Wir möchten, dass beim Erwerb von TEM-Aufnahmen von gefilterten superparamagnetische Nanopartikel und bei der Durchführung ihrer Röntgenanalyse G. Fulda (Elektronenmikroskopie Zentrum, Universität Rostock, Deutschland) für die technische Unterstützung. Die Arbeit an der RTC Rostock durchgeführt wurde vom Bundesministerium für Bildung und Forschung Deutschland (FKZ 0312138A, FKZ 316159 und VIP + 03VP00241) und dem Staat Mecklenburg-Vorpommern mit EU-Strukturfonds (ESF / IV-WM-B34- unterstützt 0030/10 und ESF / IV-BM-B35-0010 / 12) und von der DFG (DA 1296-1), die Damp-Foundation und der deutschen Herz Foundation (F / 01/12). Frank Wiekhorst wurde von dem EU FP7 Forschungsprogramm &quot;Nanomag&quot; FP7-NMP-2013-LARGE-7 unterstützt.

Wir haben keine konkurrierenden finanziellen Interessen offen zu legen.

Die Herstellung von gentechnisch veränderten Zellen, beladen mit superparamagnetische Nanopartikel für ihre weiteren magnetisch gesteuerte Führung wird in dem aktuellen Protokoll dargestellt. Die erfolgreiche Anwendung dieser Strategie ermöglicht die Auflösung einiger Schwierigkeiten der Zelltherapie, wie geringe Retention und schlechte Einpflanzung in dem verletzten Bereich 2, 3, 4, durch ein anzielbare Zellprodukt zur Tr...

Gen- und Zelltherapie sind leistungsfähige Werkzeuge, die das Potenzial haben, um die aktuellen Herausforderungen in CVD-Behandlung zu lösen. Trotz der Tatsache , dass diese beiden Ansätze derzeit in klinischen Studien getestet werden, sind sie noch nicht bereit für eine breite klinische Anwendung 1. Bemerkenswert ist, ein gemeinsames Konzept für die Herausforderungen der Gen- und Zelltherapie zu bekämpfen ist multifunktional Genabgabevektoren geeignet für die klinische Anwendung zu entwickeln. Der Mangel an sicheren und effizienten Genabgabesysteme ist das Hauptanliegen der Gentherapie. Zur gleichen Zeit, die gentechnische Veränderung von Zellprodukten vor der Transplantation konnte die schweren Herausforderungen der Zelltherapie, wie geringe Effizienz (zB im Herzfeld, nur ca. 5% der funktionellen Verbesserung erreichte nach Stammzelltransplantation überwunden 1 ) und schlechte Retention / Verpflanzung an der Stelle der Verletzung (dh fällt Zellbindung unter von 5 bis 10% innerhalb von Minuten bis Stunden post-Anwendung, unabhängig vom Applikationsweg 2, 3, 4). Bisher überschreiten virale Vektoren stark nicht-virale Systeme in Bezug auf Effizienz, die in ihrer breiteren Anwendung in klinischen Studien (~ 67%) 5 geführt hat. Allerdings trägt virales Vehikel ernsthafte Risiken, wie Immunogenität (und die nachfolgende Entzündungsreaktion mit schweren Komplikationen), Onkogenizität und Einschränkungen in der Größe des durch genetische Material 6. Aufgrund dieser Sicherheitsbedenken und die hohen Kosten der Produktion viraler Vektor, ist die Verwendung von nicht-viralen Systemen bevorzugt in bestimmten Fällen 7, 8. Es ist besonders geeignet für Erkrankungen , die transient genetische Korrektur, wie beispielsweise die Expression von Wachstumsfaktoren erfordern Steuerung der Angiogenese (zB für die CVD - Behandlung) oder die delivery von Impfstoffen. In unserer Gruppe wurde ein Abgabesystem durch die Kombination von verzweigtem 25 kDa-Polyethylenimin (PEI) und superparamagnetische Eisenoxid - Nanopartikel (MNP) miteinander verbunden ist durch Biotin-Streptavidin - Wechselwirkung 9 ausgelegt. Dieser Vektor ist ein mögliches Instrument für die gentechnische Veränderung von Zellen, so dass für ihre gleichzeitige Magnetisierung vor der Transplantation. Letzteres stellt eine Basis für die magnetische Orientierung / Retention, die heutzutage besonders vielversprechend, da die erweiterte Targeting Techniken erfolgreich 10 entwickelt. Zudem 12 die resultierenden magnetisch ansprechenden Zellen , die das Potential haben , nicht-invasiv durch Magnetresonanztomographie (MRI) oder Magnetic Particle Imaging 11, überwacht zu werden. Im Fall des PEI / MNP-Vektor, stellt sicher, Polyamin-Kondensations Nukleinsäure- und somit Schutz vor abbauenden Faktor<html> s, Vektor - Internalisierung in Zellen und endosomalen 5 entkommen. Die MNP ergänzen die Eigenschaften von PEI, nicht nur in Bezug auf die magnetische Orientierung, sondern auch durch die bekannte PEI Toxizität reduzieren 7, 13, 14. Zuvor in Bezug auf die Abgabeeffizienz (dh pDNA und miRNA) und Sicherheits PEI / MNP Vektor Eigenschaften wurden eingestellt durch Fibroblasten und humanen mesenchymalen Stammzellen , 15, 16 verwendet wird . In diesem Manuskript wird ein ausführliches Protokoll zur Anwendung von PEI / MNP zur Erzeugung von miRNA-modifizierten Zellen wird 17 beschrieben. Zu diesem Zweck werden HUVECs verwendet und ein etabliertes Modell für die in - vitro - Angiogenese darstellen. Sie sind schwierig zu transfizieren und sind anfällig für toxische Einflüsse 18, 19,ass = &quot;xref&quot;&gt; 20. Zusätzlich stellen wir einen Algorithmus solche Zellen in vitro zu bewerten, einschließlich ihrer Ausrichtung, die interzelluläre Kommunikation, und MRI - Erkennung.

<table border="0" cellpadding="0" cellspacing="0" width="653">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PEI 25 kDa</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">408727</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">EZ-Link Sulfo-NHS-LC-Biotin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">21335</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">PD-10 Desalting Columns</td>
			<td style="width:159px;">GE Healthcare</td>
			<td style="width:119px;">17085101</td>
			<td style="width:179px;">Containing Sephadex G-25 Medium</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Ninhydrin Reagent solution 2%</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">7285</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Glycine</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">410225</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Pierce Biotin Quantitation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">28005</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">&#160;Microplate reader Model 680</td>
			<td style="width:159px;">Bio-Rad</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Streptavidin MagneSphere Paramagnetic Particles</td>
			<td style="width:159px;">Promega</td>
			<td style="width:119px;">Z5481</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Millex-HV PVDF Filter</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">SLHV013SL</td>
			<td style="width:179px;">0.45&#181;m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Libra 120 transmission electron microscope&#160;</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">Acceleration Voltage 120KV</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Sapphire X-ray detector</td>
			<td style="width:159px;">EDAX-Amatek</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cell culture plastic</td>
			<td style="width:159px;">TPP</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 488&#160;</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 488-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cy5 miRNA Label IT kit</td>
			<td style="width:159px;">Mirus Bio</td>
			<td style="width:119px;">MIR 9650</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Biotin Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-71</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Collagense Type IV Gibco</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">17104019</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Endothelial growth medium, EGM-2</td>
			<td style="width:159px;">Lonza</td>
			<td style="width:119px;">CC-3156 &#38; CC-4176</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Penicillin/Streptomycin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">15140122</td>
			<td style="width:179px;">100 U/ml, 100&#181;g/ml</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matrigel</td>
			<td style="width:159px;">BD Biosciences</td>
			<td style="width:119px;">356234</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">anti-PECAM-1 antibody</td>
			<td style="width:159px;">Santa Cruz</td>
			<td style="width:119px;">sc-1506</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MS MACS columns</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-042-201</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Near-IR Live/Dead Cell Stain Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">L10119</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Cy3 Dye-Labeled Pre-miR Negative Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17120</td>
			<td style="width:179px;">&#34;Cy3-miR&#34; or &#34;Cyanine-miR3&#34; in the manuscript</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Pre-miR miRNA Precursor Molecules - Negative Control&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17110</td>
			<td style="width:179px;">&#34;scr-miR&#34; in the manuscript</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Anti-hsa-miR92a-3p synthetic Inhibitor&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM10916</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">LSM 780 ELYRA PS.1 system</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Paraformaldehyde</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">158127</td>
			<td style="width:179px;">4% solution in PBS</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">DAPI nuclear stain</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">D1306</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NucleoSpin RNA isolation Kit</td>
			<td style="width:159px;">Machery-Nagel</td>
			<td style="width:119px;">740955</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">mirVana miRNA Isolation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM1560</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">TaqMan MicroRNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4366596</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">StepOnePlus Real-Time PCR System</td>
			<td style="width:159px;">Applied Biosystems</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">High-Capacity cDNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4368814</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">hsa-miR-92a TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">000431</td>
			<td style="width:179px;">Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastGene Taq Ready Mix</td>
			<td style="width:159px;">Nippon Genetics</td>
			<td style="width:119px;">LS27</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">ITGA5 TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">Hs01547673_m1</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">RNU6B TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">001093</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">18S rRNA Endogenous Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4333760F</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Gelatin</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">G7041</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">CellTrace Calcein Red-Orange</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C34851</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PBS</td>
			<td style="width:159px;">Pan Biotech</td>
			<td style="width:119px;">P04-53500</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">BSA</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MACS buffer</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-091-221</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Agarose</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">A9539</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">7.1 Tesla animal MRI system</td>
			<td style="width:159px;">Bruker Corporation</td>
			<td style="width:119px;">A7906</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">ImageJ software</td>
			<td style="width:159px;">National Institutes of Health</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">upgraded with an AngiogenesisAnalyzer (NIH)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MPS device</td>
			<td style="width:159px;">Bruker Biospin</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matlab software</td>
			<td style="width:159px;">Mathworks</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Ring Neodym Magnet&#160;</td>
			<td style="width:159px;">magnets4you GmbH</td>
			<td style="width:119px;">RM-10x04x05-G</td>
			<td style="width:179px;">&#248; 10 mm; remanescence is ~1.3T, coercivity &#8805; 955 kA/m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Click-iT EdU Alexa Fluor 647 Imaging Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C10340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">FluorSave Reagent</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">345789</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Ultrasonic bath</td>
			<td style="width:159px;">Bandelin electronic</td>
			<td style="width:119px;">Type: RK 100 SH</td>
			<td></td>
		</tr>
	</tbody>
</table>

preparation and in vitro characterization of magnetized mir-modified endothelial cells

Bis heute sind die verfügbaren chirurgischen und pharmakologischen Behandlungen für Herz-Kreislauf-Erkrankungen (CVD) sind begrenzt und oft palliativ. Zur gleichen Zeit, Gen- und Zelltherapien sind vielversprechende alternative Ansätze für eine CVD-Behandlung. Allerdings ist die breite klinische Anwendung der Gentherapie durch den Mangel an geeigneten Genabgabesysteme stark eingeschränkt. Die Entwicklung geeigneter Genübertragungsvektoren können, eine Lösung für die aktuellen Herausforderungen in der Zelltherapie bereitzustellen. Insbesondere bestehende Nachteile, wie begrenzte Effizienz und niedrige Zelleinlagerungen im Organe verletzt, konnte durch entsprechendes Zell - Engineering (dh genetische) vor der Transplantation überwunden werden. Das dargestellte Protokoll beschreibt die effiziente und sichere vorübergehende Modifikation von Endothelzellen ein Polyethylenimin superparamagnetischen Nanopartikel (PEI / MNP) -basierten Auslieferungsvektor verwendet wird. Außerdem werden der Algorithmus und Methoden zur Zellcharakterisierung definiert. Die erfolgreiche intracelluLAR Lieferung von microRNA (du) in menschliche Nabelvenen-Endothelzellen (HUVECs) hat, ohne die Lebensfähigkeit der Zellen zu beeinflussen, Funktionalität oder die interzelluläre Kommunikation erzielt worden. Darüber hinaus wurde dieser Ansatz eine starke funktionelle Wirkung in eingeführten exogen ich verursachen unter Beweis gestellt. Wichtig ist, gewährleistet die Anwendung dieser MNP-basierte Vektorzelle Magnetisierung, mit Möglichkeiten des magnetischen Ausrichtung und nicht-invasiven MRI-Tracing begleitet. Dies kann eine Grundlage für die magnetisch geführt wird, gentechnisch hergestellten Zelltherapeutika bereitzustellen, die nicht-invasiv mit MRI überwacht werden kann.

Der Hauptzweck des vorgeschlagenen Protokolls ist magnetisch ansprechende ich-modifizierten Zellen zu erzeugen , und ihre genaue Charakterisierung (Figur 1) zu leiten. Als Ergebnis sollten effizient transfizierten Zellen, die auf magnetische Auswahl und Führung und nachweisbar mit MRI, erhalten werden. Zunächst wird die Identitäten von isolierten HUVECs wurden durch typische Färbung mit dem endothelialen M...

Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Dieses Manuskript beschreibt die effiziente, nicht-virale Abgabe von miR-Zellen durch einen PEI / MNP-Vektor und ihre Magnetisierung an Endothelzellen. Somit kann zusätzlich zu genetischer Veränderung, ermöglicht dieser Ansatz für die magnetische Zellführung und MRI Nachweisbarkeit. Die Technik kann verwendet werden, um die Eigenschaften von therapeutischen Zellprodukten zu verbessern.

Vorbereitung und<em&gt; In Vitro</em&gt; Charakterisierung von Magnetized miR-modifizierten Endothelzellen

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene ...

preparation-vitro-characterization-magnetized-mir-modified

Research

JoVE Journal

Medicine

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

7.6K Aufrufe.  University of Rostock.  Dieses Manuskript beschreibt die effiziente, nicht-virale Abgabe von miR-Zellen durch einen PEI / MNP-Vektor und ihre Magnetisierung an Endothelzellen. Somit kann zusätzlich zu genetischer Veränderung, ermöglicht dieser Ansatz für die magnetische Zellführung und MRI Nachweisbarkeit. Die Technik kann verwendet werden, um die Eigenschaften von therapeutischen Zellprodukten zu verbessern. 

Serie: Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Corneal Donor Tissue Preparation for Endothelial Keratoplasty

Over the past ten years, corneal transplantation surgical techniques have undergone revolutionary changes1,2. Since its inception, traditional full thickness corneal transplantation has been the treatment to restore sight in those limited by corneal disease. Some disadvantages to this approach include a high degree of post-operative astigmatism, lack of predictable refractive outcome, and disturbance to the ocular surface. The development of Descemet's stripping endothelial keratoplasty (DSEK), transplanting only the posterior corneal stroma, Descemet's membrane, and endothelium, has dramatically changed treatment of corneal endothelial disease. DSEK is performed through a smaller incision; this technique avoids 'open sky' surgery with its risk of hemorrhage or expulsion, decreases the incidence of postoperative wound dehiscence, reduces unpredictable refractive outcomes, and may decrease the rate of transplant rejection3-6.
Initially, cornea donor posterior lamellar dissection for DSEK was performed manually1 resulting in variable graft thickness and damage to the delicate corneal endothelial tissue during tissue processing. Automated lamellar dissection (Descemet's stripping automated endothelial keratoplasty, DSAEK) was developed to address these issues. Automated dissection utilizes the same technology as LASIK corneal flap creation with a mechanical microkeratome blade that helps to create uniform and thin tissue grafts for DSAEK surgery with minimal corneal endothelial cell loss in tissue processing.
Eye banks have been providing full thickness corneas for surgical transplantation for many years. In 2006, eye banks began to develop methodologies for supplying precut corneal tissue for endothelial keratoplasty. With the input of corneal surgeons, eye banks have developed thorough protocols to safely and effectively prepare posterior lamellar tissue for DSAEK surgery. This can be performed preoperatively at the eye bank. Research shows no significant difference in terms of the quality of the tissue7 or patient outcomes8,9 using eye bank precut tissue versus surgeon-prepared tissue for DSAEK surgery. For most corneal surgeons, the availability of precut DSAEK corneal tissue saves time and money10, and reduces the stress of performing the donor corneal dissection in the operating room. In part because of the ability of the eye banks to provide high quality posterior lamellar corneal in a timely manner, DSAEK has become the standard of care for surgical management of corneal endothelial disease.
The procedure that we are describing is the preparation of the posterior lamellar cornea at the eye bank for transplantation in DSAEK surgery (Figure 1).

Endothelial corneal transplantation is a surgical technique for treatment of posterior corneal diseases. Mechanical microkeratome dissection to prepare tissue results in thinner, more symmetric grafts with less endothelial cell loss and improved outcomes. Dissections can be performed at the eye bank prior to corneal transplantation surgery.

Corneal Spendergewebe Vorbereitung für Endothelial Keratoplasty

Over the past ten years, corneal transplantation surgical techniques have undergone revolutionary changes1,2. Since its inception, traditional full ...

Forschung

Medizin

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human pulp-derived stem cells (hDPSCs) possess high proliferation potential with multi-lineage differentiation capacity compare to the ordinary source of adult stem cells1-8; therefore, hDPSCs could be the good candidates for autologous transplantation in tissue engineering and regenerative medicine. Along with these benefits, possessing the mesenchymal stem cells (MSC) features, such as immunolodulatory effect, make hDPSCs more valuable, even in the case of allograft transplantation6,9,10. Therefore, the primary step for using this source of stem cells is to select the best protocol for isolating hDPSCs from pulp tissue. In order to achieve this goal, it is crucial to investigate the effect of various isolation conditions on different cellular behaviors, such as their common surface markers &amp; also their differentiation capacity.
Thus, here we separate human pulp tissue from impacted third molar teeth, and then used both existing protocols based on literature, for isolating hDPSCs,11-13 i.e. enzymatic dissociation of pulp tissue (DPSC-ED) or outgrowth from tissue explants (DPSC-OG). In this regards, we tried to facilitate the isolation methods by using dental diamond disk. Then, these cells characterized in terms of stromal-associated Markers (CD73, CD90, CD105 &amp; CD44), hematopoietic/endothelial Markers (CD34, CD45 &amp; CD11b), perivascular marker, like CD146 and also STRO-1. Afterwards, these two protocols were compared based on the differentiation potency into odontoblasts by both quantitative polymerase chain reaction (QPCR) &amp; Alizarin Red Staining. QPCR were used for the assessment of the expression of the mineralization-related genes (alkaline phosphatase; ALP, matrix extracellular phosphoglycoprotein; MEPE &amp; dentin sialophosphoprotein; DSPP).14

The method described isolation and characterization of human Dental Pulp Stem Cells (hDPSCs) by using either enzymatic dissociation of pulp (DPSC-ED) or direct outgrowth of stem cells from pulp tissue explants (DPSC-OG). Then followed by in vitro comparative differentiation of both types of hDPSCs into odontoblasts.

Isolation, Charakterisierung und vergleichende Differenzierung humaner Dental Pulp Stammzellen aus bleibenden Zähne mit zwei verschiedenen Methoden abgeleitet

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Stretch in Brain Microvascular Endothelial Cells (cEND) as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

Due to the high mortality incident brought about by traumatic brain injury (TBI), methods that would enable one to better understand the underlying mechanisms involved in it are useful for treatment. There are both in vivo and in vitro methods available for this purpose. In vivo models can mimic actual head injury as it occurs during TBI. However, in vivo techniques may not be exploited for studies at the cell physiology level. Hence, in vitro methods are more advantageous for this purpose since they provide easier access to the cells and the extracellular environment for manipulation.
Our protocol presents an in vitro model of TBI using stretch injury in brain microvascular endothelial cells. It utilizes pressure applied to the cells cultured in flexible-bottomed wells. The pressure applied may easily be controlled and can produce injury that ranges from low to severe. The murine brain microvascular endothelial cells (cEND) generated in our laboratory is a well-suited model for the blood brain barrier (BBB) thus providing an advantage to other systems that employ a similar technique. In addition, due to the simplicity of the method, experimental set-ups are easily duplicated. Thus, this model can be used in studying the cellular and molecular mechanisms involved in TBI at the BBB.

Stretch in Brain Microvascular Endothelial Cells cEND as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

In vitro traumatic brain injury models are being developed to reproduce in vivo brain deformation. Stretch-induced injury has been employed for astrocytes, neurons, glial cells, aortic, and brain endothelial cells. However, our system uses a blood brain barrier (BBB) model that possesses properties constituting a legitimate model of the BBB to establish an in vitro&#160;TBI model.

Stretchlimousine in Gehirn mikrovaskulären Endothelzellen (CEND) als<em&gt; In Vitro</em&gt; Traumatische Hirnverletzung Modell der Blut-Hirn-Schranke

Due to the high mortality incident brought about by traumatic brain injury (TBI), methods that would enable one to better understand the underlying ...

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

Metastasis is a process in which tumor cells shed from the primary tumor intravasate blood vascular and lymphatic system, thereby, gaining access to extravasate and form a secondary niche.&#160;The extravasation of tumor cells from the blood vascular system can be studied using endothelial cells (ECs) and tumor cells obtained from different cell lines.&#160;Initial studies were conducted using static conditions but it has been well documented that ECs behave differently under physiological flow conditions.&#160;Therefore, different flow chamber assemblies are currently being used to studying cancer cell interactions with ECs.&#160;Current flow chamber assemblies offer reproducible results using either different cell lines or fluid at different shear stress conditions.&#160;However, to observe and study interactions with rare cells such as circulating tumor cells (CTCs), certain changes are required to be made to the conventional flow chamber assembly.&#160;CTCs are a rare cell population among millions of blood cells. Consequently, it is difficult to obtain a pure population of CTCs.&#160;Contamination of CTCs with different types of cells normally found in the circulation is inevitable using present enrichment or depletion techniques.&#160;In the present report, we describe a unique method to fluorescently label circulating prostate cancer cells and study their interactions with ECs in a self-assembled flow chamber system.&#160;This technique can be further applied to observe interactions between prostate CTCs and any protein of interest.

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

Our report describes a unique method to visualize and analyze CTC/EC interactions in prostate cancer under physiological flow conditions.

In-vitro-Methode zur E-Selektin-vermittelte Interaktionen zwischen Prostata zirkulierenden Tumorzellen, abgeleitet von Patienten und humanen Endothelzellen beachten

Metastasis is a process in which tumor cells shed from the primary tumor intravasate blood vascular and lymphatic system, thereby, gaining access to ...

Corneal Donor Tissue Preparation for Descemet's Membrane Endothelial Keratoplasty

Descemet&#8217;s Membrane Endothelial Keratoplasty (DMEK) is a form of corneal transplantation in which only a single cell layer, the corneal endothelium, along with its basement membrane (Descemet&#39;s membrane) is introduced onto the recipient&#39;s posterior stroma3. Unlike Descemet&#8217;s Stripping Automated Endothelial Keratoplasty (DSAEK), where additional donor stroma is introduced, no unnatural stroma-to-stroma interface is created. As a result, the natural anatomy of the cornea is preserved as much as possible allowing for improved recovery time and visual acuity4. Endothelial Keratoplasty (EK) is the procedure of choice for treatment of endothelial dysfunction. The advantages of EK include rapid recovery of vision, preservation of ocular integrity and minimal refractive change due to use of a small, peripheral incision1. DSAEK utilizes donor tissue prepared with partial thickness stroma and endothelium. The rapid success and utilization of this procedure can be attributed to availability of eye-bank prepared precut tissue. The benefits of eye-bank preparation of donor tissue include elimination of need for specialized equipment in the operating room and availability of back up donor tissue in case of tissue perforation during preparation. In addition, high volume preparation of donor tissue by eye-bank technicians may provide improved quality of donor tissue. DSAEK may have limited best corrected visual acuity due to creation of a stromal interface between the donor and recipient cornea. Elimination of this interface with transplantation of only donor Descemet&#39;s membrane and endothelium in DMEK may improve visual outcomes and reduce complications after EK5. Similar to DSAEK, long term success and acceptance of DMEK is dependent on ease of availability of precut, eye-bank prepared donor tissue. Here we present a stepwise approach to donor tissue preparation which may reduce some barriers eye-banks face in providing DMEK grafts.

Endothelial keratoplasty is a surgical technique continuously evolving as advancements result in transplantation of thinner grafts with each succession1. Here we present a technique for controlled manual tissue dissection to allow safe and repeatable separation of endothelium and Descemet&#39;s membranes from donor corneoscleral buttons for transplantation2.

Hornhautspendergewebe Vorbereitung für Descemetschen Membrane Endothelial Keratoplastik

Descemet&#8217;s Membrane Endothelial Keratoplasty (DMEK) is a form of corneal transplantation in which only a single cell layer, the corneal endothelium, ...

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

This video demonstrates in detail an in vitro single-fiber electrophysiological recording protocol using a mouse colorectum-nerve preparation. The approach allows unbiased identification and functional characterization of individual colorectal afferents. Extracellular recordings of propagated action potentials (APs) that originate from one or a few afferent (i.e., single-fiber) receptive fields (RFs) in the colorectum are made from teased nerve fiber fascicles. The colorectum is removed with either the pelvic (PN) or lumbar splanchnic (LSN) nerve attached and opened longitudinally. The tissue is placed in a recording chamber, pinned flat and perfused with oxygenated Krebs solution. Focal electrical stimulation is used to locate the colorectal afferent endings, which are further tested by three distinct mechanical stimuli (blunt probing, mucosal stroking and circumferential stretch) to functionally categorize the afferents into five mechanosensitive classes. Endings responding to none of these mechanical stimuli are categorized as mechanically-insensitive afferents (MIAs). Both mechanosensitive and MIAs can be assessed for sensitization (i.e., enhanced response, reduced threshold, and/or acquisition of mechanosensitivity) by localized exposure of RFs to chemicals (e.g., inflammatory soup (IS), capsaicin, adenosine triphosphate (ATP)). We describe the equipment and colorectum&#8211;nerve recording preparation, harvest of colorectum with attached PN or LSN, identification of RFs in the colorectum, single-fiber recording from nerve fascicles, and localized application of chemicals to the RF. In addition, challenges of the preparation and application of standardized mechanical stimulation are also discussed.

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

This video demonstrates a protocol for conducting single-fiber electrophysiological recordings on an in vitro mouse colorectum-nerve preparation.

In-vitro-Funktionelle Charakterisierung von Maus Colorectal Afferente Endings

This video demonstrates in detail an in vitro single-fiber electrophysiological recording protocol using a mouse colorectum-nerve preparation. The ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

Studieren Bauchspeicheldrüsenkrebs Stammzelleigenschaften für die Entwicklung neuer Behandlungsstrategien

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Isolation and Culture Expansion of Tumor-specific Endothelial Cells

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model for developing new angiogenesis inhibitors for cancer. However, long-term in vitro expansion of murine endothelial cells (EC) is challenging due to phenotypic drift in culture (endothelial-to-mesenchymal transition) and contamination with non-EC. This is especially true for TEC which are readily outcompeted by co-purified fibroblasts or tumor cells in culture. Here, a high fidelity isolation method that takes advantage of immunomagnetic enrichment coupled with colony selection and in vitro expansion is described. This approach generates pure EC fractions that are entirely free of contaminating stromal or tumor cells. It is also shown that lineage-traced Cdh5cre:ZsGreenl/s/l reporter mice, used with the protocol described herein, are a valuable tool to verify cell purity as the isolated EC colonies from these mice show durable and brilliant ZsGreen fluorescence in culture.

We report a reliable method to isolate and culture primary tumor-specific endothelial cells from genetically engineered mouse models.

Isolierung und Kultur Expansion von tumorspezifischen Endothelzellen

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model ...

Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study vasculogenesis, (tumor) angiogenesis, and atherosclerosis. The current standard for in vitro research on human endothelial cells (ECs) is the use of Human Umbilical Vein Endothelial Cells (HUVECs) and Human Umbilical Artery Endothelial Cells (HUAECs). For canine endothelial research, only one cell line (CnAOEC) is available, which is derived from canine aortic endothelium. Although currently not completely understood, there is a difference between ECs originating from either arteries or veins. For a more direct approach to in vitro functionality studies on ECs, we describe a new method for isolating Canine Primary Endothelial Cells (CaPECs) from a variety of vessels. This technique reduces the chance of contamination with fast-growing cells such as fibroblasts and smooth muscle cells, a problem that is common in standard isolation methods such as flushing the vessel with enzymatic solutions or mincing the vessel prior to digestion of the tissue containing all cells. The technique we describe was optimized for the canine model, but can easily be utilized in other species such as human.

Novel isolation methods of primary endothelial cells from blood vessels are needed. This protocol describes a new technique that completely inverts blood vessels of interest, exposing only the endothelial side to enzymatic digestion. The resulting pure endothelial cell culture can be used to study cardiovascular diseases, disease modelling, and angiogenesis.

Isolierung und Kultur von primären Endothelzellen von Canine Arterien und der

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant CFTR channel in subjects with cystic fibrosis (CF). Identification of subjects that may benefit from these drugs is challenging because of the extensive heterogeneity of CFTR mutations, as well as other unknown factors that contribute to individual drug efficacy. Here, we describe a simple and relatively rapid assay for measuring individual CFTR function and response to CFTR modulators in vitro. Three dimensional (3D) epithelial organoids are grown from rectal biopsies in standard organoid medium. Once established, the organoids can be bio-banked for future analysis. For the assay, 30-80 organoids are seeded in 96-well plates in basement membrane matrix and are then exposed to drugs. One day later, the organoids are stained with calcein green, and forskolin-induced swelling is monitored by confocal live cell microscopy at 37 &#176;C. Forskolin-induced swelling is fully CFTR-dependent and is sufficiently sensitive and precise to allow for discrimination between the drug responses of individuals with different and even identical CFTR mutations. In vitro swell responses correlate with the clinical response to therapy. This assay provides a cost-effective approach for the identification of drug-responsive individuals, independent of their CFTR mutations. It may also be instrumental in the development of future CFTR modulators.

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

This protocol describes an assay for measuring CFTR function and CFTR modulator responses in cultured tissue from subjects with cystic fibrosis (CF). Biopsy-derived intestinal organoids swell in a cAMP-driven fashion, a response that is defective (or strongly reduced) in CF organoids and can be restored by exposure to CFTR modulators.

Forskolin-induzierte Quellung in Intestinale Organoide: Ein<em&gt; In Vitro</em&gt; Assay für Fibrosis Patienten in Cystic Drug Response-Beurteilung

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...