pour chaque gène cible de tous les pics (+/- 200 pb) entre 5 kb en amont [-]. et 1 kb en aval [+] de sites de départ de transcription correspondant (G) Top 300 gènes avec plus hauts niveaux d&#39;occupation de l&#39;ADN au sein de -5 kb et 1 kb sont enrichi pour les processus biologiques du développement embryonnaire précoce. Ceux-ci vont termes sont en ligne avec la fonction putative de zVegT. Le FDR est basée sur un test exact de Fisher bilatéral et corrigé pour les tests multiples. <a href="https://www.jove.com/files/ftp_upload/52535/52535fig3large.jpg" target="_blank">Se il vous plaît cliquer ici pour voir une version plus grande de cette figure.</a>

Watch this Scientific Journal Video about Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq at JoVE.com

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

La question de savoir comment les organismes de réglementation et des états de la chromatine chromatine affecte le génome in vivo est essentielle à notre compréhension de la façon dont les premières décisions du destin cellulaire sont faites dans l&#39;embryon en développement. ChIP-Seq-la méthode la plus populaire pour étudier les caractéristiques de la chromatine au niveau-est globale définie ici pour les embryons de xénope.

Snapshot échelle du génome des régulateurs de la chromatine et les États dans<em&gt; Xenopus</em&gt; Embryons par Chip-Seq

The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and ...

genome-wide-snapshot-chromatin-regulators-states-xenopus-embryos-chip

Research

JoVE Journal

Developmental Biology

Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

12.2K vues.  MRC National Institute for Medical Research.  La question de savoir comment les organismes de réglementation et des états de la chromatine chromatine affecte le génome in vivo est essentielle à notre compréhension de la façon dont les premières décisions du destin cellulaire sont faites dans l'embryon en développement. ChIP-Seq-la méthode la plus populaire pour étudier les caractéristiques de la chromatine au niveau-est globale définie ici pour les embryons de xénope. 

Vidéo: Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

Manipulation and In Vitro Maturation of Xenopus laevis Oocytes, Followed by Intracytoplasmic Sperm Injection, to Study Embryonic Development

Amphibian eggs have been widely used to study embryonic development. Early embryonic development is driven by maternally stored factors accumulated during oogenesis. In order to study roles of such maternal factors in early embryonic development, it is desirable to manipulate their functions from the very beginning of embryonic development. Conventional ways of gene interference are achieved by injection of antisense oligonucleotides (oligos) or mRNA into fertilized eggs, enabling under- or over-expression of specific proteins, respectively. However, these methods normally require more than several hours until protein expression is affected, and, hence, the interference of gene functions is not effective during early embryonic stages. Here, we introduce an experimental system in which expression levels of maternal proteins can be altered before fertilization. Xenopus laevis oocytes obtained from ovaries are defolliculated by incubating with enzymes. Antisense oligos or mRNAs are injected into defolliculated oocytes at the germinal vesicle (GV) stage. These oocytes are in vitro matured to eggs at the metaphase II (MII) stage, followed by intracytoplasmic sperm injection (ICSI). By this way, up to 10% of ICSI embryos can reach the swimming tadpole stage, thus allowing functional tests of specific gene knockdown or overexpression. This approach can be a useful way to study roles of maternally stored factors in early embryonic development.

Manipulation and In Vitro Maturation of Xenopus laevis Oocytes, Followed by Intracytoplasmic Sperm Injection, to Study Embryonic Development

We describe methods of manipulating Xenopus laevis immature oocytes, in vitro maturation of oocytes to eggs, and intracytoplasmic sperm injection. This protocol allows degradation of some maternal proteins and overexpression of genes of interest at fertilization, and hence is valuable to study roles of specific factors in early embryonic development.

Manipulation et<em&gt; In Vitro</em&gt; Maturation du<em&gt; Xenopus laevis</em&gt; ovocytes, Suivi par injection intracytoplasmique de spermatozoïdes, pour étudier le développement embryonnaire

Amphibian eggs have been widely used to study embryonic development. Early embryonic development is driven by maternally stored factors accumulated during ...

Recherche

Biologie du développement

Accurate and Phenol Free DNA Sexing of Day 30 Porcine Embryos by PCR

Research into prenatal programming in the pig has shown that the sex of the developing embryo or fetus can influence the developmental outcome. Therefore, the ability to determine an embryo&#39;s sex is necessary in many experiments particularly regarding early development. The present protocol demonstrates an inexpensive, rapid and non-toxic preparation of pig genomic DNA for use with PCR. Day 30 embryos must be humanely collected according to the guidelines established by Institutional Animal Policy and Welfare Committees for the present protocol. The preparation of the whole embryo for this PCR based sexing technique simply involves grinding the frozen embryo to a fine powder using a pre-chilled mortar and pestle. PCR-quality DNA is released from a small amount of embryo powder by applying a hot incubation in an alkaline lysis reagent. Next, the DNA solution is mixed with neutralization buffer and used directly for PCR. Two primer pairs are generated to detect specific sex determining region of the Y- chromosome (SRY) and ZFX region of the X- chromosome with high accuracy and specificity. The same protocol can be applied to other elongated embryos (Day 10 to Day 14) earlier than Day 30. Also, this protocol can be carried with 96-welled plates when screening a large number of embryos, making it feasible for automation and high-throughput sex typing.

This protocol describes an accurate, inexpensive, rapid and non-toxic method to determine the sex of Day 30 porcine embryo using PCR method after grinding an embryo into powder without phenol chloroform extraction and DNA column purification.

Précis et phénol libre ADN sexage des embryons de porcins Jour 30 par PCR

Research into prenatal programming in the pig has shown that the sex of the developing embryo or fetus can influence the developmental outcome. Therefore, ...

Technique to Target Microinjection to the Developing Xenopus Kidney

The embryonic kidney of Xenopus&#160;laevis (frog), the pronephros, consists of a single nephron, and can be used as a model for kidney disease. Xenopus embryos are large, develop externally, and can be easily manipulated by microinjection or surgical procedures. In addition, fate maps have been established for early Xenopus embryos. Targeted microinjection into the individual blastomere that will eventually give rise to an organ or tissue of interest can be used to selectively overexpress or knock down gene expression within this restricted region, decreasing secondary effects in the rest of the developing embryo. In this protocol, we describe how to utilize established Xenopus fate maps to target the developing Xenopus kidney (the pronephros), through microinjection into specific blastomere of 4- and 8-cell embryos. Injection of lineage tracers allows verification of the specific targeting of the injection. After embryos have developed to stage 38 - 40, whole-mount immunostaining is used to visualize pronephric development, and the contribution by targeted cells to the pronephros can be assessed. The same technique can be adapted to target other tissue types in addition to the pronephros.

Technique to Target Microinjection to the Developing Xenopus Kidney

Here, we present a protocol to use fate maps and lineage tracers to target injections into individual blastomeres that give rise to the kidney of Xenopus laevis embryos.

Technique à la cible microinjection du Developing<em&gt; Xenopus</em&gt; Kidney

The embryonic kidney of Xenopus&#160;laevis (frog), the pronephros, consists of a single nephron, and can be used as a model for kidney disease. Xenopus ...

Generation of Parabiotic Zebrafish Embryos by Surgical Fusion of Developing Blastulae

Surgical parabiosis of two animals of different genetic backgrounds creates a unique scenario to study cell-intrinsic versus cell-extrinsic roles for candidate genes of interest, migratory behaviors of cells, and secreted signals in distinct genetic settings. Because parabiotic animals share a common circulation, any blood or blood-borne factor from one animal will be exchanged with its partner and vice versa. Thus, cells and molecular factors derived from one genetic background can be studied in the context of a second genetic background. Parabiosis of adult mice has been &#160;used extensively to research aging, cancer, diabetes, obesity, and brain development. More recently, parabiosis of zebrafish embryos has been used to study the developmental biology of hematopoiesis. In contrast to mice, the transparent nature of zebrafish embryos permits the direct visualization of cells in the parabiotic context, making it a uniquely powerful method for investigating fundamental cellular and molecular mechanisms. The utility of this technique, however, is limited by a steep learning curve for generating the parabiotic zebrafish embryos. This protocol provides a step-by-step method on how to surgically fuse the blastulae of two zebrafish embryos of different genetic backgrounds to investigate the role of candidate genes of interest. In addition, the parabiotic zebrafish embryos are tolerant to heat shock, making temporal control of gene expression possible. This method does not require a sophisticated set-up and has broad applications for studying cell migration, fate specification, and differentiation in vivo during embryonic development.

This protocol provides step-by-step instruction on how to generate parabiotic zebrafish embryos of different genetic backgrounds. When combined with the unparalleled imaging capabilities of the zebrafish embryo, this method provides a uniquely powerful means to investigate cell-autonomous versus non-cell-autonomous functions for candidate genes of interest.

Génération de parabiose Zebrafish Embryons par Fusion chirurgicale de développement blastulas

Surgical parabiosis of two animals of different genetic backgrounds creates a unique scenario to study cell-intrinsic versus cell-extrinsic roles for ...

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the cells are located. Specifically, they have been developed to analyze the electrical activity of excitable cells, such as spinal neurons. In such a scenario, it is crucial to preserve the integrity of the spinal cell, but it is also important to preserve the anatomy and physiological shape of the systems involved. Indeed, the comprehension of the manner in which the nervous system-and other complex systems-works must be based on a systemic approach. For this reason, the live zebrafish embryo was chosen as a model system, and the spinal neuron membrane voltage changes were evaluated without interfering with the physiological conditions of the embryos. 
Here, an approach combining the employment of zebrafish embryos with a FRET-based biosensor is described. Zebrafish embryos are characterized by a very simplified nervous system and are particularly suited for imaging applications thanks to their transparency, allowing for the employment of fluorescence-based voltage indicators at the plasma membrane during zebrafish development. The synergy between these two components makes it possible to analyze the electrical activity of the cells in intact living organisms, without perturbing the physiological state. Finally, this non-invasive approach can co-exist with other analyses (e.g., spontaneous movement recordings, as shown here).

Protocols described here allow for the study of the electrical properties of excitable cells in the most non-invasive physiological conditions by employing zebrafish embryos in an in vivo system together with a fluorescence resonance energy transfer (FRET)-based genetically encoded voltage indicator (GEVI) selectively expressed in the cell type of interest.

Biosensing Potentiel de membrane de neurones moteurs dans les embryons vivants de zébrés

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Visualization and Quantitative Analysis of Embryonic Angiogenesis in Xenopus tropicalis

Blood vessels supply oxygen and nutrients throughout the body, and the formation of the vascular network is under tight developmental control. The efficient in vivo visualization of blood vessels and the reliable quantification of their complexity are key to understanding the biology and disease of the vascular network. Here, we provide a detailed method to visualize blood vessels with a commercially available fluorescent dye, human plasma acetylated low density lipoprotein DiI complex (DiI-AcLDL), and to quantify their complexity in Xenopus tropicalis. Blood vessels can be labeled by a simple injection of DiI-AcLDL into the beating heart of an embryo, and blood vessels in the entire embryo can be imaged in live or fixed embryos. Combined with gene perturbation by the targeted microinjection of nucleic acids and/or the bath application of pharmacological reagents, the roles of a gene or of a signaling pathway on vascular development can be investigated within one week without resorting to sophisticated genetically engineered animals. Because of the well-defined venous system of Xenopus and its stereotypic angiogenesis, the sprouting of pre-existing vessels, vessel complexity can be quantified efficiently after perturbation experiments. This relatively simple protocol should serve as an easily accessible tool in diverse fields of cardiovascular research.

Visualization and Quantitative Analysis of Embryonic Angiogenesis in Xenopus tropicalis

This protocol demonstrates a fluorescence-based method to visualize the vasculature and to quantify its complexity in Xenopus tropicalis. Blood vessels can be imaged minutes after the injection of a fluorescent dye into the beating heart of an embryo after genetic and/or pharmacological manipulations to study cardiovascular development in vivo.

Visualisation et analyse quantitative de l&#39;angiogenèse embryonnaire dans<em&gt; Xenopus tropicalis</em

Blood vessels supply oxygen and nutrients throughout the body, and the formation of the vascular network is under tight developmental control. The ...

CARIP-Seq and ChIP-Seq: Methods to Identify Chromatin-Associated RNAs and Protein-DNA Interactions in Embryonic Stem Cells

Embryonic stem (ES) cell self-renewal&#160;and differentiation is governed by extrinsic signals and intrinsic networks of transcription factors, epigenetic regulators, and post-translation modifications of histones that combinatorially influence the gene expression state of nearby genes. RNA has also been shown to interact with various proteins to regulate chromatin dynamics&#160;and gene expression. Chromatin-associated RNA immunoprecipitation (CARIP) followed by next-generation sequencing (CARIP-Seq) is a novel method to survey RNAs associated with chromatin proteins, while chromatin immunoprecipitation followed by next-generation sequencing (ChIP-Seq) is a powerful genomics technique to map the location of post-translational modification of histones, transcription factors, and epigenetic modifiers on a global-scale in ES cells. Here, we describe methods to perform CARIP-Seq and ChIP-Seq, including library construction for next-generation sequencing, to generate global chromatin-associated RNA and epigenomic maps in ES cells.

Here, we describe methods to perform ChIP-Seq and CARIP-Seq, including library preparation for next-generation sequencing, to generate global epigenomic and chromatin-associated RNA maps in ES cells.

CAIRP-Seq et ChIP-Seq : méthodes pour identifier les ARN associée à la chromatine et Interactions protéine-ADN dans les cellules souches embryonnaires

Embryonic stem (ES) cell self-renewal&#160;and differentiation is governed by extrinsic signals and intrinsic networks of transcription factors, ...

Visualizing the Node and Notochordal Plate In Gastrulating Mouse Embryos Using Scanning Electron Microscopy and Whole Mount Immunofluorescence

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is the formation of the transient organizers, the node and notochordal plate, from cells that have passed through the primitive streak. The proper formation of these signaling centers is essential for the development of the body plan and techniques to visualize them are of high interest to mouse developmental biologists. The node and notochordal plate lie on the ventral surface of gastrulating mouse embryos around embryonic day (E) 7.5 of development. The node is a cup-shaped structure whose cells possess a single slender cilium each. The proper subcellular localization and rotation of the cilia in the node pit determines left-right asymmetry. The notochordal plate cells also possess single cilia albeit shorter than those of the node cells. The notochordal plate forms the notochord which acts as an important signaling organizer for somitogenesis and neural patterning. Because the cells of the node and notochordal plate are transiently present on the surface and possess cilia, they can be visualized using scanning electron microscopy (SEM). Among other techniques used to visualize these structures at the cellular level is whole mount immunofluorescence (WMIF) using the antibodies against the proteins that are highly expressed in the node and notochordal plate. In this report, we describe our optimized protocols to perform SEM and WMIF of the node and notochordal plate in developing mouse embryos to help in the assessment of tissue shape and cellular organization in wild-type and gastrulation mutant embryos.

The node and notochordal plate are transient signaling organizers in developing mouse embryos that can be visualized using several techniques. Here, we describe in detail how to perform two of the techniques to study their structure and morphogenesis: 1) scanning electron microscopy (SEM); and 2) whole mount immunofluorescence (WMIF).

Visualiser le nœud et la notochorde plaque en Gastrulating des embryons de souris à l’aide de la microscopie électronique à balayage et toute monture Immunofluorescence

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is ...

Microinjection of DNA into Eyebuds in Xenopus laevis Embryos and Imaging of GFP Expressing Optic Axonal Arbors in Intact, Living Xenopus Tadpoles

The primary visual projection of tadpoles of the aquatic frog Xenopus laevis serves as an excellent model system for studying mechanisms that regulate the development of neuronal connectivity. During establishment of the retino-tectal projection, optic axons extend from the eye and navigate through distinct regions of the brain to reach their target tissue, the optic tectum. Once optic axons enter the tectum, they elaborate terminal arbors that function to increase the number of synaptic connections they can make with target interneurons in the tectum. Here, we describe a method to express DNA encoding green fluorescent protein (GFP), and gain- and loss-of-function gene constructs, in optic neurons (retinal ganglion cells) in Xenopus embryos. We explain how to microinject a combined DNA/lipofection reagent into eyebuds of one day old embryos such that exogenous genes are expressed in single or small numbers of optic neurons. By tagging genes with GFP or co-injecting with a GFP plasmid, terminal axonal arbors of individual optic neurons with altered molecular signaling can be imaged directly in brains of intact, living Xenopus tadpoles several days later, and their morphology can be quantified. This protocol allows for determination of cell-autonomous molecular mechanisms that underlie the development of optic axon arborization in vivo.

Microinjection of DNA into Eyebuds in Xenopus laevis Embryos and Imaging of GFP Expressing Optic Axonal Arbors in Intact, Living Xenopus Tadpoles

This protocol aims to demonstrate how to microinject a DNA/DOTAP mixture into eyebuds of one day old Xenopus laevis embryos, and how to image and reconstruct individual green fluorescent protein (GFP) expressing optic axonal arbors in tectal midbrains of intact, living Xenopus tadpoles.

Microinjection d'ADN dans eyebuds in Xenopus laevis Embryos and Imaging of GFP Expressing Optic Axonal Arbors in Intact, Living Xenopus Tadpoles

The primary visual projection of tadpoles of the aquatic frog Xenopus laevis serves as an excellent model system for studying mechanisms that regulate the ...

Analysis of Transforming Growth Factor &#223; Family Cleavage Products Secreted Into the Blastocoele of Xenopus laevis Embryos

The two arms of the Transforming Growth Factor &#223; (Tgf&#223;) superfamily, represented by Tgf&#223;/Nodal or Bone morphogenetic protein (Bmp) ligands, respectively, play essential roles in embryonic development and adult homeostasis. Members of the Tgf&#223; family are made as inactive precursors that dimerize and fold within the endoplasmic reticulum. The precursor is subsequently cleaved into ligand and prodomain fragments. Although only the dimeric ligand can engage Tgf&#223; receptors and activate downstream signaling, there is growing recognition that the prodomain moiety contributes to ligand activity. This article describes a protocol that can be used to identify cleavage products generated during activation of Tgf&#223; precursor proteins. RNA encoding Tgf&#223; precursors are first microinjected into X. laevis embryos. The following day, cleavage products are collected from the blastocoele of&#160;gastrula stage embryos and analyzed on Western blots. This protocol can be completed relatively quickly, does not require expensive reagents and provides a source of concentrated Tgf&#223; cleavage products under physiologic conditions.

Analysis of Transforming Growth Factor &#223; Family Cleavage Products Secreted Into the Blastocoele of Xenopus laevis Embryos

When Transforming Growth Factor &#223; family precursor proteins are ectopically expressed in Xenopus laevis embryos, they dimerize, get cleaved and are secreted into the blastocoele, which begins at the late blastula to early gastrula stage. We describe a method for aspirating cleavage products from the blastocoele cavity for immunoblot analysis.

Analyse du facteur de croissance transformant ß Produits de clivage de la famille sécrétés en blastocoèles d’embryons xenopus laevis

The two arms of the Transforming Growth Factor &#223; (Tgf&#223;) superfamily, represented by Tgf&#223;/Nodal or Bone morphogenetic protein (Bmp) ligands, ...