We would like to thank G. Fulda (Electron Microscopy Center, Rostock University, Germany) for the technical support in acquiring TEM images of filtered superparamagnetic nanoparticles and in performing their X-ray analysis. The work carried out at the RTC Rostock was supported by the Federal Ministry of Education and Research Germany (FKZ 0312138A, FKZ 316159 and VIP+03VP00241) and the State Mecklenburg-Western Pomerania with EU Structural Funds (ESF/IV-WM-B34-0030/10 and ESF/IV-BM-B35-0010/12) and by the DFG (DA 1296-1), the Damp-Foundation, and the German Heart Foundation (F/01/12). Frank Wiekhorst was supported by the EU FP7 research program "Nanomag" FP7-NMP-2013-LARGE-7.

We have no competing financial interests to disclose.

The production of genetically engineered cells loaded with superparamagnetic nanoparticles for their further magnetically controlled guidance is presented in the current protocol. The successful application of this strategy allows for the resolution of some difficulties of cell therapy, such as low retention and poor engraftment in the injured area2,3,4, by providing a targetable cell product for transplantation. Moreover, the s...

Gene and cell therapy are powerful tools that have the potential to solve current challenges in CVD treatment. Despite the fact that both of these approaches are currently being tested in clinical trials, they are not yet ready for wide clinical application1. Notably, a common approach to tackle the challenges of gene and cell therapy is to develop multifunctional gene delivery vectors suitable for clinical application. The lack of safe and efficient gene delivery systems is the main concern of gene therapy. At the same time, the genetic engineering of cellular products prior to transplantation could overcome the serious challenges of cell therapy, such as low efficiency (e.g., in the cardiac field, only ~ 5% of functional improvement is achieved post-stem cell transplantation1) and poor retention/engraftment at the site of injury (i.e.,cell retention drops below 5 - 10% within minutes to hours post-application, regardless of the administration route2,3,4).
To date, viral vectors greatly exceed non-viral systems in terms of efficiency, which has resulted in their wider application in clinical trials (~ 67%)5. However, viral vehicles carry serious risks, such as immunogenicity (and the subsequent inflammatory response, with severe complications), oncogenicity, and limitations in the size of the carried genetic material6. Due to these safety concerns and the high costs of viral vector production, the use of non-viral systems is preferable in certain cases7,8. It is particularly suitable for disorders that require transient genetic correction, such as the expression of growth factors controlling angiogenesis (e.g., for CVD treatment) or the delivery of vaccines.
In our group, a delivery system was designed by combining branched 25-kDa polyethyleneimine (PEI) and superparamagnetic iron oxide nanoparticles (MNP) bound together by biotin-streptavidin interaction9. This vector is a potential tool for the genetic engineering of cells, allowing for their simultaneous magnetization prior to transplantation. The latter provides a basis for magnetic guidance/retention, which is particularly promising nowadays, as advanced magnetic targeting techniques are being successfully developed10. Moreover, the resulting magnetically responsive cells have the potential to be non-invasively monitored by magnetic resonance imaging (MRI) or magnetic particle imaging11,12.
In the case of the PEI/MNP vector, polyamine ensures nucleic acid condensation and thus protection from degrading factors, vector internalization in cells, and endosomal escape5. The MNPs complement the properties of PEI, not only in terms of magnetic guidance, but also by reducing the known PEI toxicity7,13,14. Previously, PEI/MNP vector properties were adjusted in terms of delivery efficiency (i.e., pDNA and miRNA) and safety by using fibroblasts and human mesenchymal stem cells15,16.
In this manuscript, a detailed protocol on the application of PEI/MNPs for the generation of miRNA-modified cells is described17. For this purpose, HUVECs are used and represent an established model for in vitro angiogenesis. They are challenging to transfect and are susceptible to toxic influence18,19,20. In addition, we provide an algorithm to evaluate such cells in vitro, including their targeting, intercellular communication, and MRI detection.

<table><tbody><tr><td>PEI 25 kDa</td><td>Sigma Aldrich</td><td>408727</td><td></td></tr><tr><td>EZ-Link Sulfo-NHS-LC-Biotin</td><td>Thermo Scientific</td><td>21335</td><td></td></tr><tr><td>PD-10 Desalting Columns</td><td>GE Healthcare</td><td>17085101</td><td>Containing Sephadex G-25 Medium</td></tr><tr><td>Ninhydrin Reagent solution 2%</td><td>Sigma Aldrich</td><td>7285</td><td></td></tr><tr><td>Glycine</td><td>Sigma Aldrich</td><td>410225</td><td></td></tr><tr><td>Pierce Biotin Quantitation Kit</td><td>Thermo Scientific</td><td>28005</td><td></td></tr><tr><td>Microplate reader Model 680</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>Streptavidin MagneSphere Paramagnetic Particles</td><td>Promega</td><td>Z5481</td><td></td></tr><tr><td>Millex-HV PVDF Filter</td><td>Merck</td><td>SLHV013SL</td><td>0.45 &amp;micro;m</td></tr><tr><td>Libra 120 transmission electron microscope</td><td>Zeiss</td><td></td><td>Acceleration Voltage 120&amp;nbsp;kV</td></tr><tr><td>Sapphire X-ray detector</td><td>EDAX-Amatek</td><td></td><td></td></tr><tr><td>Cell culture plastic</td><td>TPP</td><td></td><td></td></tr><tr><td>NHS-Esther Atto 565</td><td>ATTO-TEC GmbH</td><td>AD 565-31</td><td></td></tr><tr><td>NHS-Esther Atto 488&amp;nbsp;</td><td>ATTO-TEC GmbH</td><td>AD 488-31</td><td></td></tr><tr><td>Cy5 miRNA Label IT kit</td><td>Mirus Bio</td><td>MIR 9650</td><td></td></tr><tr><td>Biotin Atto 565</td><td>ATTO-TEC GmbH</td><td>AD 565-71</td><td></td></tr><tr><td>Collagense Type IV Gibco</td><td>Thermo Scientific</td><td>17104019</td><td></td></tr><tr><td>Endothelial growth medium, EGM-2</td><td>Lonza</td><td>CC-3156 &amp;amp; CC-4176</td><td></td></tr><tr><td>Penicillin/Streptomycin</td><td>Thermo Scientific</td><td>15140122</td><td>100 U/mL, 100 &amp;micro;g/mL</td></tr><tr><td>Matrigel</td><td>BD Biosciences</td><td>356234</td><td></td></tr><tr><td>anti-PECAM-1 antibody</td><td>Santa Cruz</td><td>sc-1506</td><td></td></tr><tr><td>MS MACS columns</td><td>Miltenyi Biotec&amp;nbsp;</td><td>130-042-201</td><td></td></tr><tr><td>Near-IR Live/Dead Cell Stain Kit</td><td>Thermo Scientific</td><td>L10119</td><td></td></tr><tr><td>Cy3 Dye-Labeled Pre-miR Negative Control</td><td>Thermo Scientific</td><td>AM17120</td><td>&quot;Cy3-miR&quot; or &quot;Cyanine-miR3&quot; in the manuscript</td></tr><tr><td>Pre-miR miRNA Precursor Molecules - Negative Control&amp;nbsp;</td><td>Thermo Scientific</td><td>AM17110</td><td>&quot;scr-miR&quot; in the manuscript</td></tr><tr><td>Anti-hsa-miR92a-3p synthetic Inhibitor&amp;nbsp;</td><td>Thermo Scientific</td><td>AM10916</td><td></td></tr><tr><td>LSM 780 ELYRA PS.1 system</td><td>Zeiss</td><td></td><td></td></tr><tr><td>Paraformaldehyde</td><td>Sigma Aldrich</td><td>158127</td><td>4% solution in PBS</td></tr><tr><td>DAPI nuclear stain</td><td>Thermo Scientific</td><td>D1306</td><td></td></tr><tr><td>NucleoSpin RNA isolation Kit</td><td>Machery-Nagel</td><td>740955</td><td></td></tr><tr><td>mirVana miRNA Isolation Kit</td><td>Thermo Scientific</td><td>AM1560</td><td></td></tr><tr><td>TaqMan MicroRNA Reverse Transcription Kit</td><td>Thermo Scientific</td><td>4366596</td><td></td></tr><tr><td>StepOnePlus Real-Time PCR System</td><td>Applied Biosystems</td><td></td><td></td></tr><tr><td>High-Capacity cDNA Reverse Transcription Kit</td><td>Thermo Scientific</td><td>4368814</td><td></td></tr><tr><td>hsa-miR-92a TaqMan assay</td><td>Thermo Scientific</td><td>000431</td><td>Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU</td></tr><tr><td>FastGene Taq Ready Mix</td><td>Nippon Genetics</td><td>LS27</td><td></td></tr><tr><td>ITGA5 TaqMan assay</td><td>Thermo Scientific</td><td>Hs01547673_m1</td><td></td></tr><tr><td>RNU6B TaqMan assay</td><td>Thermo Scientific</td><td>001093</td><td></td></tr><tr><td>18S rRNA Endogenous Control</td><td>Thermo Scientific</td><td>4333760F</td><td></td></tr><tr><td>Gelatin</td><td>Sigma Aldrich</td><td>G7041</td><td></td></tr><tr><td>CellTrace Calcein Red-Orange</td><td>Thermo Scientific</td><td>C34851</td><td></td></tr><tr><td>PBS</td><td>Pan Biotech</td><td>P04-53500</td><td></td></tr><tr><td>BSA</td><td>Sigma Aldrich</td><td></td><td></td></tr><tr><td>MACS buffer</td><td>Miltenyi Biotec&amp;nbsp;</td><td>130-091-221</td><td></td></tr><tr><td>Agarose</td><td>Sigma Aldrich</td><td>A9539</td><td></td></tr><tr><td>7.1 Tesla animal MRI system</td><td>Bruker Corporation</td><td>A7906</td><td></td></tr><tr><td>ImageJ software</td><td>National Institutes of Health</td><td></td><td>upgraded with an AngiogenesisAnalyzer (NIH)</td></tr><tr><td>MPS device</td><td>Bruker Biospin</td><td></td><td></td></tr><tr><td>Matlab software</td><td>Mathworks</td><td></td><td></td></tr><tr><td>Ring Neodym Magnet&amp;nbsp;</td><td>magnets4you GmbH</td><td>RM-10x04x05-G</td><td>&amp;oslash; 10 mm; remanescence is ~ 1.3&amp;nbsp;T, coercivity &amp;ge; 955 kA/m</td></tr><tr><td>Click-iT EdU Alexa Fluor 647 Imaging Kit</td><td>Thermo Scientific</td><td>C10340</td><td></td></tr><tr><td>FluorSave Reagent</td><td>Merck</td><td>345789</td><td></td></tr><tr><td>Ultrasonic bath</td><td>Bandelin electronic</td><td>Type: RK 100 SH</td><td></td></tr></tbody></table>

preparation and in vitro characterization of magnetized mir-modified endothelial cells

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene and cell therapies are highly promising alternative approaches for CVD treatment. However, the broad clinical application of gene therapy is greatly limited by the lack of suitable gene delivery systems. The development of appropriate gene delivery vectors can provide a solution to current challenges in cell therapy. In particular, existing drawbacks, such as limited efficiency and low cell retention in the injured organ, could be overcome by appropriate cell engineering (i.e., genetic) prior to transplantation. The presented protocol describes the efficient and safe transient modification of endothelial cells using a polyethyleneimine superparamagnetic magnetic nanoparticle (PEI/MNP)-based delivery vector. Also, the algorithm and methods for cell characterization are defined. The successful intracellular delivery of microRNA (miR) into human umbilical vein endothelial cells (HUVECs) has been achieved without affecting cell viability, functionality, or intercellular communication. Moreover, this approach was proven to cause a strong functional effect in introduced exogenous miR. Importantly, the application of this MNP-based vector ensures cell magnetization, with accompanying possibilities of magnetic targeting and non-invasive MRI tracing. This may provide a basis for magnetically guided, genetically engineered cell therapeutics that can be monitored non-invasively with MRI.

The main purpose of the proposed protocol is to produce magnetically responsive miR-modified cells and to conduct their accurate characterization (Figure 1). As a result, efficiently transfected cells, responsive to magnetic selection and guidance and detectable with MRI, should be obtained.
First, the identities of isolated HUVECs were confirmed by typical staining with the endothelial marker CD31 (PECAM) (<str...

Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

This manuscript describes the efficient, non-viral delivery of miR to endothelial cells by a PEI/MNP vector and their magnetization. Thus, in addition to genetic modification, this approach allows for magnetic cell guidance and MRI detectability. The technique can be used to improve the characteristics of therapeutic cell products.

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene ...

preparation-vitro-characterization-magnetized-mir-modified

Research

JoVE Journal

Medicine

7.6K Views.  University of Rostock.  Dit manuscript beschrijft de efficiënte, niet-virale aflevering van miR aan endotheelcellen door een PEI / MNP vector en de magnetisatie. Dus behalve genetische modificatie, deze benadering voor magnetische cellen leiding en MRI detecteerbaarheid. De techniek kan worden gebruikt om de kenmerken van de therapeutische cel producten te verbeteren. 

Video: Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Generation of an Immortalized Murine Brain Microvascular Endothelial Cell Line as an In Vitro Blood Brain Barrier Model

Epithelial and endothelial cells (EC) are building paracellular barriers which protect the tissue from the external and internal environment. The blood-brain barrier (BBB) consisting of EC, astrocyte end-feet, pericytes and the basal membrane is responsible for the protection and homeostasis of the brain parenchyma. In vitro BBB models are common tools to study the structure and function of the BBB at the cellular level. A considerable number of different in vitro BBB models have been established for research in different laboratories to date. Usually, the cells are obtained from bovine, porcine, rat or mouse brain tissue (discussed in detail in the review by Wilhelm et al. 1). Human tissue samples are available only in a restricted number of laboratories or companies 2,3. While primary cell preparations are time consuming and the EC cultures can differ from batch to batch, the establishment of immortalized EC lines is the focus of scientific interest.
Here, we present a method for establishing an immortalized brain microvascular EC line from neonatal mouse brain. We describe the procedure step-by-step listing the reagents and solutions used. The method established by our lab allows the isolation of a homogenous immortalized endothelial cell line within four to five weeks. The brain microvascular endothelial cell lines termed cEND 4 (from cerebral cortex) and cerebEND 5 (from cerebellar cortex), were isolated according to this procedure in the F&ouml;rster laboratory and have been effectively used for explanation of different physiological and pathological processes at the BBB. Using cEND and cerebEND we have demonstrated that these cells respond to glucocorticoid- 4,6-9 and estrogen-treatment 10 as well as to pro-infammatory mediators, such as TNFalpha 5,8. Moreover, we have studied the pathology of multiple sclerosis 11 and hypoxia 12,13 on the EC-level. The cEND and cerebEND lines can be considered as a good tool for studying the structure and function of the BBB, cellular responses of ECs to different stimuli or interaction of the EC with lymphocytes or cancer cells.

Generation of an Immortalized Murine Brain Microvascular Endothelial Cell Line as an In Vitro Blood Brain Barrier Model

This method describes how to isolate and immortalize microvascular endothelial cells from mouse brain. We describe a step-by-step protocol starting from the homogenization of brain tissue, digestion steps, seeding and immortalization of the cells. Usually, it takes about five weeks to obtain a homogenous, immortalized microvascular endothelial cell line.

Epithelial and endothelial cells (EC) are building paracellular barriers which protect the tissue from the external and internal environment. The ...

Neuroscience

Ferromagnetic Bare Metal Stent for Endothelial Cell Capture and Retention

Rapid endothelialization of cardiovascular stents is needed to reduce stent thrombosis and to avoid anti-platelet therapy which can reduce bleeding risk. The feasibility of using magnetic forces to capture and retain endothelial outgrowth cells (EOC) labeled with super paramagnetic iron oxide nanoparticles (SPION) has been shown previously. But this technique requires the development of a mechanically functional stent from a magnetic and biocompatible material followed by in-vitro and in-vivo testing to prove rapid endothelialization. We developed a weakly ferromagnetic stent from 2205 duplex stainless steel using computer aided design (CAD) and its design was further refined using finite element analysis (FEA). The final design of the stent exhibited a principal strain below the fracture limit of the material during mechanical crimping and expansion. One hundred stents were manufactured and a subset of them was used for mechanical testing, retained magnetic field measurements, in-vitro cell capture studies, and in-vivo implantation studies. Ten stents were tested for deployment to verify if they sustained crimping and expansion cycle without failure. Another 10 stents were magnetized using a strong neodymium magnet and their retained magnetic field was measured. The stents showed that the retained magnetism was sufficient to capture SPION-labeled EOC in our in-vitro studies. SPION-labeled EOC capture and retention was verified in large animal models by implanting 1 magnetized stent and 1 non-magnetized control stent in each of 4 pigs. The stented arteries were explanted after 7 days and analyzed histologically. The weakly magnetic stents developed in this study were capable of attracting and retaining SPION-labeled endothelial cells which can promote rapid healing.

Our goals were to design, manufacture and test ferromagnetic stents for endothelial cell capture. Ten stents were tested for fracture and 10 more stents were tested for retained magnetism. Finally, 10 stents were tested in-vitro and 8 more stents were implanted in 4 pigs to show cell capture and retention.

Rapid endothelialization of cardiovascular stents is needed to reduce stent thrombosis and to avoid anti-platelet therapy which can reduce bleeding risk. ...

Bioengineering

Synthesis of Cationized Magnetoferritin for Ultra-fast Magnetization of Cells

Many important biomedical applications, such as cell imaging and remote manipulation, can be achieved by labeling cells with superparamagnetic iron oxide nanoparticles (SPIONs). Achieving sufficient cellular uptake of SPIONs is a challenge that has traditionally been met by exposing cells to elevated concentrations of SPIONs or by prolonging exposure times (up to 72 hr). However, these strategies are likely to mediate toxicity. Here, we present the synthesis of the protein-based SPION magnetoferritin as well as a facile surface functionalization protocol that enables rapid cell magnetization using low exposure concentrations. The SPION core of magnetoferritin consists of cobalt-doped iron oxide with an average particle diameter of 8.2 nm mineralized inside the cavity of horse spleen apo-ferritin. Chemical cationization of magnetoferritin produced a novel, highly membrane-active SPION that magnetized human mesenchymal stem cells (hMSCs) using incubation times as short as one minute and iron concentrations as lows as 0.2 mM.

A protocol for the synthesis and cationization of cobalt-doped magnetoferritin is presented, as well as a method to rapidly magnetize stem cells with cationized magnetoferritin.

Many important biomedical applications, such as cell imaging and remote manipulation, can be achieved by labeling cells with superparamagnetic iron oxide ...

A Patient-Derived Xenograft Model for Venous Malformation

Venous malformation (VM) is a vascular anomaly that arises from impaired development of the venous network resulting in dilated and often dysfunctional veins. The purpose of this article is to carefully describe the establishment of a murine xenograft model that mimics human VM and is able to reflect patient heterogeneity. Hyper-activating non-inherited (somatic) TEK (TIE2) and PIK3CA mutations in endothelial cells (EC) have been identified as the main drivers of pathological vessel enlargement in VM. The following protocol describes the isolation, purification and expansion of patient-derived EC expressing mutant TIE2 and/or PIK3CA. These EC are injected subcutaneously into the back of immunodeficient athymic mice to generate ectatic vascular channels. Lesions generated with TIE2 or PIK3CA-mutant EC are visibly vascularized within 7&#8210;9 days of injection and recapitulate histopathological features of VM patient tissue. This VM xenograft model provides a reliable platform to investigate the cellular and molecular mechanisms driving VM formation and expansion. In addition, this model will be instrumental for translational studies testing the efficacy of novel drug candidates in preventing the abnormal vessel enlargement seen in human VM.

We present a detailed protocol to generate a murine xenograft model of venous malformation. This model is based on the subcutaneous injection of patient-derived endothelial cells containing hyper-activating TIE2 and/or PIK3CA gene mutations. Xenograft lesions closely recapitulate the histopathological features of VM patient tissue.

Venous malformation (VM) is a vascular anomaly that arises from impaired development of the venous network resulting in dilated and often dysfunctional ...

Developmental Biology

Isolation of Primary Murine Brain Microvascular Endothelial Cells

The blood-brain-barrier is ultrastructurally assembled by a monolayer of brain microvascular endothelial cells (BMEC) interconnected by a junctional complex of tight and adherens junctions. Together with other cell-types such as astrocytes or pericytes, they form the neurovascular unit (NVU), which specifically regulates the interchange of fluids, molecules and cells between the peripheral blood and the CNS. Through this complex and dynamic system BMECs are involved in various processes maintaining the homeostasis of the CNS. A dysfunction of the BBB is observed as an essential step in the pathogenesis of many severe CNS diseases. However, specific and targeted therapies are very limited, as the underlying mechanisms are still far from being understood. 
Animal and in vitro models have been extensively used to gain in-depth understanding of complex physiological and pathophysiological processes. By reduction and simplification it is possible to focus the investigation on the subject of interest and to exclude a variety of confounding factors. However, comparability and transferability are also reduced in model systems, which have to be taken into account for evaluation. The most common animal models are based on mice, among other reasons, mainly due to the constantly increasing possibilities of methodology. In vitro studies of isolated murine BMECs might enable an in-depth analysis of their properties and of the blood-brain-barrier under physiological and pathophysiological conditions. Further insights into the complex mechanisms at the BBB potentially provide the basis for new therapeutic strategies.
This protocol describes a method to isolate primary murine microvascular endothelial cells by a sequence of physical and chemical purification steps. Special considerations for purity and cultivation of MBMECs as well as quality control, potential applications and limitations are discussed.

Brain microvascular endothelial cells (BMEC) are interconnected by specific junctional proteins forming a highly regulated barrier separating blood and the central nervous system (CNS), the so-called blood-brain-barrier (BBB). The isolation of primary murine brain microvascular endothelial cells, as discussed in this protocol, enables detailed in vitro studies of the BBB.

The blood-brain-barrier is ultrastructurally assembled by a monolayer of brain microvascular endothelial cells (BMEC) interconnected by a junctional ...

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal model experimental autoimmune encephalomyelitis (EAE). This process is characterized by the transmigration of activated T cells across brain endothelial cells (ECs), the main constituents of the BBB. However, the consequences on brain EC function upon interaction with such T cells are largely unknown. Here we describe an assay that allows for the evaluation of primary mouse brain microvascular EC (MBMEC) function and barrier integrity during the interaction with T cells over time. The assay makes use of impedance cell spectroscopy, a powerful tool for studying EC monolayer integrity and permeability, by measuring changes in transendothelial electrical resistance (TEER) and cell layer capacitance (Ccl). In direct contact with ECs, stimulated but not na&#239;ve T cells are capable of inducing EC monolayer dysfunction, as visualized by a decrease in TEER and an increase in Ccl. The assay records changes in EC monolayer integrity in a continuous and automated fashion. It is sensitive enough to distinguish between different strengths of stimuli and levels of T cell activation and it enables the investigation of the consequences of a targeted modulation of T cell-EC interaction using a wide range of substances such as antibodies, pharmacological reagents and cytokines. The technique can also be used as a quality control for EC integrity in in vitro T-cell transmigration assays. These applications make it a versatile tool for studying BBB properties under physiological and pathophysiological conditions.

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Here, we describe an in vitro murine model of the blood-brain barrier that makes use of impedance cell spectroscopy, with a focus on the consequences on endothelial cell integrity and permeability upon interaction with activated T cells.

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal ...

Immunology and Infection

Isolation of Primary Murine Skeletal Muscle Microvascular Endothelial Cells

The endothelial cells of skeletal muscle capillaries (muscle microvascular endothelial cells, MMEC) build up the barrier between blood stream and skeletal muscles regulating the exchange of fluids and nutrients as well as the immune response against infectious agents by controlling immune cell migration. For these functions, MMEC form a functional &#34;myovascular unit&#34; (MVU), with further cell types, such as fibroblasts, pericytes and skeletal muscle cells. Consequently, a dysfunction of MMEC and therefore the MVU contributes to a vast variety of myopathies. However, regulatory mechanisms of MMEC in health and disease remain insufficiently understood and their elucidation precedes more specific treatments for myopathies. The isolation and in-depth investigation of primary MMEC functions in the context of the MVU might facilitate a better understanding of these processes.
This article provides a protocol to isolate primary murine MMEC of the skeletal muscle by mechanical and enzymatic dissociation including purification and culture maintenance steps.

Microvascular endothelial cells of skeletal muscles (MMEC) shape the inner wall of muscle capillaries and regulate both, exchange of fluids/molecules and migration of (immune) cells between muscle tissue and blood. Isolation of primary murine MMEC, as described here, enables comprehensive in vitro investigations of the &#34;myovascular unit&#34;.

The endothelial cells of skeletal muscle capillaries (muscle microvascular endothelial cells, MMEC) build up the barrier between blood stream and skeletal ...

Isolation of Embryonic Ventricular Endothelial Cells

Cell culture has greatly enhanced our ability to assess individual populations of cells under myriad culture conditions. While immortalized cell lines offer significant advantages for their ease of use, these cell lines are unavailable for all potential cell types. By isolating primary cells from a specific region of interest, particularly from a transgenic mouse, more nuanced studies can be performed. The basic technique involves dissecting the organ or partial organ of interest (e.g. the heart or a specific region of the heart) and dissociating the organ to single cells. These cells are then incubated with magnetic beads conjugated to an antibody that recognizes the cell type of interest. The cells of interest can then be isolated with the use of a magnet, with a short trypsin incubation dissociating the cells from the beads. These isolated cells can then be cultured and analyzed as desired. This technique was originally designed for adult mouse organs but can be easily scaled down for use with embryonic organs, as demonstrated herein. Because our interest is in the developing coronary vasculature, we wanted to study this population of cells during specific embryonic stages. Thus, the original protocol had to be modified to be compatible with the small size of the embryonic ventricles and the low potential yield of endothelial cells at these developmental stages. Utilizing this scaled-down approach, we have assessed coronary plexus remodeling in transgenic embryonic ventricular endothelial cells.

Primary cell culture is a useful technique for analyzing specific populations of cells, particularly from transgenic mouse embryos at specific developmental stages. Herein, embryonic ventricles are dissected and dissociated, and antibody-conjugated beads recognize and separate out the endothelial cells for further analysis.

Cell culture has greatly enhanced our ability to assess individual populations of cells under myriad culture conditions. While immortalized cell lines ...

Biology

Differentiation of Human Induced Pluripotent Stem Cells to Brain Microvascular Endothelial Cell-Like Cells with a Mature Immune Phenotype

Blood-brain barrier (BBB) dysfunction is a pathological hallmark of many neurodegenerative and neuroinflammatory diseases affecting the central nervous system (CNS). Due to the limited access to disease-related BBB samples, it is still not well understood whether BBB malfunction is causative for disease development or rather a consequence of the neuroinflammatory or neurodegenerative process. Human induced pluripotent stem cells (hiPSCs) therefore provide a novel opportunity to establish in vitro BBB models from healthy donors and patients, and thus to study disease-specific BBB characteristics from individual patients. Several differentiation protocols have been established for deriving brain microvascular endothelial cell (BMEC)-like cells from hiPSCs. Consideration of the specific research question is mandatory for the correct choice of the respective BMEC-differentiation protocol. Here, we describe the extended endothelial cell culture method (EECM), which is optimized to differentiate hiPSCs into BMEC-like cells with a mature immune phenotype, allowing the study of immune cell-BBB interactions. In this protocol, hiPSCs are first differentiated into endothelial progenitor cells (EPCs) by activating Wnt/&#946;-catenin signaling. The resulting culture, which contains smooth muscle-like cells (SMLCs), is then sequentially passaged to increase the purity of endothelial cells (ECs) and to induce BBB-specific properties. Co-culture of EECM-BMECs with these SMLCs or conditioned medium from SMLCs allows for the reproducible, constitutive, and cytokine-regulated expression of EC adhesion molecules. Importantly, EECM-BMEC-like cells establish barrier properties comparable to primary human BMECs, and due to their expression of all EC adhesion molecules, EECM-BMEC-like cells are different from other hiPSC-derived in vitro BBB models. EECM-BMEC-like cells are thus the model of choice for investigating the potential impact of disease processes at the level of the BBB, with an impact on immune cell interaction in a personalized fashion.

Here, we describe a protocol, the extended endothelial cell culture method (EECM), that allows differentiation of pluripotent stem cells to brain microvascular endothelial cell (BMEC)-like cells. These cells show endothelial cell adhesion molecule expression and are thus a human blood-brain barrier model suitable to study immune cell interactions in vitro.

Blood-brain barrier (BBB) dysfunction is a pathological hallmark of many neurodegenerative and neuroinflammatory diseases affecting the central nervous ...

Optimized Magnetic High-Yield Production of Endosome-Derived Nanovesicles

A Magnetic Separation-Assisted High-Speed Homogenization Method for Large-Scale Production of Endosome-Derived Vesicles

Extracellular vesicles (EVs) have attracted significant attention in physiological and pathological research, disease diagnosis, and treatment; however, their clinical translation has been limited by the lack of scale-up manufacturing approaches. Therefore, this protocol provides a magnetic separation-assisted high-speed homogenization method for the large-scale production of endosome-derived nanovesicles as a new type of exosome mimics (EMs) derived from the endosomes, which have about 100-time higher yield than conventional ultracentrifugation method. In this method, magnetic nanoparticles (MNPs) were internalized by parental cells via endocytosis and were subsequently accumulated within their endosomes. Then, MNPs-loaded endosomes were collected and purified by hypotonic treatment and magnetic separation. A high-speed homogenizer was utilized to break MNP-loaded endosomes into monodisperse nanovesicles. The resulting endosome-derived vesicles feature the same biological origin and structure, characterized by nanoparticle tracking analysis, transmission electron microscope, and western blotting. Their morphology and protein composition are similar to native EVs, indicating that EMs may potentially serve as a low-cost and high-yield surrogate of native EVs for clinical translations.

Author Spotlight: Development of a Large-Scale, Reproducible Production Method for Exosome Mimetics Using Magnetic Nanoparticles 

Here, we describe a magnetic separation-assisted high-speed homogenization method for large-scale production of endosome-derived nanovesicles as a new type of exosome mimics (EMs) that share the same biological origin and similar structure, morphology, and protein composition of native extracellular vesicles (EVs).

Extracellular vesicles (EVs) have attracted significant attention in physiological and pathological research, disease diagnosis, and treatment; however, ...

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Samenvatting

Meer video's verkennen