AOH and MAS acknowledges the College of Science and the Thomas H. Gosnell School of Life Sciences at the Rochester Institute of Technology for support. This work was supported in part by United States National Science Foundation (NSF) award to AOH MCB-1120541.

NOTE: The authors are willing to provide bacterial strains and recombinant plasmids to facilitate the incorporation of functional complementation analysis for teaching purposes for individuals who are interested. The plasmids that were used to facilitate functional complementation experiments are listed in Table 1.
1. Construction of Plasmids for Functional Complementation
<ol>
	<li>Cloning of Diaminopimelate Aminotransferase (dapL) for Functional Complementation.
	<ol>
		<li>Amplify the dapL open reading frame (ORF) from the V. spinosum and cDNAs from A. thaliana and C. reinhardtii by PCR. Use 1 cycle at 94 &#176;C for 2 min, followed by 30 cycles of 94 &#176;C for 15 sec, 60 &#176;C for 30 sec and 72 &#176;C for 2 min. Include 12 pmoles of each primer, 1 mM MgSO4, 0.5 mM each of the 4 deoxynucleotide triphosphates, and 0.5 ng of template DNA and 1 unit of Pfx DNA polymerase. 
		NOTE: The complete description pertaining to the recombinant cloning of three dapL orthologs from the plant A. thaliana (At-dapL), the bacterium Verrucomicrobium spinosum (Vs-dapL) and the alga Chlamydomonas reinhardtii (Cr-dapL) has been previously published.2,18-20 
		NOTE: The primers used for the cloning of the dapL orthologs are as follows: 
		VsdapL F- 5&#39;-CCCCGAATTCATGGCCCTCATCAACGAAAACTTCCTCAAG-3&#39; 
		VsdapL R 5&#39;- CCCCGTCGACCTACTTCAGCGCGGCGATACGGCGGCAGAC-3&#39; 
		AtdapL F- 5&#39;-GGGGCATTGGAAGGAGATATAACCATGGCAGTCAATACTTGCAAATGT-3&#39; 
		AtdapL R-5&#39;- GGGGGTCGACTCATTTGTAAAGCTGCTTGAATCTTCG-3&#39; 
		CrdapL F-5&#39;-CCCCCGAATTCATGCAGCTCAACGTGCGGTCCACCGCCAGC-3&#39; 
		CrdapL R-5&#39;- CCCCCAAGCTTCTAGTTACGCTTGCCGTAGGCCTCCTTAAA-3&#39;</li>
		<li>Clone the PCR fragments into the plasmid pET30A to produce the recombinant plasmids, pET30A::VsdapL, pET30A::AtdapL and pET30A::CrdapL using the primers, restriction enzymes and T4 DNA ligase.
		<ol>
			<li>Briefly, incubate 50 ng of insert and 20 ng of vector in 1x ligase buffer and 1 unit of T4 DNA ligase overnight at 17 &#176;C. Transform ligation into E. coli Dh5&#945; cells and screen for colonies on LB plates supplemented with 50 &#181;g/ml&#8722;1 kanamycin by incubating at 37 &#176;C for 24 hr.18-20</li>
		</ol>
		</li>
		<li>To create the plasmid for functional complementation, digest pET30A::VsdapL and pET30A::AtdapL plasmids with the restriction enzymes XbaI and SalI and XbaI and HindIII for the pET30A::CrdapL. Ligate the inserts into the plasmid pBAD33 using T4 DNA ligase to produce the plasmids pBAD33::VsdapL; pBAD33::AtdapL and pBAD33::CrdapL.
		<ol>
			<li>Incubate 50 ng of insert and 20 ng of vector in 1x ligase buffer and 1 unit of T4 DNA ligase overnight at 17 &#176;C. Transform ligation into E. coli Dh5&#945; cells and screen for colonies on LB plates supplemented with 34 &#181;g/ml&#8722;1 kanamycin by incubating 37 &#176;C for 24 hr.20</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Cloning of Tyrosine Aminotransferase (tyrB) from A. thaliana for Functional Complementation. 
	NOTE: The complete details regarding the cloning of the cDNA from A. thaliana annotated by the locus tags At5g36160 has been described previously.4 
	<ol>
		<li>Amplify the cDNA by PCR. Use 1 cycle at 94 &#176;C for 2 min, followed by 30 cycles of 94 &#176;C for 15 sec, 60 &#176;C for 30 sec and 72 &#176;C for 2 min. Include 12 pmoles of each primer, 1 mM MgSO4, 0.5 mM each of the four deoxynucleotide triphosphates, and 0.5 ng of template DNA and 1 unit of Pfx DNA polymerase. 
		NOTE: The primers used for the cloning of the At5g36160 are as follows: 
		AttyrB F- 5&#39;-CCCCGAATTCATGGGAGAAAACGGAGCCAAGCGAT-3&#39; 
		AttyrB R- 5&#39;- CCCCGAATTCATGGGAGAAAACGGAGCCAAGCGAT-3&#39;</li>
		<li>Clone the fragment into the plasmid pET30A to produce the recombinant plasmids pET30A::At5g36160 by digesting the PCR fragment with EcoR1 and Sal1; ligate in the fragment into pET30A using T4 DNA ligase as described below.4</li>
		<li>To create the functional complementation plasmid, digest the pET30A::At5g36160 with the restriction enzymes XbaI and HindIII, and ligate the insert into pBAD33 using the same restriction enzyme sites to produce the recombinant plasmid pBAD33::At5g3160 using T4 DNA ligase.
		<ol>
			<li>Incubate 50 ng of insert and 20 ng of vector in 1x ligase buffer and 1 unit of T4 DNA ligase overnight at 17 &#176;C. Transform the ligation into E. coli Dh5&#945; cells and screen for colonies on LB plates supplemented with 34 &#181;g/ml&#8722;1 chloramphenicol by incubating 37 &#176;C for 24 hr.4</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Cloning of UDP-N-acetylmuramoyl-L-alanyl-D-glutamate-meso-2,6-diaminopimelate Ligase (murE) from V. spinosum for Functional Complementation. 
	NOTE: The cloning of the murE ORF from V. spinosum has been described previously.18
	<ol>
		<li>Amplify the open reading frame by PCR. Use 1 cycle at 94 &#176;C for 2 min, followed by 30 cycles of 94 &#176;C for 15 sec, 60 &#176;C for 30 sec and 72 &#176;C for 2 min. Include 12 pmoles of each primer, 1 mM MgSO4, 0.5 mM each of the four deoxynucleotide triphosphates, 0.5 ng of template DNA and 1 unit of Pfx DNA polymerase. Then clone into the plasmid pET100D to produce the plasmid pET100D::VsmurE. 
		NOTE: The primers used for the cloning of the VsmurE are as follows: 
		VsMurE F- 5&#39;- CACCATGACCATTTTGCGCGATCTTATCGAGGGT -3&#39; 
		VsMurE R- 5&#39;- GTCGACTCACTGACGGTCATCCCTCCTTTGGCGTGC-3&#39;</li>
		<li>To produce the plasmid for functional complementation, digest the pET100D::VsmurE 
		With the restriction enzymes XbaI and Sal1 and ligate the insert into pBAD33 to produce the recombinant plasmid pBAD33::VsmurE using T4 DNA ligase.
		<ol>
			<li>Incubate 50 ng of insert and 20 ng of vector in 1x ligase buffer, along with 1 unit of T4 DNA ligase, overnight at 17 &#176;C. Transform ligation into E. coli Dh5&#945; cells and screen for colonies on LB plates supplemented with 34 &#181;g/ml&#8722;1 chloramphenicol by incubating 37 &#176;C for 24 hr.8</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Cloning of relA/spoT (rsh) from Novosphingobium sp for Functional Complementation. 
	NOTE: The cloning of the rsh from Novosphingobium sp. has been described previously.17 
	<ol>
		<li>Amplify the rsh ORF in addition to 599 nucleotides upstream of the initiation start site and 46 nucleotides downstream at the termination site by PCR. Use 1 cycle at 94 &#176;C for 2 min, followed by 30 cycles of 94 &#176;C for 15 sec, 60 &#176;C for 30 sec and 72 &#176;C for 2 min. Include 12 pmoles of each primer, 1 mM MgSO4, 0.5 mM each of the four deoxynucleotide triphosphates, 0.5 ng of template DNA and 1 unit of Taq DNA polymerase. Then clone into the plasmid pCR2.1 to produce pCR2.1::Nsprsh.
		<ol>
			<li>Incubate 1 &#181;l of amplified PCR fragment, 1 &#181;l of pCR2.1 vector, 1 &#181;l of salt solution and 1 &#181;l of water. Incubate at 25 &#176;C for 5 min and 2 &#181;l of ligation into E. coli cells, and screen for colonies on LB plates supplemented with 50 &#181;g/ml&#8722;1 kanamycin by incubating 37 &#176;C for 24 hr. 
			NOTE: The primers used for the cloning of the rsh are as follows: 
			rsh F- 5&#39;- GTTGAAAAACGCCGAATAGC -3&#39; 
			rsh R- 5&#39;- GAGACCTGTGCGTAGGTGGT -3&#39;</li>
			<li>For functional complementation, digest the plasmid pCR2.1::Nsprsh with EcoR1 and ligate the insert into the broad host range pRK290 to produce the recombinant plasmid pRK290::Nsprsh using T4 DNA ligase.
			<ol>
				<li>Incubate 50 ng of insert and 20 ng of vector in 1x ligase buffer and 1 unit of T4 DNA ligase overnight at 17 &#176;C. Transform ligation into E. coli Dh5&#945; cells and screen for colonies on LB plates supplemented with 10 &#181;g/ml&#8722;1 tetracycline by incubating 37 &#176;C for 24 hr.17</li>
			</ol>
			</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Preparation of Electro-competent Bacterial Cells to Facilitate Transformation
NOTE: The preparation of electro-competent cells is based on the protocol 26 for 1.0 L of culture that can be scaled down to a smaller volume (i.e., 250 ml). Please note that this protocol can be used to make all the strains competent that are described in this manuscript to facilitate FCA.22
<ol>
	<li>Inoculate 50 ml of liquid medium with a single colony into a flask and grow over night, making sure to check the genotype of the mutant before commencing this step (Table 2).</li>
	<li>On day two, inoculate 1.0 L of the appropriate medium (LB for E. coli mutants and PD for Novosphingobium sp) with the 50 ml of the overnight culture, and grow to an OD600 to 0.4-0.6 (log phase) at 30 &#176;C.</li>
	<li>Harvest cells by centrifuging at 5,000 x g for 15 min at 4 &#176;C, decant the supernatant, and resuspend the pellet in 500 ml of sterile ice-cold pure H2O.</li>
	<li>Centrifuge the cells at 5,000 x g for 20 min at 4 &#176;C, decant the supernatant and resuspend the pellet in 250 ml of sterile ice-cold 10% glycerol.</li>
	<li>Centrifuge the cells at 5,000 x g for 20 min at 4 &#176;C, decant the supernatant, and resuspend the pellet in 2.0 ml of 10% glycerol.</li>
	<li>Aliquot the cells by transferring 50 &#181;l into micro-centrifuge tubes and immediately freeze by placing the tubes in a dry-ice-ethanol bath. Store the competent cells at -80 &#176;C for electroporation.</li>
</ol>
3. Electroporation of Bacterial Cells with Complementation Plasmids
<ol>
	<li>For electroporation, add 1.0 &#181;l (10-50 ng) of recombinant plasmid to an aliquot (50 &#181;l) of competent cells and place on ice for 5 min.</li>
	<li>Transfer the mixture via pipetting to an electroporation cuvette and set the electroporation apparatus to the following setting: 25 &#181;F capacitance, 2.5 kV, and 200 ohm resistance and deliver a pulse.</li>
	<li>Add 1.0 ml of recovery media (LB) to the electroporation cuvette and transfer using a pipette to a 15 ml conical tube. Recover with gentle rotation for 60 min in a shaking incubator.</li>
	<li>Plate 100 &#181;l of the culture from the recovery step onto the agar plates to select for transformants by pipetting and spreading using a sterile spreader. 
	NOTE: Make sure to check Table 1 and Table 2 before commencing this step to check the antibiotics and genotypes to make the proper agar plates.</li>
</ol>
4. Transformation of AOH1 to Facilitate Functional Complementation Using L,L-diaminopimelate Aminotransferase (dapL)
<ol>
	<li>For complementation analysis, transform AOH1 with the empty vector (pBAD33), and with the DapL expression vectors in separate transformation events using the electroporation protocol outlined in section 3.0.</li>
	<li>Select transformants by plating on LB agar medium supplemented with 50 &#181;g/ml&#8722;1 DAP and 34 &#181;g/ml&#8722;1 chloramphenicol and 50 &#181;g/ml&#8722;1 kanamycin.</li>
	<li>Test for functional complementation by replica-plating colonies by streaking onto LB medium with 0.2% (w/v) arabinose with and without 50 &#181;g/ml&#8722;1 DAP and 34 &#181;g/ml&#8722;1 kanamycin.</li>
	<li>Incubate plates at 30 &#176;C for 24 hr and observe results. 
	NOTE: The result should show that the mutant is only able to grow on DAP free media only when the dapL gene is expressed in the mutant background when compared to the vector only control.</li>
</ol>
5. Transformation of TKL-11 to Facilitate Functional Complementation Using UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-meso-diaminopimelate Ligase (murE)
<ol>
	<li>Transform the mutant with the empty vector (pBAD33) and with the MurE expressing vector (pBAD33::VsmurE) using the protocol outlined in section 3.0.</li>
	<li>Plate and select transformants on LB agar medium supplemented with 50 &#181;g/ml&#8722;1 thymine and 34 &#181;g/ml&#8722;1 chloramphenicol and incubate the plates at 30 &#176;C for 24 hr.</li>
	<li>Test for complementation by streaking or plating colonies from both the control and the experimental transformations onto two LB medium plus 0.2% (w/v) arabinose and 50 &#181;g/ml&#8722;1 thymine.</li>
	<li>Incubate one plate at 30 &#176;C and the other at 42 &#176;C for 24 hr to visually assess the growth phenotype. 
	NOTE: The results should show that the mutant is able to grow at 42 &#176;C only when the murE gene is expressed in the mutant background compared to the vector only control.</li>
</ol>
6. Transformation of DL39 to Facilitate Functional Complementation Using Tyrosine Aminotransferase (tyrB)
<ol>
	<li>Transform DL39 with either pBAD33 or pBAD33::At5g36160, and select transformants on LB agar plates supplemented with 50 &#181;g/ml&#8722;1 tyrosine, 50 &#181;g/ml&#8722;1 phenylalanine, and 34 &#181;g/ml&#8722;1 chloramphenicol using the protocol outlined in section 3.0.</li>
	<li>Replica-plate colonies on minimal (M9) media with 50 &#181;g/ml&#8722;1 phenylalanine and 50 &#181;g/ml&#8722;1 tyrosine, 50 &#181;g/ml&#8722;1 aspartate, 50 &#181;g/ml&#8722;1 leucine, 50 &#181;g/ml&#8722;1valine, 50 &#181;g/ml&#8722;1 isoleucine, 10 &#181;g/ml&#8722;1 uracil 0.5% (w/v) glycerol, 0.2% (w/v) arabinose. Also replica-plate colonies on plates lacking phenylalanine and tyrosine by streaking the same colony of both plates.</li>
	<li>Incubate plates at 30 &#176;C for 48 hr to observe growth phenotype. 
	NOTE: The result should show that the mutant is only able to grow on phenylalanine and tyrosine free media, only when the tyrB gene is expressed in the mutant background when compared to the vector only control.</li>
</ol>
7. Transformation of Hx699 to Facilitate Functional Complementation of the Hypomucoid Phenotype of Novosphingobium sp. Strain Hx699
<ol>
	<li>Transform wild-type strain Novosphingobium sp. (Rr2-17) and the mutant Hx699 with pRK290 and pRK290::rshNsp in 2 separate transformation events using the transformation protocol outlined in section 3.0.</li>
	<li>Plate the transformations on potato dextrose (PD) agar supplemented with 10 &#181;g/ml&#8722;1 tetracycline, and incubate for at least 24 hr or until transformants appear.</li>
	<li>Streak both transformations in an &#34;X&#34; pattern on fresh PD agar plates and incubate at 30 &#176;C for at least 4 days. Observe the phenotypes of the vector only, and experiment by visually examining the growth phenotype of both plates. 
	NOTE: The result should show that the hypo-mucoid phenotype is complemented when rsh is expressed in the mutant background when compared to the vector only control.</li>
</ol>

<ol>
	<li>Gillum, A. M., Tsay, E. Y., Kirsch, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+the+Candida+albicans+gene+for+orotidine-5'-phosphate+decarboxylase+by+complementation+of+S.+cerevisiae+ura3+and+E.+coli+pyrF+mutations.">Isolation of the Candida albicans gene for orotidine-5'-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations.</a> Mol Gen Genet. 198, 179-182 (1984).</li><li>Hudson, A. O., Singh, B. K., Leustek, T., Gilvarg, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+L,L-diaminopimelate+aminotransferase+defines+a+novel+variant+of+the+lysine+biosynthesis+pathway+in+plants.">An L,L-diaminopimelate aminotransferase defines a novel variant of the lysine biosynthesis pathway in plants.</a> Plant Physiol. 140, 292-301 (2006).</li><li>Jander, G., Joshi, V., Last, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aspartate-derived+amino+acid+biosynthesis+in+Arabidopsis+thaliana.">Aspartate-derived amino acid biosynthesis in Arabidopsis thaliana.</a> The Arabidopsis Book. , (2009).</li><li>Prabhu, P., Hudson, A. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+partial+characterization+of+an+L-Tyrosine+aminotransferase+from+Arabidopsis+thaliana.">Identification and partial characterization of an L-Tyrosine aminotransferase from Arabidopsis thaliana.</a> Biochemistry Research International. , 549572 (2010).</li><li>Mansfield, J., Genin, S., Magori, S., Citovsky, V., Sriariyanum, M., Ronald, P., Dow, M., Verdier, V., Beer, S. V., Machado , M. A., Toth, I., Salmond, G., Foster, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Top+10+pathogenic+bacteria+in+molecular+pathology.">Top 10 pathogenic bacteria in molecular pathology.</a> Molecular Plant Pathology. 13, 614-629 (2012).</li><li>McGroty, S. E., Pattaniyil, D. T., Patin, D., Blanot, D., Ravichandran, A. C., Suzuki, H., Dobson, R. C., Savka, M. A., Hudson, A. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+Characterization+of+UDP-N-acetylmuramoyl-L-alanyl-D-glutamate:+meso-2,6-diaminopimelate+ligase+(MurE)+from+Verrucomicrobium+spinosum+DSM+4136T.">Biochemical Characterization of UDP-N-acetylmuramoyl-L-alanyl-D-glutamate: meso-2,6-diaminopimelate ligase (MurE) from Verrucomicrobium spinosum DSM 4136T.</a> PLoS ONE. 8 (6), e66458 (2013).</li><li>Hutton, C. A., Perugini, M. A., Gerrard, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+lysine+biosynthesis:+an+evolving+antibiotic+strategy.">Inhibition of lysine biosynthesis: an evolving antibiotic strategy.</a> Mol Biosyst. 3, 458-465 (2007).</li><li>Potrykus, K., Cashel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=(p)ppGpp:+still+magical.">(p)ppGpp: still magical.</a> Annu Rev Microbiol. 62, 35-51 (2008).</li><li>Dalebroux, Z. D., Svensson, S. L., Gaynor, E. C., Swanson, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ppGpp+Conjures+Bacterial+Virulence.">ppGpp Conjures Bacterial Virulence.</a> Microbiology and Molecular Biology Reviews. 74, 171-199 (2010).</li><li>Cashel, M., Gentry, D. J., Hernandez, V. J., Vinella, D., Neidhardt, F. C., Curtiss, R., Ingraham, J. L., Lin, E. C. C., Low, K. B., Magasanik, B., Reznikoff, W. S., Riley, M., Schaechter, M., Umbarger, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+stringent+response.">The stringent response.</a> Escherichia coli and Salmonella typhimurium: cellular and molecular biology. , 1458-1496 (1996).</li><li>Chatterji, D., Ojha, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Revisiting+the+stringent+response,+ppGpp+and+starvation+signaling.">Revisiting the stringent response, ppGpp and starvation signaling.</a> Curr. Opin. Microbiol. 4, 160-165 (2001).</li><li>Jain, V., Kumar, M., Chatterji, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ppGpp:+stringent+response+and+survival.">ppGpp: stringent response and survival.</a> J. Microbiol. 44, 1-10 (2006).</li><li>Kramer, G. F., Baker, J. C., Ames, B. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Near-UV+stress+in+Salmonella+typhimurium:+4-thiouridine+in+tRNA,+ppGpp,+and+pppGpp+as+components+of+an+adaptive+response.">Near-UV stress in Salmonella typhimurium: 4-thiouridine in tRNA, ppGpp, and pppGpp as components of an adaptive response.</a> J. Bacteriol. 170, 2344-2351 (1988).</li><li>Braeken, K., Moris, M., Daniels, R., Vanderleyden, J., Michiels, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+horizons+for+(p)ppGpp+in+bacterial+and+plant+physiology.">New horizons for (p)ppGpp in bacterial and plant physiology.</a> Trends Microbiol. 14, 45-54 (2006).</li><li>Joseleau-Petit, D., Vinella, D., D'Ari, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+alarms+and+cell+division+in+Escherichia+coli.">Metabolic alarms and cell division in Escherichia coli.</a> J. Bacteriol. 181, 9-14 (1999).</li><li>Mittenhuber, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+genomics+and+evolution+of+genes+encoding+bacterial+(p)+ppGpp+synthetases/hydrolases+(the+Rel,+RelA,+and+SpoT+proteins).">Comparative genomics and evolution of genes encoding bacterial (p) ppGpp synthetases/hydrolases (the Rel, RelA, and SpoT proteins).</a> J. Mol. Microbiol. Biotechnol. 3, 585-600 (2001).</li><li>Gan, H. M., Buckley, L., Szegedi, E., Hudson, A. O., Savka, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+an+rsh+Gene+from+a+Novosphingobium+sp.+Necessary+for+Quorum-Sensing+Signal+Accumulation.">Identification of an rsh Gene from a Novosphingobium sp. Necessary for Quorum-Sensing Signal Accumulation.</a> J. Bacteriol. 191, 2551-2560 (2009).</li><li>Nachar, V. R., Savka, F. C., McGroty, S. E., Donovan, K. A., North, R. A., Dobson, R. C., Buckley, L. J., Hudson, A. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+and+biochemical+analysis+of+the+diaminopimelate+and+lysine+biosynthesis+pathway+in+Verrucomicrobium+spinosum:+Identification+and+partial+characterization+of+L,L-diaminopimelate+aminotransferase+and+UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-meso-diaminopimelate+ligase.">Genomic and biochemical analysis of the diaminopimelate and lysine biosynthesis pathway in Verrucomicrobium spinosum: Identification and partial characterization of L,L-diaminopimelate aminotransferase and UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-meso-diaminopimelate ligase.</a> Front. Microbiol. 3, 183 (2012).</li><li>Hudson, A. O., Gir&#242;n, I., Dobson, R. C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystallization+and+preliminary+X-ray+diffraction+analysis+of+L,L-diaminopimelate+aminotransferase+(DapL)+from+Chlamydomonas+reinhardtii.">Crystallization and preliminary X-ray diffraction analysis of L,L-diaminopimelate aminotransferase (DapL) from Chlamydomonas reinhardtii.</a> Acta Cryst. 67, 140-143 (2011).</li><li>Dobson, R. C. J., Gir &#242;n, I., Hudson, A. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=L,L-Diaminopimelate+Aminotransferase+from+Chlamydomonas+reinhardtii:+A+Target+for+Algaecide+Development.">L,L-Diaminopimelate Aminotransferase from Chlamydomonas reinhardtii: A Target for Algaecide Development.</a> PLoS ONE. 6 (5), e20439 (2011).</li><li>Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tight+regulation,+modulation,+and+high-level+expression+by+vectors+containing+the+arabinose+pBAD+promoter.">Tight regulation, modulation, and high-level expression by vectors containing the arabinose pBAD promoter.</a> J. Bacteriol. 177, 4121-4130 (1995).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning: A laboratory manual. , (2001).</li><li>Lugtenberg, E. J., van Schijndel-van Dam, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temperature-sensitive+mutants+of+Escherichia+coli+K-12+with+low+activity+of+the+diaminopimelic+acid+adding+enzyme.">Temperature-sensitive mutants of Escherichia coli K-12 with low activity of the diaminopimelic acid adding enzyme.</a> J. Bacteriol. 110, 41-46 (1972).</li><li>Mavrides, C., Orr, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multispecific+aspartate+and+aromatic+amino+acid+aminotransferases+in+Escherichia+coli.">Multispecific aspartate and aromatic amino acid aminotransferases in Escherichia coli.</a> J. Biol Chem. 250, 4128-4133 (1975).</li><li>Gelfand, D. H., Steinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+mutants+deficient+in+the+aspartate+and+aromatic+amino+acid+aminotransferases.">Escherichia coli mutants deficient in the aspartate and aromatic amino acid aminotransferases.</a> J. Bacteriol. 130, 429-440 (1977).</li><li>Whitaker, R. J., Gaines, C. G., Jensen, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+multispecific+quintet+of+aromatic+aminotransferases+that+overlap+different+biochemical+pathways+in+Pseudomonas+aeruginosa.">A multispecific quintet of aromatic aminotransferases that overlap different biochemical pathways in Pseudomonas aeruginosa.</a> J. Biol Chem. 257, 13550-13556 (1982).</li><li>Raskin, D. M., Judson, N., Mekalanos, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+the+stringent+response+in+the+essential+function+if+the+conserved+bacterial+G+protein+CgtA+in+Vibrio+cholera.">Regulation of the stringent response in the essential function if the conserved bacterial G protein CgtA in Vibrio cholera.</a> Proc Natl Acad Sci, USA. 104, 4636-4641 (2007).</li><li>Ditta, G., Stanfield, S., Corbin, D., Helinski, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broad+host+range+DNA+cloning+system+for+Gram-negative+bacteria:+construction+of+a+gene+bank+of+Rhizobium+meliloti.">Broad host range DNA cloning system for Gram-negative bacteria: construction of a gene bank of Rhizobium meliloti.</a> Proc Natl Acad Sci, USA. 77, 7347-7351 (1980).</li><li>Watanabe, A., Suzuki, M., Ujiie, S., Gomi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+and+enzymatic+characterization+of+a+novel+&#946;-1,6-glucosidase+from+Aspergillus+oryzae.">Purification and enzymatic characterization of a novel &#946;-1,6-glucosidase from Aspergillus oryzae.</a> J Biosci Bioeng. , (2015).</li><li>Song, J. T., Lu, H., McDowell, J. M., Greenberg, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+key+role+for+ALD1+in+activation+of+local+and+systemic+defenses+in+Arabidopsis.">A key role for ALD1 in activation of local and systemic defenses in Arabidopsis.</a> Plant J. 40, 200-212 (2004).</li><li>Rost, B., Liu, J., Nair, R., Wrzeszczynski, K. P., Ofran, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automatic+prediction+of+protein+function.">Automatic prediction of protein function.</a> Celuular and Molecular Life Sciences. 60, 2637-2650 (2003).</li><li>Norris, S. R., Shen, X., Penna, D. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complementation+of+the+Arabidopsis+pds1+mutation+with+the+gene+encoding+p-Hyrdoxyphenylpyruvate+dioxygenase.">Complementation of the Arabidopsis pds1 mutation with the gene encoding p-Hyrdoxyphenylpyruvate dioxygenase.</a> Plant Physiol. 117, 1317-1323 (1998).</li><li>Mohler, W. A., Blau, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+and+cell+fusion+analyzed+by+lacZ+complementation+in+mammalian+cells.">Gene expression and cell fusion analyzed by lacZ complementation in mammalian cells.</a> Proc Natl Acad Sci, USA. 93, 12423-12427 (1996).</li></ol>

The authors declare that they have no competing financial interests.

Many of the courses that are integral to the Biotechnology and Molecular Bioscience curriculum at the Rochester Institute of Technology have a laboratory component in addition to the lecture portion of the course. The curriculum for the academic year 2014-2015 contains a total of 48 courses, 29 of which contain a laboratory component which represent approximately 60%. One such course is Fundamentals of Plant Biochemistry and Pathology (FPBP), a blended lecture/ laboratory course and Bioseparations: Principles and Practic...

Functional complementation in the context of elucidating the function(s)/role(s) of a gene is defined as the ability of a particular homologous or orthologous gene to restore a particular mutant with an observable phenotype to the wild-type state when the homologous or orthologous gene is introduced in cis or trans into the mutant background. This technique has been widely used to isolate and identify the function(s)/role(s) of many genes. One particular example is the isolation and identification of orotidine-5-phosphate decarboxylase from Candida albicans using the ura3 mutant of S. cerevisiae and the pyrF mutant of E. coli.1 The authors have used this technique to elucidate the function of genes that are involved in the metabolism of amino acids, peptidoglycan and the stringent response in their research programs and have incorporated this technique into their teaching programs in the Biotechnology and Molecular Bioscience (BMB) program at the Rochester Institute of Technology (RIT).
The authors teach Fundamentals of Plant Biochemistry/Pathology (FPBP) (Hudson) and Bioseparations: Principles and Practices (BPP) (Hudson/Savka), two upper division elective laboratory based courses in the BMB Program at the RIT. Since some of the topics that are discussed in the courses are affiliated with their research interests, the authors have incorporated many of the techniques and experimental tools that are used in their respective research programs into these two laboratory-based courses. One such example is functional complementation as a laboratory exercise to reinforce the lecture materials pertaining to amino acid metabolism from plants, peptidoglycan and the stringent response metabolism from bacteria.
Three of the amino acid pathways from plants that are discussed in the FPBB course are that of lysine (lys), tyrosine (tyr) and phenylalanine (phe). The lys pathway is highlighted in the course because of the importance of the amino acid as an essential amino acid for all animals particularly humans since animals lack the genetic machinery to synthesize lys de novo. In addition, it was recently discovered that plants employ a pathway for the synthesis of lys that is significantly different from that of bacteria. This discovery was partially facilitated by functional complementation of the E. coli diaminopimelate (dap) mutants using a gene that encodes the enzyme L,L-diaminopimelate aminotransferase (DapL) from the model plant Arabidopsis thaliana.2 The variant pathways for the synthesis of lys through the intermediate diaminopimelate are shown in Figure 1. In addition, the synthesis of lys facilitates through the aspartate derived family of amino acids which is highly regulated.3 In addition to their importance in protein synthesis, the pathways for tyr and phe are highlighted given their importance in serving as precursor compounds for the anabolism of phenylpropanoid compounds involved the synthesis of plant defense compounds such as: alkaloids, lignins, flavonoids, isoflavonoids, hydroxycinnamic acid among others.4 The tyr and phe pathways are also highlighted to show the difference between the plant and bacterial anabolic pathways. In bacteria, the enzyme tyrosine aminotransferase (TyrB) is involved in the anabolism of both amino acids, whereas in plants, the enzyme is primarily involved in the catabolism of tyr and phe and is not involved in the anabolism of these amino acids. (Figure 2).4
The differences between Gram positive and Gram negative bacteria regarding the structure of peptidoglycan (PG) are highlighted in the FPBP course. The PG of Gram negative bacteria is of interest regarding plant pathology based on to the fact that most plant pathogens are Gram negative. A recent review regarding the top 10 bacterial phyto-pathogens revealed that all are Gram negative. The bacteria were from the genera: Pseudomonas, Ralstonia, Agrobacterium, Xanthomonas, Erwinia, Xylella, Dickeya and Pectobacterium.5 One of the chemical differences when comparing the PG stem of Gram negative and Gram positive bacteria is the difference between the cross-linking amino acids of both types. The initial step for that different cross-linking of PG occurs in the cytoplasmic step of PG anabolism and is facilitated by the enzyme UDP-N-acetylmuramoyl-L-alanyl-D-glutamate-meso-2,6-diaminopimelate ligase (MurE) (Figure 3A). MurE catalyzes the addition of a particular diamine compound at third position of the peptide stem.6 In most Gram negative bacteria, the penultimate lys precursor, meso-diaminopimelate (m-DAP) serves as the cross-linking amino acid and lys serves the same role in the PG of most Gram positive bacteria (Figure 3B).7 This is due to the fact that both m-DAP and lys possess two amine groups and are capable of forming two peptide bonds for peptide stem cross-linking.
In the Bioseparations: Principles and Practices (BPP) course, the differences between open and closed systems for the cultivation of bacteria and how nutrient levels will change significantly in both systems due to environmental changes are discussed. These events are linked to regulatory changes called a &#34;shift down&#34; or &#34;shift up&#34; triggered by starvation or an adequate supply of amino acids or energy. The &#34;shift down&#34; response can occur when a bacterial culture is transferred from a rich and complex medium to a chemically defined medium with a single carbon source. This change in environment leads to the rapid cessation of tRNA and rRNA synthesis. This cessation results in the lack of ribosomes, protein and DNA synthesis even though the biosynthesis of amino acids are upregulated.
Following the &#34;shift down&#34; response, the existing ribosomes are used to produce new enzymes to synthesize the amino acids no longer available in the medium or environment. After a period of time, rRNA synthesis and new ribosomes are assembled and the population of bacterial cells begins to grow although at a reduced rate. The course of events is termed the &#34;stringent response&#34; or &#34;stringent control&#34; and is an example of global cellular regulation and can be thought of as a mechanism for adjusting the cell&#39;s biosynthetic machinery to compensate for the availability of the required substrates and energy needs.8 The stringent response thus enables bacteria to respond rapidly to fluxes of nutrients in the environment and contributes and enhances the ability of bacteria to compete in environments that can change rapidly with regards to nutrient and or substrate availability.8-9 
The stringent response has an integral role in gene expression when the availability of amino acids, carbon, nitrogen, phosphate, and fatty acids are limited.8,10-14 This stringent response is coordinated by two nucleotides, guanosine tetraphosphate (ppGpp) and guanosine pentaphosphate (pppGpp) commonly referred together as the alarmone (p)ppGpp. For example, when amino acids are limited-which can lead to a bottleneck in protein synthesis-the alarmone, guanosine 3,5-(bis) pyrophosphate (ppGpp), derived from anabolism of guanosine 3-diphosphate 5-triphosphate (pppGpp) accumulates in the cell. The change in (p)ppGpp level is involved in expression of genes that regulate the response to overcome the lack of substrates in the environment that are directly involved in cell growth and development. Two of the genes that are involved in this process are called relA and spoT. RelA is a ribosome-associated (p)ppGpp synthetase that is involved in the response to the accumulation of uncharged tRNAs that is the result of amino acid limitation. SpoT functions as a bifunctional (p)ppGpp synthetase and hydrolase. The synthetase activity of SpoT is involved in the response to the lack of carbon and fatty acid starvation.8 The RelA/SpoT homologs are widespread in plants and bacteria and are referred to as Rsh for RelA/SpoT homologs.8,10-12,16 A recent manuscript showed that there is a specific Rsh protein involved in the synthesis of these alarmones from the bacterium Novosphingobium sp Rr 2-17.17
Here we present four biochemical pathways tethered to the functional complementation assays. The complementation assays outlined in this manuscript provides an avenue to explore employing this in vivo assay as a means of identifying and or characterizing enzymes that are predicted to have unknown/putative function(s) or as teaching tools to supplement the teaching of biochemical pathways.

<table><tbody><tr><td>&lt;em&gt;E. coli&lt;/em&gt; mutants</td><td>Hudson/Savka lab or CGSC (http://cgsc.biology.yale.edu/)</td><td></td><td></td></tr><tr><td>Electroporator</td><td>Biorad-USA</td><td>1652100</td><td></td></tr><tr><td>Electroporation Cuvettes</td><td>Biorad-USA</td><td>1652082</td><td></td></tr><tr><td>Temperature controlled incubator</td><td>Generic</td><td></td><td></td></tr><tr><td>Microcentrifuge</td><td>Generic</td><td></td><td></td></tr><tr><td>Luria Agar</td><td>Thermofisher Scientific</td><td>22700025</td><td></td></tr><tr><td>Luria Broth</td><td>Thermofisher Scientific</td><td>12795084</td><td></td></tr><tr><td>M9 Medium</td><td>Sigma-Aldrich</td><td>63011</td><td></td></tr><tr><td>Potato Dextrose Medium</td><td>Fisher Scientfic&amp;nbsp;</td><td>DF0013-15-8</td><td></td></tr><tr><td>Kanamycin</td><td>Sigma-Aldrich</td><td>K1377</td><td></td></tr><tr><td>Diaminopimelate</td><td>Sigma-Aldrich</td><td>92591</td><td></td></tr><tr><td>Thymine</td><td>Sigma-Aldrich</td><td>T0376</td><td></td></tr><tr><td>Chloramphenicol</td><td>Sigma-Aldrich</td><td>C0378</td><td></td></tr><tr><td>Tyrosine</td><td>Sigma-Aldrich</td><td>T3754</td><td></td></tr><tr><td>Phenlylalanine</td><td>Sigma-Aldrich</td><td>P2126</td><td></td></tr><tr><td>Aspartate</td><td>Sigma-Aldrich</td><td>A9256</td><td></td></tr><tr><td>Valine</td><td>Sigma-Aldrich</td><td>V0500</td><td></td></tr><tr><td>Leucine</td><td>Sigma-Aldrich</td><td>L8000</td><td></td></tr><tr><td>Isoleucine</td><td>Sigma-Aldrich</td><td>I2752</td><td></td></tr><tr><td>Uracil</td><td>Sigma-Aldrich</td><td>U0750</td><td></td></tr><tr><td>Gylcerol</td><td>Sigma-Aldrich</td><td>G5516</td><td></td></tr><tr><td>Arabinose</td><td>Sigma-Aldrich</td><td>A3256</td><td></td></tr><tr><td>Tetracyline</td><td>Sigma-Aldrich</td><td>87128</td><td></td></tr><tr><td>Taq DNA polymerase</td><td>Thermofisher Scientific</td><td>10342-020</td><td></td></tr><tr><td>Platinum pfx DNA polymerase</td><td>Thermofisher Scientific</td><td>11708-013</td><td></td></tr><tr><td>T4 DNA ligase</td><td>Thermofisher Scientific</td><td>15224-041</td><td></td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; Dh5-alpha</td><td>Thermofisher Scientific</td><td>18258012</td><td></td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; Top10</td><td>Thermofisher Scientific</td><td>C4040-03</td><td></td></tr><tr><td>pET100D/topo vector</td><td>Thermofisher Scientific</td><td>K100-01</td><td></td></tr><tr><td>pCR2.1 Vector</td><td>Thermofisher Scientific</td><td>K2030-01</td><td></td></tr></tbody></table>

functional complementation analysis (fca): a laboratory exercise designed and implemented to supplement the teaching of biochemical pathways

Functional complementation assay (FCA) is an in vivo assay that is widely used to elucidate the function/role of genes/enzymes. This technique is very common in biochemistry, genetics and many other disciplines. A comprehensive overview of the technique to supplement the teaching of biochemical pathways pertaining to amino acids, peptidoglycan and the bacterial stringent response is reported in this manuscript. Two cDNAs from the model plant organism Arabidopsis thaliana that are involved in the metabolism of lysine (L,L-diaminopimelate aminotransferase (dapL) and tyrosine aminotransferase (tyrB) involved in the metabolism of tyrosine and phenylalanine are highlighted. In addition, the bacterial peptidoglycan anabolic pathway is highlighted through the analysis of the UDP-N-acetylmuramoyl-L-alanyl-D-glutamate-meso-2,6-diaminopimelate ligase (murE) gene from the bacterium Verrucomicrobium spinosum involved in the cross-linking of peptidoglycan. The bacterial stringent response is also reported through the analysis of the rsh (relA/spoT homolog) bifunctional gene responsible for a hyper-mucoid phenotype in the bacterium Novosphingobium sp. Four examples of FCA are presented. The video will focus on three of them, namely lysine, peptidoglycan and the stringent response.

The bacterial strains that are employed in the various functional complementation analyses are listed in Table 2.
Functional complementation analysis: L,L-diaminopimelate aminotransferase (dapL)
The E. coli double mutant AOH1 (&#916;dapD::Kan2, dapE6) harbors a mutation in the dapE gene and a complete deletion of the dapD gen...

Watch this Scientific Journal Video about Functional Complementation Analysis FCA: A Laboratory Exercise Designed and Implemented to Supplement the Teaching of Biochemical Pathways at JoVE.com

Functional Complementation Analysis FCA: A Laboratory Exercise Designed and Implemented to Supplement the Teaching of Biochemical Pathways

The validation of enzymatic activities involved in biochemical pathways can be elucidated using functional complementation analysis (FCA). Described in this manuscript is the FCA assay demonstrating the enzymatic activity of enzymes involved in the metabolism of amino acids, bacterial stringent response and bacterial peptidoglycan biosynthesis.

Functional Complementation Analysis (FCA): A Laboratory Exercise Designed and Implemented to Supplement the Teaching of Biochemical Pathways

Functional complementation assay (FCA) is an in vivo assay that is widely used to elucidate the function/role of genes/enzymes. This technique is very ...

functional-complementation-analysis-fca-laboratory-exercise-designed

Research

JoVE Journal

Biology

17.6K Views.  Rochester Institute of Technology.  De validatie van de enzymatische activiteiten die betrokken zijn bij biochemische pathways kunnen worden toegelicht met behulp van functionele complementatie analyse (FCA). In dit manuscript het FCA assay waaruit de enzymatische activiteit van enzymen betrokken bij het metabolisme van aminozuren, bacteriële stringente respons en bacteriële peptidoglycaan biosynthese. 

Video: Functional Complementation Analysis FCA: A Laboratory Exercise Designed and Implemented to Supplement the Teaching of Biochemical Pathways

Expression, Purification, Crystallization, and Enzyme Assays of Fumarylacetoacetate Hydrolase Domain-Containing Proteins

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this superfamily generally display multi-functionality, involving mainly hydrolase and decarboxylase mechanisms. This article presents a series of consecutive methods for the expression and purification of FAHD proteins, mainly FAHD protein 1 (FAHD1) orthologues among species (human, mouse, nematodes, plants, etc.). Covered methods are protein expression in E. coli, affinity chromatography, ion exchange chromatography, preparative and analytical gel filtration, crystallization, X-ray diffraction, and photometric assays. Concentrated protein of high levels of purity (&#62;98%) may be employed for crystallization or antibody production. Proteins of similar or lower quality may be employed in enzyme assays or used as antigens in detection systems (Western-Blot, ELISA). In the discussion of this work, the identified enzymatic mechanisms of FAHD1 are outlined to describe its hydrolase and decarboxylase bi-functionality in more detail.

Expression and purification of fumarylacetoacetate hydrolase domain-containing proteins is described with examples (expression in E. coli, FPLC). Purified proteins are used for crystallization and antibody production and employed for enzyme assays. Selected photometric assays are presented to display the multi-functionality of FAHD1 as oxaloacetate decarboxylase and acylpyruvate hydrolase.

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this ...

Biochemistry

The Importance of Correct Protein Concentration for Kinetics and Affinity Determination in Structure-function Analysis 

In this study, we explore the interaction between the bovine cysteine protease inhibitor cystatin B and a catalytically inactive form of papain (Fig. 1), a plant cysteine protease, by real-time label-free analysis using Biacore X100. Several cystatin B variants with point mutations in areas of interaction with papain, are produced. For each cystatin B variant we determine its specific binding concentration using calibration-free concentration analysis (CFCA) and compare the values obtained with total protein concentration as determined by A280. After that, the kinetics of each cystatin B variant binding to papain is measured using single-cycle kinetics (SCK). We show that one of the four cystatin B variants we examine is only partially active for binding. This partial activity, revealed by CFCA, translates to a significant difference in the association rate constant (ka) and affinity (KD), compared to the values calculated using total protein concentration. Using CFCA in combination with kinetic analysis in a structure-function study contributes to obtaining reliable results, and helps to make the right interpretation of the interaction mechanism.

The Importance of Correct Protein Concentration for Kinetics and Affinity Determination in Structure-function Analysis

We apply label-free protein interaction analysis using Biacore X100 for structure-function analysis of the binding of several cystatin B mutants to papain through kinetic characterization. Calibration-free concentration analysis (CFCA) measures the concentration of protein with retained binding activity without the need for a standard curve. We show that confirmation of concentrations using CFCA increases the reliability of the kinetic analysis and that kinetic constants can reliably be determined even if the activity of a recombinant protein is reduced.

In this study, we explore the interaction between the bovine cysteine protease inhibitor cystatin B and a catalytically inactive form of papain (Fig. 1), ...

Bioenergetic Profile Experiment using C2C12 Myoblast Cells

The ability to measure cellular metabolism and understand mitochondrial dysfunction, has enabled scientists worldwide to advance their research in understanding the role of mitochondrial function in obesity, diabetes, aging, cancer, cardiovascular function and safety toxicity.
Cellular metabolism is the process of substrate uptake, such as oxygen, glucose, fatty acids, and glutamine, and subsequent energy conversion through a series of enzymatically controlled oxidation and reduction reactions. These intracellular biochemical reactions result in the production of ATP, the release of heat and chemical byproducts, such as lactate and CO2 into the extracellular environment.
Valuable insight into the physiological state of cells, and the alteration of the state of those cells, can be gained through measuring the rate of oxygen consumed by the cells, an indicator of mitochondrial respiration - the Oxygen Consumption Rate - or OCR. Cells also generate ATP through glycolysis, i.e.: the conversion of glucose to lactate, independent of oxygen. In cultured wells, lactate is the primary source of protons. Measuring the lactic acid produced indirectly via protons released into the extracellular medium surrounding the cells, which causes acidification of the medium provides the Extra-Cellular Acidification Rate - or ECAR.
In this experiment, C2C12 myoblast cells are seeded at a given density in Seahorse cell culture plates. The basal oxygen consumption (OCR) and extracellular acidification (ECAR) rates are measured to establish baseline rates. The cells are then metabolically perturbed by three additions of different compounds (in succession) that shift the bioenergetic profile of the cell.
This assay is derived from a classic experiment to assess mitochondria and serves as a framework with which to build more complex experiments aimed at understanding both physiologic and pathophysiologic function of mitochondria and to predict the ability of cells to respond to stress and/or insults.

A description of a method for profiling mitochondrial function in cells is provided. The mitochondrial profile generated provides four parameters of mitochondrial function that can be measured in one experiment: basal respiration rate, ATP-linked respiration, proton leak, and reserve capacity.

The ability to measure cellular metabolism and understand mitochondrial dysfunction, has enabled scientists worldwide to advance their research in ...

Bimolecular Fluorescence Complementation

Defining the subcellular distribution of signaling complexes is imperative to understanding the output from that complex. Conventional methods such as immunoprecipitation do not provide information on the spatial localization of complexes. In contrast, BiFC monitors the interaction and subcellular compartmentalization of protein complexes. In this method, a fluororescent protein is split into amino- and carboxy-terminal non-fluorescent fragments which are then fused to two proteins of interest. Interaction of the proteins results in reconstitution of the fluorophore (Figure 1)1,2. A limitation of BiFC is that once the fragmented fluorophore is reconstituted the complex is irreversible3. This limitation is advantageous in detecting transient or weak interactions, but precludes a kinetic analysis of complex dynamics. An additional caveat is that the reconstituted flourophore requires 30min to mature and fluoresce, again precluding the observation of real time interactions4. BiFC is a specific example of the protein fragment complementation assay (PCA) which employs reporter proteins such as green fluorescent protein variants (BiFC), dihydrofolate reductase, b-lactamase, and luciferase to measure protein:protein interactions5,6. Alternative methods to study protein:protein interactions in cells include fluorescence co-localization and F&ouml;rster resonance energy transfer (FRET)7. For co-localization, two proteins are individually tagged either directly with a fluorophore or by indirect immunofluorescence. However, this approach leads to high background of non-interacting proteins making it difficult to interpret co-localization data. In addition, due to the limits of resolution of confocal microscopy, two proteins may appear co-localized without necessarily interacting. With BiFC, fluorescence is only observed when the two proteins of interest interact. FRET is another excellent method for studying protein:protein interactions, but can be technically challenging. FRET experiments require the donor and acceptor to be of similar brightness and stoichiometry in the cell. In addition, one must account for bleed through of the donor into the acceptor channel and vice versa. Unlike FRET, BiFC has little background fluorescence, little post processing of image data, does not require high overexpression, and can detect weak or transient interactions. Bioluminescence resonance energy transfer (BRET) is a method similar to FRET except the donor is an enzyme (e.g. luciferase) that catalyzes a substrate to become bioluminescent thereby exciting an acceptor. BRET lacks the technical problems of bleed through and high background fluorescence but lacks the ability to provide spatial information due to the lack of substrate localization to specific compartments8. Overall, BiFC is an excellent method for visualizing subcellular localization of protein complexes to gain insight into compartmentalized signaling.

The subcellular localization of proteins is important in determining the spatio-temporal regulation of cell signaling. Here, we describe bimolecular fluorescence complementation (BiFC) as a straightforward method for monitoring the spatial interactions of proteins in the cell.

Defining the subcellular distribution of signaling complexes is imperative to understanding the output from that complex. Conventional methods such as ...

Detection of Protein Interactions in Plant using a Gateway Compatible Bimolecular Fluorescence Complementation (BiFC) System

We have developed a BiFC technique to test the interaction between two proteins in vivo. This is accomplished by splitting a yellow fluorescent protein (YFP) into two non-overlapping fragments. Each fragment is cloned in-frame to a gene of interest. These constructs can then be co-transformed into Nicotiana benthamiana via Agrobacterium mediated transformation, allowing the transit expression of fusion proteins. The reconstitution of YFP signal only occurs when the inquest proteins interact 1-7. To test and validate the protein-protein interactions, BiFC can be used together with yeast two hybrid (Y2H) assay. This may detect indirect interactions which can be overlooked in the Y2H. Gateway technology is a universal platform that enables researchers to shuttle the gene of interest (GOI) into as many expression and functional analysis systems as possible8,9. Both the orientation and reading frame can be maintained without using restriction enzymes or ligation to make expression-ready clones. As a result, one can eliminate all the re-sequencing steps to ensure consistent results throughout the experiments. We have created a series of Gateway compatible BiFC and Y2H vectors which provide researchers with easy-to-use tools to perform both BiFC and Y2H assays10. Here, we demonstrate the ease of using our BiFC system to test protein-protein interactions in N. benthamiana plants.

Detection of Protein Interactions in Plant using a Gateway Compatible Bimolecular Fluorescence Complementation BiFC System

We have developed a technique to test protein-protein interactions in plant. A yellow fluorescent protein (YFP) is split into two non-overlapping fragments. Each fragment is cloned in-frame to a gene of interest via Gateway system, enabling expression of fusion proteins. Reconstitution of YFP signal only occurs when the inquest proteins interact.

We have developed a BiFC technique to test the interaction between two proteins in vivo. This is accomplished by splitting a yellow fluorescent protein ...

Metabolic Pathway Confirmation and Discovery Through 13C-labeling of Proteinogenic Amino Acids

Microbes have complex metabolic pathways that can be investigated using biochemistry and functional genomics methods. One important technique to examine cell central metabolism and discover new enzymes is 13C-assisted metabolism analysis 1. This technique is based on isotopic labeling, whereby microbes are fed with a 13C labeled substrates. By tracing the atom transition paths between metabolites in the biochemical network, we can determine functional pathways and discover new enzymes. 
As a complementary method to transcriptomics and proteomics, approaches for isotopomer-assisted analysis of metabolic pathways contain three major steps 2. First, we grow cells with 13C labeled substrates. In this step, the composition of the medium and the selection of labeled substrates are two key factors. To avoid measurement noises from non-labeled carbon in nutrient supplements, a minimal medium with a sole carbon source is required. Further, the choice of a labeled substrate is based on how effectively it will elucidate the pathway being analyzed. Because novel enzymes often involve different reaction stereochemistry or intermediate products, in general, singly labeled carbon substrates are more informative for detection of novel pathways than uniformly labeled ones for detection of novel pathways3, 4. Second, we analyze amino acid labeling patterns using GC-MS. Amino acids are abundant in protein and thus can be obtained from biomass hydrolysis. Amino acids can be derivatized by N-(tert-butyldimethylsilyl)-N-methyltrifluoroacetamide (TBDMS) before GC separation. TBDMS derivatized amino acids can be fragmented by MS and result in different arrays of fragments. Based on the mass to charge (m/z) ratio of fragmented and unfragmented amino acids, we can deduce the possible labeled patterns of the central metabolites that are precursors of the amino acids. Third, we trace 13C carbon transitions in the proposed pathways and, based on the isotopomer data, confirm whether these pathways are active 2. Measurement of amino acids provides isotopic labeling information about eight crucial precursor metabolites in the central metabolism. These metabolic key nodes can reflect the functions of associated central pathways.
13C-assisted metabolism analysis via proteinogenic amino acids can be widely used for functional characterization of poorly-characterized microbial metabolism1. In this protocol, we will use Cyanothece 51142 as the model strain to demonstrate the use of labeled carbon substrates for discovering new enzymatic functions.

Metabolic Pathway Confirmation and Discovery Through 13C-labeling of Proteinogenic Amino Acids

13C-isotope labeling is a useful technique for determining the cell central metabolism for various types of microorganisms. After cells have been cultured with a specific labeled substrate, GC-MS measurement can reveal functional metabolic pathways based on unique labeling patterns in proteinogenic amino acids.

Microbes have complex metabolic pathways that can be investigated using biochemistry and functional genomics methods. One important technique to examine ...

A Quantitative Fitness Analysis Workflow

Quantitative Fitness Analysis (QFA) is an experimental and computational workflow for comparing fitnesses of microbial cultures grown in parallel1,2,3,4. QFA can be applied to focused observations of single cultures but is most useful for genome-wide genetic interaction or drug screens investigating up to thousands of independent cultures. The central experimental method is the inoculation of independent, dilute liquid microbial cultures onto solid agar plates which are incubated and regularly photographed. Photographs from each time-point are analyzed, producing quantitative cell density estimates, which are used to construct growth curves, allowing quantitative fitness measures to be derived. Culture fitnesses can be compared to quantify and rank genetic interaction strengths or drug sensitivities. The effect on culture fitness of any treatments added into substrate agar (e.g. small molecules, antibiotics or nutrients) or applied to plates externally (e.g. UV irradiation, temperature) can be quantified by QFA.
The QFA workflow produces growth rate estimates analogous to those obtained by spectrophotometric measurement of parallel liquid cultures in 96-well or 200-well plate readers. Importantly, QFA has significantly higher throughput compared with such methods. QFA cultures grow on a solid agar surface and are therefore well aerated during growth without the need for stirring or shaking.
QFA throughput is not as high as that of some Synthetic Genetic Array (SGA) screening methods5,6. However, since QFA cultures are heavily diluted before being inoculated onto agar, QFA can capture more complete growth curves, including exponential and saturation phases3. For example, growth curve observations allow culture doubling times to be estimated directly with high precision, as discussed previously1.
Here we present a specific QFA protocol applied to thousands of S. cerevisiae cultures which are automatically handled by robots during inoculation, incubation and imaging. Any of these automated steps can be replaced by an equivalent, manual procedure, with an associated reduction in throughput, and we also present a lower throughput manual protocol. The same QFA software tools can be applied to images captured in either workflow.
We have extensive experience applying QFA to cultures of the budding yeast S. cerevisiae but we expect that QFA will prove equally useful for examining cultures of the fission yeast S. pombe and bacterial cultures.

Quantitative Fitness Analysis (QFA) is a complementary series of experimental and computational methods for estimating microbial culture fitnesses. QFA estimates the effect of genetic mutations, drugs or other applied treatments on microbe growth. Experiments scaling from focussed analysis of single cultures to thousands of parallel cultures can be designed.

Quantitative Fitness Analysis (QFA) is an experimental and computational workflow for comparing fitnesses of microbial cultures grown in parallel1,2,3,4. ...

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Phenotypes are determined by a complex series of physical (e.g. protein-protein) and functional (e.g. gene-gene or genetic) interactions (GI)1. While physical interactions can indicate which bacterial proteins are associated as complexes, they do not necessarily reveal pathway-level functional relationships1. GI screens, in which the growth of double mutants bearing two deleted or inactivated genes is measured and compared to the corresponding single mutants, can illuminate epistatic dependencies between loci and hence provide a means to query and discover novel functional relationships2. Large-scale GI maps have been reported for eukaryotic organisms like yeast3-7, but GI information remains sparse for prokaryotes8, which hinders the functional annotation of bacterial genomes. To this end, we and others have developed high-throughput quantitative bacterial GI screening methods9, 10.
Here, we present the key steps required to perform quantitative E. coli Synthetic Genetic Array (eSGA) screening procedure on a genome-scale9, using natural bacterial conjugation and homologous recombination to systemically generate and measure the fitness of large numbers of double mutants in a colony array format. Briefly, a robot is used to transfer, through conjugation, chloramphenicol (Cm) - marked mutant alleles from engineered Hfr (High frequency of recombination) 'donor strains' into an ordered array of kanamycin (Kan) - marked F- recipient strains. Typically, we use loss-of-function single mutants bearing non-essential gene deletions (e.g. the 'Keio' collection11) and essential gene hypomorphic mutations (i.e. alleles conferring reduced protein expression, stability, or activity9, 12, 13) to query the functional associations of non-essential and essential genes, respectively. After conjugation and ensuing genetic exchange mediated by homologous recombination, the resulting double mutants are selected on solid medium containing both antibiotics. After outgrowth, the plates are digitally imaged and colony sizes are quantitatively scored using an in-house automated image processing system14. GIs are revealed when the growth rate of a double mutant is either significantly better or worse than expected9. Aggravating (or negative) GIs often result between loss-of-function mutations in pairs of genes from compensatory pathways that impinge on the same essential process2. Here, the loss of a single gene is buffered, such that either single mutant is viable. However, the loss of both pathways is deleterious and results in synthetic lethality or sickness (i.e. slow growth). Conversely, alleviating (or positive) interactions can occur between genes in the same pathway or protein complex2 as the deletion of either gene alone is often sufficient to perturb the normal function of the pathway or complex such that additional perturbations do not reduce activity, and hence growth, further. Overall, systematically identifying and analyzing GI networks can provide unbiased, global maps of the functional relationships between large numbers of genes, from which pathway-level information missed by other approaches can be inferred9.

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Systematic, large-scale synthetic genetic (gene-gene or epistasis) interaction screens can be used to explore genetic redundancy and pathway cross-talk. Here, we describe a high-throughput quantitative synthetic genetic array screening technology, termed eSGA that we developed for elucidating epistatic relationships and exploring genetic interaction networks in Escherichia coli.

Phenotypes  are determined by a complex series of physical (e.g. protein-protein) and  functional (e.g. gene-gene or genetic) interactions (GI)1. While ...

Multi-enzyme Screening Using a High-throughput Genetic Enzyme Screening System

The recent development of a high-throughput single-cell assay technique enables the screening of novel enzymes based on functional activities from a large-scale metagenomic library1. We previously proposed a genetic enzyme screening system (GESS) that uses dimethylphenol regulator activated by phenol or p-nitrophenol. Since a vast amount of natural enzymatic reactions produce these phenolic compounds from phenol deriving substrates, this single genetic screening system can be theoretically applied to screen over 200 different enzymes in the BRENDA database. Despite the general applicability of GESS, applying the screening process requires a specific procedure to reach the maximum flow cytometry signals. Here, we detail the developed screening process, which includes metagenome preprocessing with GESS and the operation of a flow cytometry sorter. Three different phenolic substrates (p-nitrophenyl acetate, p-nitrophenyl-&#946;-D-cellobioside, and phenyl phosphate) with GESS were used to screen and to identify three different enzymes (lipase, cellulase, and alkaline phosphatase), respectively. The selected metagenomic enzyme activities were confirmed only with the flow cytometry but DNA sequencing and diverse in vitro analysis can be used for further gene identification.

This work presents a method of high-throughput screening using a universal genetic enzyme screening system that can be theoretically applied to over 200 enzymes. Here, the single screening system identifies three different enzymes (lipase, cellulase, and alkaline phosphatase) by simply changing the substrate used (p-nitrophenyl acetate, p-nitrophenyl-&#946;-D-cellobioside, and phenyl phosphate).

The recent development of a high-throughput single-cell assay technique enables the screening of novel enzymes based on functional activities from a ...

A Web Tool for Generating High Quality Machine-readable Biological Pathways

PathWhiz is a web server built to facilitate the creation of colorful, interactive, visually pleasing pathway diagrams that are rich in biological information. The pathways generated by this online application are machine-readable and fully compatible with essentially all web-browsers and computer operating systems. It uses a specially developed, web-enabled pathway drawing interface that permits the selection and placement of different combinations of pre-drawn biological or biochemical entities to depict reactions, interactions, transport processes and binding events. This palette of entities consists of chemical compounds, proteins, nucleic acids, cellular membranes, subcellular structures, tissues, and organs. All of the visual elements in it can be interactively adjusted and customized. Furthermore, because this tool is a web server, all pathways and pathway elements are publicly accessible. This kind of pathway &#34;crowd sourcing&#34; means that PathWhiz already contains a large and rapidly growing collection of previously drawn pathways and pathway elements. Here we describe a protocol for the quick and easy creation of new pathways and the alteration of existing pathways. To further facilitate pathway editing and creation, the tool contains replication and propagation functions. The replication function allows existing pathways to be used as templates to create or edit new pathways. The propagation function allows one to take an existing pathway and automatically propagate it across different species. Pathways created with this tool can be &#34;re-styled&#34; into different formats (KEGG-like or text-book like), colored with different backgrounds, exported to BioPAX, SBGN-ML, SBML, or PWML data exchange formats, and downloaded as PNG or SVG images. The pathways can easily be incorporated into online databases, integrated into presentations, posters or publications, or used exclusively for online visualization and exploration. This protocol has been successfully applied to generate over 2,000 pathway diagrams, which are now found in many online databases including HMDB, DrugBank, SMPDB, and ECMDB.

PathWhiz is a comprehensive, online pathway drawing tool for generating biochemical and biological pathways. It uses publicly accessible databases and easily expandable palettes consisting of pre-drawn pathway components. This protocol describes how to easily build new pathways, replicate and edit existing pathways, and propagate previously drawn pathways to different organisms.

Functional Complementation Analysis (FCA): A Laboratory Exercise Designed and Implemented to Supplement the Teaching of Biochemical Pathways

Samenvatting

Meer video's verkennen