This project has been funded in part with federal funds from the National Institute of Allergy and Infectious Diseases, National Institutes of Health, Department of Health and Human Services, under CEIRS contract HHSN272201400008C (F.K.); NIH U19AI109946-01 (F.K.); and P01AI097092-04S1 (P.E.L.).

<ol>
	<li>Shaw, M. L., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Orthomyxoviridae: the viruses and their replication. , (2013).</li><li>Nelson, M. I., Holmes, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolution+of+epidemic+influenza.">The evolution of epidemic influenza.</a> Nat Rev Genet. 8 (3), 196-205 (2007).</li><li>Lauring, A. S., Andino, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quasispecies+Theory+and+the+Behavior+of+RNA+Viruses.">Quasispecies Theory and the Behavior of RNA Viruses.</a> PLoS Pathog. 6 (7), e1001005 (2010).</li><li>Henry Dunand, C. J., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preexisting+human+antibodies+neutralize+recently+emerged+H7N9+influenza+strains.">Preexisting human antibodies neutralize recently emerged H7N9 influenza strains.</a> J Clin Invest. 125 (3), 1255-1268 (2015).</li><li>Dunand, C. J. H., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Both+Neutralizing+and+Non-Neutralizing+Human+H7N9+Influenza+Vaccine-Induced+Monoclonal+Antibodies+Confer+Protection.">Both Neutralizing and Non-Neutralizing Human H7N9 Influenza Vaccine-Induced Monoclonal Antibodies Confer Protection.</a> Cell Host Microbe. 19 (6), 800-813 (2016).</li><li>Tan, G. S., Lee, P. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+Broadly+Neutralizing+Monoclonal+Antibody+That+Targets+the+Fusion+Domain+of+Group+2+Influenza+A+Virus+Hemagglutinin.">Characterization of a Broadly Neutralizing Monoclonal Antibody That Targets the Fusion Domain of Group 2 Influenza A Virus Hemagglutinin.</a> J Virol. 88 (23), 13580-13592 (2014).</li><li>Tan, G. S., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broadly-Reactive+Neutralizing+and+Non-neutralizing+Antibodies+Directed+against+the+H7+Influenza+Virus+Hemagglutinin+Reveal+Divergent+Mechanisms+of+Protection.">Broadly-Reactive Neutralizing and Non-neutralizing Antibodies Directed against the H7 Influenza Virus Hemagglutinin Reveal Divergent Mechanisms of Protection.</a> PLoS Pathog. 12 (4), e1005578 (2016).</li><li>Smith, K., Garman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+generation+of+fully+human+monoclonal+antibodies+specific+to+a+vaccinating+antigen.">Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen.</a> Nat Protoc. 4 (3), 372-384 (2009).</li><li>Steel, J., Lowen, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+virus+vaccine+based+on+the+conserved+hemagglutinin+stalk+domain.">Influenza virus vaccine based on the conserved hemagglutinin stalk domain.</a> mBio. 1 (1), (2010).</li><li>Krammer, F., Pica, N., Hai, R., Margine, I., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+hemagglutinin+influenza+virus+vaccine+constructs+elicit+broadly+protective+stalk-specific+antibodies.">Chimeric hemagglutinin influenza virus vaccine constructs elicit broadly protective stalk-specific antibodies.</a> J Virol. 87 (12), 6542-6550 (2013).</li><li>Wang, T. T., Tan, G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+a+synthetic+peptide+from+the+influenza+virus+hemagglutinin+provides+protection+against+distinct+viral+subtypes.">Vaccination with a synthetic peptide from the influenza virus hemagglutinin provides protection against distinct viral subtypes.</a> Proc Natl Acad Sci U S A. 107 (44), 18979-18984 (2010).</li><li>Impagliazzo, A., Milder, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stable+trimeric+influenza+hemagglutinin+stem+as+a+broadly+protective+immunogen.">A stable trimeric influenza hemagglutinin stem as a broadly protective immunogen.</a> Science. 349 (6254), 1301-1306 (2015).</li><li>Krammer, F., Palese, P., Steel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Universal+Influenza+Virus+Vaccine+Design+and+Antibody+Mediated+Therapies+Based+on+Conserved+Regions+of+the+Hemagglutinin.">Advances in Universal Influenza Virus Vaccine Design and Antibody Mediated Therapies Based on Conserved Regions of the Hemagglutinin.</a> Current Topics in Microbiology and Immunology. , (2014).</li><li>Wohlbold, T. J., Nachbagauer, R., Margine, I., Tan, G. S., Hirsh, A., Krammer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+soluble+headless+hemagglutinin+protects+mice+from+challenge+with+divergent+influenza+viruses.">Vaccination with soluble headless hemagglutinin protects mice from challenge with divergent influenza viruses.</a> Vaccine. 33 (29), 3314-3321 (2015).</li><li>Ekiert, D. C., Bhabha, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibody+recognition+of+a+highly+conserved+influenza+virus+epitope.">Antibody recognition of a highly conserved influenza virus epitope.</a> Science. 324 (5924), 246-251 (2009).</li><li>Ekiert, D. C., Friesen, R. H. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Highly+Conserved+Neutralizing+Epitope+on+Group+2+Influenza+A+Viruses.">A Highly Conserved Neutralizing Epitope on Group 2 Influenza A Viruses.</a> Science. 333 (6044), 843-850 (2011).</li><li>Dreyfus, C., Laursen, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Conserved+Protective+Epitopes+on+Influenza+B+Viruses.">Highly Conserved Protective Epitopes on Influenza B Viruses.</a> Science. 337 (6100), 1343-1348 (2012).</li><li>Tran, E. E. H., Podolsky, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-electron+Microscopy+Structures+of+Chimeric+Hemagglutinin+Displayed+on+a+Universal+Influenza+Vaccine+Candidate.">Cryo-electron Microscopy Structures of Chimeric Hemagglutinin Displayed on a Universal Influenza Vaccine Candidate.</a> mBio. 7 (2), e00257 (2016).</li><li>Wiley, D. C., Wilson, I. A., Skehel, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+identification+of+the+antibody-binding+sites+of+Hong+Kong+influenza+haemagglutinin+and+their+involvement+in+antigenic+variation.">Structural identification of the antibody-binding sites of Hong Kong influenza haemagglutinin and their involvement in antigenic variation.</a> Nature. 289 (5796), 373-378 (1981).</li><li>Gerhard, W., Yewdell, J., Frankel, M. E., Webster, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigenic+structure+of+influenza+virus+haemagglutinin+defined+by+hybridoma+antibodies.">Antigenic structure of influenza virus haemagglutinin defined by hybridoma antibodies.</a> Nature. 290 (5808), 713-717 (1981).</li><li>Jackson, D. C., Murray, J. M., White, D. O., Gerhard, W. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enumeration+of+antigenic+sites+of+influenza+virus+hemagglutinin.">Enumeration of antigenic sites of influenza virus hemagglutinin.</a> Infect Immun. 37 (3), 912-918 (1982).</li><li>Matsuzaki, Y., Sugawara, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitope+Mapping+of+the+Hemagglutinin+Molecule+of+A/(H1N1)pdm09+Influenza+Virus+by+Using+Monoclonal+Antibody+Escape+Mutants.">Epitope Mapping of the Hemagglutinin Molecule of A/(H1N1)pdm09 Influenza Virus by Using Monoclonal Antibody Escape Mutants.</a> J Virol. 88 (21), 12364-12373 (2014).</li><li>Tan, G. S., Krammer, F., Eggink, D., Kongchanagul, A., Moran, T. M., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pan-H1+anti-hemagglutinin+monoclonal+antibody+with+potent+broad-spectrum+efficacy+in+vivo.">A pan-H1 anti-hemagglutinin monoclonal antibody with potent broad-spectrum efficacy in vivo.</a> J Virol. 86 (11), 6179-6188 (2012).</li><li>Geneva: World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> WHO manual on animal influenza diagnosis and surveillance. , (2002).</li><li>Brauer, R., Chen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+Virus+Propagation+in+Embryonated+Chicken+Eggs.">Influenza Virus Propagation in Embryonated Chicken Eggs.</a> J Vis Exp. (97), e52421 (2015).</li><li>Mart&#237;nez-Sobrido, L., Garc&#237;a-Sastre, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+Recombinant+Influenza+Virus+from+Plasmid+DNA.">Generation of Recombinant Influenza Virus from Plasmid DNA.</a> J Vis Exp. (42), e2057 (2010).</li><li>Hoffmann, E., Stech, J., Guan, Y., Webster, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+primer+set+for+the+full-length+amplification+of+all+influenza+A+viruses.">Universal primer set for the full-length amplification of all influenza A viruses.</a> ArchVirol. 146 (12), 2275-2289 (2001).</li><li>Zhou, B., Lin, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+Influenza+B+Virus+Genomic+Amplification+Facilitates+Sequencing,+Diagnostics,+and+Reverse+Genetics.">Universal Influenza B Virus Genomic Amplification Facilitates Sequencing, Diagnostics, and Reverse Genetics.</a> J Clin Microbiol. 52 (5), 1330-1337 (2014).</li><li>Sidhu, S. S., Kossiakoff, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+and+designing+protein+function+with+restricted+diversity.">Exploring and designing protein function with restricted diversity.</a> Curr Opin Chem Biol. 11, 347-354 (2007).</li><li>Chen, C. -. W., Chang, C. -. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peptide+Scanning-assisted+Identification+of+a+Monoclonal+Antibody-recognized+Linear+B-cell+Epitope.">Peptide Scanning-assisted Identification of a Monoclonal Antibody-recognized Linear B-cell Epitope.</a> J Vis Exp. (121), e55417 (2017).</li></ol>

The authors declare no conflicts of interest.

Although the majority of residues identified via escape mutants have been accurate, one of the major caveats of this approach is that point mutations of escape variants may not necessarily map within the molecular footprint of the antibody as determined by structural analyses. This is due to the ability of a mutation at a certain residue to lead to a conformational change distal to the location of the mutated residue, analogous to an allosteric effect. Another limitation is that this methodology can only be implemented for neutralizing antibodies; antibodies that lack in vitro selective pressure will not lead to escape mutants. However, this limitation can be overcome with the use of a panel of escape variants generated by previously characterized neutralizing antibodies. Tan et al. used an escape variant of a neutralizing mAb to the H7N9 virus to map the epitope of a non-neutralizing antibody7.
Nonetheless, elucidating the epitopes of antibodies through the generation of escape variants provides a viable alternative to crystallography and cryo-electron microscopy, both of which require an extensive investment of equipment. Other alternatives are to determine the minimal binding region of mAbs using alanine scanning or peptide scanning/truncation mutants. Alanine scanning mutagenesis may require a significant amount of work in generating a large number of variants during screening29, while peptide scanning is limited to linear epitopes30. The method described in this protocol requires no special equipment or technique and in fact, makes use of existing in vitro neutralization assays modified to generate escape variants of the antibodies of interest.
The protocol for generating escape variants that require multiple passages (e.g., stalk-specific antibodies) is highly dependent on the starting concentration of antibody in passage 0. It is better to err on the side of caution and start at a log to half a log lower than the half maximal inhibitory concentration of an antibody and allow for robust virus growth. The researcher can speculate that a high titer virus culture in the presence of low immunological pressure will have a large genetic variation in the viral population. Escape variants can be selected for by gradually increasing the antibody concentration in the following passages. In the event that the virus growth decreases, the amount of viral supernatant can be increased in the next passage while maintaining the same amount of antibody concentration in the previous passage.
The aim of a majority of universal influenza vaccines is to elicit a robust antibody response towards the stalk region of the HA. The analyses of escape variants to stalk-specific antibodies are important in defining the relationship between influenza virus fitness and immunological pressure. Interestingly, escape mutant viruses resulting from stalk-specific mAbs were all attenuated in vivo in murine LD50 studies4. These studies provide a strong case for stalk-based vaccination platforms. Additionally, this protocol could be used to identify escape mutants to other anti-viral compounds, such as small molecule inhibitors. Finally, this methodology is not limited to influenza virus surface glycoproteins, but may also be more widely applied to determine the epitopes of other viral glycoproteins.

Similar to other RNA viruses, influenza A viruses possess an error-prone polymerase that allows for the generation of a multitude of antigenic variants with each round of replication1,2,3. The influenza A virus has an astonishing ability to adapt and evade the human immune response via antigenic drift, which is achieved through an accumulation of mutations on the surface glycoproteins that leads to the loss of antibody binding. Antigenic drift of the viral surface glycoproteins, HA and neuraminidase (NA), necessitates the need to reformulate and administer the vaccine annually.
Technological advancements in the isolation and generation of antigen-specific antibodies have yielded a high number of vaccine-induced mAbs4,5,6,7,8. In turn, the characterization of the epitopes of mAbs that broadly neutralize influenza A viruses has greatly aided the development of several universal influenza vaccine candidates9,10,11,12,13,14. Elucidating the antigenic footprint of a mAb reveals the structural determinants of neutralization and allows for an informed approach towards vaccine design. However, it is neither realistic nor cost-effective for laboratories to structurally characterize extensive panels of mAbs through x-ray crystallography or cryo-electron microscopy in order to map epitopes on the viral antigen15,16,17,18.
X-ray crystallography or cryo-electron microscopy requires expensive equipment, specialized techniques and potentially an extensive amount of time to generate data. An alternative and faster approach is utilizing the rapid generation of diverse viral populations via the error-prone RNA-dependent RNA polymerase to generate escape mutants to determine the epitopes of mAbs19,20,21,22,23. The generation of escape variants does not require any special equipment or technique and can be performed with conventional laboratory reagents and equipment.
Here, we describe a method that allows for the mapping of critical residues required for mAb binding that recognize the influenza HA.

<table><tbody><tr><td>Falcon 96-well clear flat bottom TC-treated culture microplate with Lid</td><td>Corning, Inc.</td><td>353072</td><td>Assay plate use for the microneutralization assay</td></tr><tr><td>Falcon 96-well clear V-bottom plate</td><td>Corning, Inc.</td><td>353263</td><td>Assay plate use for the hemagglutination inhibition assay</td></tr><tr><td>1X Minimal Essential Medium (MEM)</td><td>Gibco</td><td>11095080</td><td>Infection medium</td></tr><tr><td>Tosyl phenylalanyl chloromethyl (TPCK)-treated trypsin</td><td>Sigma-Aldrich</td><td>T8802</td><td>Cleaves immature HA&lt;sub&gt;0&lt;/sub&gt; to HA&lt;sub&gt;1&lt;/sub&gt; and HA&lt;sub&gt;2&lt;/sub&gt;</td></tr><tr><td>Biotinylated anti-NP primary antibody (IAV)</td><td>EMD Millipore</td><td>MAB8258B</td><td>An antibody that recognizes the NP protein of influenza A viruses</td></tr><tr><td>Biotinylated anti-NP primary antibody (IBV)</td><td>EMD Millipore</td><td>MAB8260B-5</td><td>An antibody that recognizes the NP protein of influenza B viruses</td></tr><tr><td>Streptavidin-HRP antibody</td><td>EMD Millipore</td><td>18-152</td><td>This is used as a secondary antibody for the biotinylated anti-NP antibody</td></tr><tr><td>HRP substrate (SIGMAFAST-OPD)</td><td>Sigma-Aldrich</td><td>P9187-5SET</td><td>o-phenylenediamine dihydrochloride water soluble substrate for HRP</td></tr><tr><td>96-well V-bottom plate</td><td>Nunc</td><td>249662</td><td>Assay plate used for the hemagglutination assay</td></tr><tr><td>Chicken red blood cells</td><td>Lampire Biological Laboratories</td><td>7201403</td><td>Used to assess the ability of influenza virus to agglutinate</td></tr><tr><td>TRIzol</td><td>Ambion</td><td>15596026</td><td>Extraction of RNA</td></tr><tr><td>Superscript III</td><td>Invitrogen</td><td>12574018</td><td>Reverse transcriptase</td></tr><tr><td>Gel Extraction Kit</td><td>Qiagen</td><td>28704</td><td>Isolation of amplified PCR product</td></tr><tr><td>Lipofectamine 2000</td><td>Invitrogen</td><td>11668027</td><td>Transfection reagent</td></tr><tr><td>Anti-human IgG (H+L) Alexa Fluor 488</td><td>Invitrogen</td><td>A-11013</td><td>Fluorescent secondary antibody for human antibodies</td></tr><tr><td>Anti-mouse IgG (H+L) Alexa Fluor 488</td><td>Invitrogen</td><td>A-11001</td><td>Fluorescent secondary antibody for murine antibodies</td></tr><tr><td>6-well polystyrene microplate</td><td>Corning, Inc.</td><td>353934</td><td></td></tr><tr><td>UltraPure Agarose</td><td>Invitrogen</td><td>16500500</td><td></td></tr><tr><td>Nalgene long term storage Cryo-tubes</td><td>ThermoFisher Scientific</td><td>5012-0020</td><td>Freezing of viral culture supernatant</td></tr><tr><td>reassortant A/California/04/09 (H1)</td><td>Palese Laboratory</td><td></td><td>reassortant virus expressing the HA and NA of A/California/04/09 (H1N1) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td></tr><tr><td>reassortant A/Shanghai/1/13 (H7)</td><td>Palese Laboratory</td><td></td><td>reassortant virus expressing the HA and NA of A/Shanghai/1/13 (H7N9) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td></tr><tr><td>Bovine serum albumin solution (35%)</td><td>Sigma-Aldrich</td><td>A7979</td><td></td></tr><tr><td>Qiagen gel extration kit</td><td>Qiagen</td><td>28704</td><td>Silica-membrane-based purification of DNA fragments</td></tr></tbody></table>

generation of escape variants of neutralizing influenza virus monoclonal antibodies

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface glycoproteins of the virus. The generation of escape variants is a powerful method in elucidating how viruses escape immune detection and in identifying critical residues required for antibody binding. Here, we describe a protocol on how to generate influenza A virus escape variants by utilizing human or murine monoclonal antibodies (mAbs) directed against the viral hemagglutinin (HA). With the use of our technique, we previously characterized critical residues required for the binding of antibodies targeting either the head or stalk of the novel avian H7N9 HA. The protocol can be easily adapted for other virus systems. Analyses of escape variants are important for modeling antigenic drift, determining single nucleotide polymorphisms (SNPs) conferring resistance and virus fitness, and in the designing of vaccines and/or therapeutics.

We have previously used variations of this method to generate escape variants to human and murine mAbs induced by the seasonal influenza virus vaccine, H7N9 vaccination, or sequential DNA/recombinant HA protein vaccination4,5,6,7. As described above, antibodies were first characterized using the HI and microneutralization assays in order to inform us of which specific protocol to continue with next4,5. Antibodies 07-5D03, 07-5F01, 07-5G01, 07-4B03, 07-4E02 and 07-4D05 were found to have HI and neutralization activities against the avian H7N9 virus (A/Shanghai/1/2013) (Table 1), and thus protocol 1 (step 2.1) was utilized. For mAbs with neutralizing that lack HI activity, such as 41-5E04, 045-051310-2B06, 042-100809-2F04 and S6-B01 (Table 1), protocol 2 (step 2.2) was used to generate escape variants. Escape mutant mapping revealed that many of the antibodies recognize critical residues in distinct locations on the viral HA4,5 (Figure 4). While the majority of the HI-positive antibodies have escape mutant residues near previously reported antigenic sites of the H7 HA, the HI-negative antibodies generated escape mutants with point mutations in the stalk region4,5.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antibody</td>
			<td>HI Activity</td>
			<td>NEUT Activity</td>
		</tr>
		<tr>
			<td>07-5D03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5F01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5G01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4B03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4E02</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4D05</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>41-5E04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>045-051310-2B06</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>042-100809-2F04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>S6-B01</td>
			<td>-</td>
			<td>+</td>
		</tr>
	</tbody>
</table>
Table 1: Table of antibody HI and neutralization activity. Ten H7-specific mAbs isolated from individuals vaccinated with an experimental H7N9 vaccine exhibit different in vitro antiviral activities5.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td colspan="4">Forward Primer (5&#39; to 3&#39;)</td>
			<td colspan="4">Reverse Primer&#160; (5&#39; to 3&#39;)</td>
			<td colspan="2">Thermocylcer conditions</td>
		</tr>
		<tr>
			<td>IAV</td>
			<td colspan="4">TATTCGTCTCAGGGAGCAAAAGCAGGGG</td>
			<td colspan="4">ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT</td>
			<td colspan="2">42 &#186;C for 60 min, 94 &#186;C for 2 min/5 cycles of 94 &#186;C for 20 s, 50 &#186;C for 30 s and 68 &#186;C for 3 min 30 s, followed by 40&#160; cycles of 94 &#186;C for 20 s, 58 &#186;C for 30 s, and 68 &#186;C for 3 min 30 s with a final extension time at 68 &#186;C for 10 min</td>
		</tr>
		<tr>
			<td>IBV</td>
			<td colspan="4">GGGGGGAGCAGAAGCAGAGC</td>
			<td colspan="4">CCGGGTTATTAGTAGTAACAAGAGC</td>
			<td colspan="2">45 &#186;C for 60 min, 55 &#186;C for 30 min, 94 &#186;C for 2 min/5 cycles of 94 &#186;C for 20 s, 40 &#186;C for 30 s and 68 &#186;C for 3 min 30 s, followed by 40&#160; cycles of 94 &#186;C for 20 s, 58 &#186;C for 30 s, and 68 &#186;C for 3 min 30 s with a final extension time at 68 &#186;C for 10 min</td>
		</tr>
	</tbody>
</table>
Table 2: Universal influenza virus primers. Primer pairs for the amplification of the HA segments of influenza A27 and B28 viruses and their respective thermocycler conditions.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56067/56067fig1.jpg" /> 
Figure 1: HI assay. (A) A schematic for the setting up a HI assay to test the activity of two mouse H1-specific mAbs 7B2 (head-specific) and 6F12 (stalk-specific) using a 96-well V-bottom plate, and (B) an example of the results of an HI assay23. <a href="https://cloudflare.jove.com/files/ftp_upload/56067/56067fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56067/56067fig2.jpg" /> 
Figure 2: Microneutralization assay. A schematic for setting up a microneutralization assay to test the activity of two human mAbs 4D055 and CR911417. <a href="https://cloudflare.jove.com/files/ftp_upload/56067/56067fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56067/56067fig3.jpg" /> 
Figure 3: Generation of escape mutants. The methodology suggested will be dependent on the HI and the microneutralization activity exhibited by the antibody. The generation of escape mutants against (A) neutralizing HI-positive antibodies may require a single passage in eggs, while (B) neutralizing HI-negative antibodies may involve multiple passages with increasing antibody amounts in cell tissue culture. <a href="https://cloudflare.jove.com/files/ftp_upload/56067/56067fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56067/56067fig4.jpg" /> 
Figure 4: An example of an epitope map of the novel avian H7N9 HA generated with escape mutant variants. Vaccine-induced antibodies isolated from individuals vaccinated with a candidate H7N9 influenza A vaccine were used to generate escape mutant variants. Each residue indicated in red represents the location of critical amino acids required for efficient binding of a mAb. Data were adapted from Dunand-Henry et al., 20154. <a href="https://cloudflare.jove.com/files/ftp_upload/56067/56067fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies at JoVE.com

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

We describe a method by which we identify critical residues required for the binding of human or murine monoclonal antibodies that target the viral hemagglutinin of influenza A viruses. The protocol can be adapted to other virus surface glycoproteins and their corresponding neutralizing antibodies.

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

generation-escape-variants-neutralizing-influenza-virus-monoclonal

Research

JoVE Journal

Immunology and Infection

11.7K Views.  Icahn School of Medicine at Mount Sinai. Beschrijven we een methode waarmee we identificeren kritische residuen nodig zijn voor de binding van de mens of lymfkliertest monoclonal antilichamen die gericht zijn op de virale hemagglutinine van influenza A-virussen. Het protocol kan worden aangepast aan andere oppervlakte glycoproteïnen van virus en hun overeenkomstige neutraliserende antilichamen.

Video: Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Quantitative Analyses of all Influenza Type A Viral Hemagglutinins and Neuraminidases using Universal Antibodies in Simple Slot Blot Assays

Hemagglutinin (HA) and neuraminidase (NA) are two surface proteins of influenza viruses which are known to play important roles in the viral life cycle and the induction of protective immune responses1,2. As the main target for neutralizing antibodies, HA is currently used as the influenza vaccine potency marker and is measured by single radial immunodiffusion (SRID)3. However, the dependence of SRID on the availability of the corresponding subtype-specific antisera causes a minimum of 2-3 months delay for the release of every new vaccine. Moreover, despite evidence that NA also induces protective immunity4, the amount of NA in influenza vaccines is not yet standardized due to a lack of appropriate reagents or analytical method5. Thus, simple alternative methods capable of quantifying HA and NA antigens are desirable for rapid release and better quality control of influenza vaccines.
Universally conserved regions in all available influenza A HA and NA sequences were identified by bioinformatics analyses6-7. One sequence (designated as Uni-1) was identified in the only universally conserved epitope of HA, the fusion peptide6, while two conserved sequences were identified in neuraminidases, one close to the enzymatic active site (designated as HCA-2) and the other close to the N-terminus (designated as HCA-3)7. Peptides with these amino acid sequences were synthesized and used to immunize rabbits for the production of antibodies. The antibody against the Uni-1 epitope of HA was able to bind to 13 subtypes of influenza A HA (H1-H13) while the antibodies against the HCA-2 and HCA-3 regions of NA were capable of binding all 9 NA subtypes. All antibodies showed remarkable specificity against the viral sequences as evidenced by the observation that no cross-reactivity to allantoic proteins was detected. These universal antibodies were then used to develop slot blot assays to quantify HA and NA in influenza A vaccines without the need for specific antisera7,8. Vaccine samples were applied onto a PVDF membrane using a slot blot apparatus along with reference standards diluted to various concentrations. For the detection of HA, samples and standard were first diluted in Tris-buffered saline (TBS) containing 4M urea while for the measurement of NA they were diluted in TBS containing 0.01% Zwittergent as these conditions significantly improved the detection sensitivity. Following the detection of the HA and NA antigens by immunoblotting with their respective universal antibodies, signal intensities were quantified by densitometry. Amounts of HA and NA in the vaccines were then calculated using a standard curve established with the signal intensities of the various concentrations of the references used. 
Given that these antibodies bind to universal epitopes in HA or NA, interested investigators could use them as research tools in immunoassays other than the slot blot only.

A simple slot blot method was developed for the quantification of influenza viral hemagglutinin and neuraminidase using universal antibodies targeting their most conserved sequences identified through bioinformatics analyses. This innovative approach may provide a useful alternative to quantitative determination of all viral hemagglutinin and neuraminidase.

Hemagglutinin (HA) and neuraminidase (NA) are two surface proteins of influenza viruses which are known to play important roles in the viral life cycle ...

Expression of Functional Recombinant Hemagglutinin and Neuraminidase Proteins from the Novel H7N9 Influenza Virus Using the Baculovirus Expression System

The baculovirus expression system is a powerful tool for expression of recombinant proteins. Here we use it to produce correctly folded and glycosylated versions of the influenza A virus surface glycoproteins - the hemagglutinin (HA) and the neuraminidase (NA). As an example, we chose the HA and NA proteins expressed by the novel H7N9 virus that recently emerged in China. However the protocol can be easily adapted for HA and NA proteins expressed by any other influenza A and B virus strains. Recombinant HA (rHA) and NA (rNA) proteins are important reagents for immunological assays such as ELISPOT and ELISA, and are also in wide use for vaccine standardization, antibody discovery, isolation and characterization. Furthermore, recombinant NA molecules can be used to screen for small molecule inhibitors and are useful for characterization of the enzymatic function of the NA, as well as its sensitivity to antivirals. Recombinant HA proteins are also being tested as experimental vaccines in animal models, and a vaccine based on recombinant HA was recently licensed by the FDA for use in humans. The method we describe here to produce these molecules is straight forward and can facilitate research in influenza laboratories, since it allows for production of large amounts of proteins fast and at a low cost. Although here we focus on influenza virus surface glycoproteins, this method can also be used to produce other viral and cellular surface proteins.

Here we describe a way to express correctly folded and functional influenza virus surface antigens derived from the novel Chinese H7N9 virus in insect cells. The technique can be adapted to express ectodomains of any viral or cellular surface proteins.

The baculovirus expression system is a powerful tool for expression of  recombinant proteins. Here we use it to produce correctly folded and  glycosylated ...

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding molecules is time-consuming and laborious due to the complicated handling and lack of alternatives. The aim of this protocol is to provide one standard method for the generation of monoclonal antibodies using hybridoma technology. This technology combines two steps. Step 1 is an appropriate immunization of the animal and step 2 is the fusion of B lymphocytes with immortal myeloma cells in order to generate hybrids possessing both parental functions, such as the production of antibody molecules and immortality. The generated hybridoma cells were then recloned and diluted to obtain stable monoclonal cell cultures secreting the desired monoclonal antibody in the culture supernatant. The supernatants were tested in enzyme-linked immunosorbent assays (ELISA) for antigen specificity. After the selection of appropriate cell clones, the cells were transferred to mass cultivation in order to produce the desired antibody molecule in large amounts. The purification of the antibodies is routinely performed by affinity chromatography. After purification, the antibody molecule can be characterized and validated for the final test application. The whole process takes 8 to 12 months of development, and there is a high risk that the antibody will not work in the desired test system.

An optimized protocol is presented for the generation of monoclonal antibodies based on the hybridoma technology. Mice were immunized with an immunoconjugate. Spleen cells were fused by PEG and an electric impulse with immortal myeloma cells. Antibody-producing hybridoma cells were selected by HAT and antigen-specific ELISA screening.

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding ...

Optimization of a Quantitative Micro-neutralization Assay

The micro-neutralization (MN) assay is a standard technique for measuring the infectivity of the influenza virus and the inhibition of virus replication. In this study, we present the protocol of an imaging-based MN assay to quantify the true antigenic relationships between viruses. Unlike typical plaque reduction assays that rely on visible plaques, this assay quantitates the entire infected cell population of each well. The protocol matches the virus type or subtype with the selection of cell lines to achieve maximum infectivity, which enhances sample contrast during imaging and image processing. The introduction of quantitative titration defines the amount of input viruses of neutralization and enables the results from different experiments to be comparable. The imaging setup with a flatbed scanner and free downloadable software makes the approach high throughput, cost effective, user friendly, and easy to deploy in most laboratories. Our study demonstrates that the improved MN assay works well with the current circulating influenza A(H1N1)pdm09, A(H3N2), and B viruses, without being significantly influenced by amino acid substitutions in the neuraminidase (NA) of A(H3N2) viruses. It is particularly useful for the characterization of viruses that either grow to low HA titer and/or undergo an abortive infection resulting in an inability to form plaques in cultured cells.

This study describes an imaging-based micro-neutralization assay to analyze the antigenic relationships between viruses. The protocol employs a flatbed scanner and has four steps, including titration, titration quantitation, neutralization, and neutralization quantitation. The assay works well with current circulating influenza A(H1N1)pdm09, A(H3N2), and B viruses.

The micro-neutralization (MN) assay is a standard technique for measuring the infectivity of the influenza virus and the inhibition of virus replication. ...

A Method to Assess Fc-mediated Effector Functions Induced by Influenza Hemagglutinin Specific Antibodies

Antibodies play a crucial role in coupling the innate and adaptive immune responses against viral pathogens through their antigen binding domains and Fc-regions. Here, we describe how to measure the activation of Fc effector functions by monoclonal antibodies targeting the influenza virus hemagglutinin with the use of a genetically engineered Jurkat cell line expressing an activating type 1 Fc-Fc&#947;R. Using this method, the contribution of specific Fc-Fc&#947;R interactions conferred by immunoglobulins can be determined using an in vitro assay.

We describe a method to measure the activation of Fc-mediated effector functions by antibodies that target the influenza virus hemagglutinin. This assay can also be adapted to assess the ability of monoclonal antibodies or polyclonal sera targeting other viral surface glycoproteins to induce Fc-mediated immunity.

Antibodies play a crucial role in coupling the innate and adaptive immune responses against viral pathogens through their antigen binding domains and ...

Measuring Influenza Neutralizing Antibody Responses to A(H3N2) Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

Neutralizing antibodies against hemagglutinin (HA) of influenza viruses are considered the main immune mechanism that correlates with protection for influenza infections. Microneutralization (MN) assays are often used to measure neutralizing antibody responses in human sera after influenza vaccination or infection. Madine Darby Canine Kidney (MDCK) cells are the commonly used cell substrate for MN assays. However, currently circulating 3C.2a and 3C.3a A(H3N2) influenza viruses have acquired altered receptor binding specificity. The MDCK-SIAT1 cell line with increased &#945;-2,6 sialic galactose moieties on the surface has proven to provide improved infectivity and more faithful replications than conventional MDCK cells for these contemporary A(H3N2) viruses. Here, we describe a MN assay using MDCK-SIAT1 cells that has been optimized to quantify neutralizing antibody titers to these contemporary A(H3N2) viruses. In this protocol, heat inactivated sera containing neutralizing antibodies are first serially diluted, then incubated with 100 TCID50/well of influenza A(H3N2) viruses to allow antibodies in the sera to bind to the viruses. MDCK-SIAT1 cells are then added to the virus-antibody mixture, and incubated for 18 - 20 h at 37 &#176;C, 5% CO2 to allow A(H3N2) viruses to infect MDCK-SIAT1 cells. After overnight incubation, plates are fixed and the amount of virus in each well is quantified by an enzyme-linked immunosorbent assay (ELISA) using anti-influenza A nucleoprotein (NP) monoclonal antibodies. Neutralizing antibody titer is defined as the reciprocal of the highest serum dilution that provides &#8805;50% inhibition of virus infectivity.

Measuring Influenza Neutralizing Antibody Responses to AH3N2 Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

Influenza neutralizing antibodies correlate with protection of influenza infections. Microneutralization assays measure neutralizing antibodies in human sera and are often used for influenza human serology. We describe a microneutralization assay using MDCK-SIAT1 cells to measure neutralizing antibody titers to contemporary 3C.2a and 3C.3a A(H3N2) viruses following influenza vaccination or infection.

Neutralizing antibodies against hemagglutinin (HA) of influenza viruses are considered the main immune mechanism that correlates with protection for ...

Production of High-Titer Infectious Influenza Pseudotyped Particles with Envelope Glycoproteins from Highly Pathogenic H5N1 and Avian H7N9 Viruses

The occasional direct transmission of the highly pathogenic avian influenza A virus H5N1 (HPAI H5N1) and H7N9 to humans and their lethality are serious public health issues and suggest the possibility of an epidemic. However, our molecular understanding of the virus is rudimentary, and it is necessary to study the biological properties of its envelope proteins as therapeutic targets and to develop strategies to control infection. We developed a solid viral pseudotyped particle (pp) platform to study avian influenza virus, including the functional analysis of its hemagglutinin (HA) and neuraminidase (NA) envelope glycoproteins, the reassortment characteristics of the HAs and NAs, receptors, tropisms, neutralizing antibodies, diagnosis, infectivity, for the purposes of drug development and vaccine design. Here, we describe an experimental procedure to establish pps with the envelope glycoproteins (HA, NA) from two influenza A strains (HAPI H5N1 and 2013 avian H7N9). Their generation is based on the capacity of some viruses, such as murine leukemia virus (MLV), to incorporate envelope glycoproteins into a pp. In addition, we also detail how these pps are quantified with RT-qPCR, and the infectivity detection of native and mismatched virus pps depending on the origin of the HAs and NAs. This system is highly flexible and adaptable and can be used to establish viral pps with envelope glycoproteins that can be incorporated in any other type of enveloped virus. Thus, this viral particle platform can be used to study wild viruses in many research investigations.

This protocol describes an experimental process to produce high-titer infectious viral pseudotyped particles (pp) with envelope glycoproteins from two influenza A strains and how to determine their infectivity. This protocol is highly adaptable to develop pps of any other type of enveloped viruses with different envelope glycoproteins.

The occasional direct transmission of the highly pathogenic avian influenza A virus H5N1 (HPAI H5N1) and H7N9 to humans and their lethality are serious ...

Quantifying Vaccine-Induced Neutralizing Antibodies in SARS-CoV-2 Variants

Application of Ha-CoV-2 Pseudovirus for Rapid Quantification of SARS-CoV-2 Variants and Neutralizing Antibodies

The coronavirus disease 2019 pandemic (COVID-19) has highlighted the need for rapid assays to accurately measure the infectivity of emerging SARS-CoV-2 variants and the effectiveness of vaccine-induced neutralizing antibodies against viral variants. These assays are essential for pandemic surveillance and validating vaccines and variant-specific boosters. This manuscript demonstrates the application of a novel hybrid alphavirus-SARS-CoV-2 pseudovirus (Ha-CoV-2) for quick quantification of SARS-CoV-2 variant infectivity and vaccine-induced neutralizing antibodies to viral variants. Ha-CoV-2 is a SARS-CoV-2 virus-like particle consisting of viral structural proteins (S, M, N, and E) and a fast-expressing RNA genome derived from an alphavirus, Semliki Forest Virus (SFV). Ha-CoV-2 also contains both green fluorescent protein (GFP) and luciferase reporter genes that allow for quick quantification of viral infectivity. As an example, the infectivity of the SARS-CoV-2 Delta (B.1.617.2) and the Omicron (B.1.1.529) variants are quantified, and their sensitivities to a neutralizing antibody (27VB) are also measured. These examples demonstrate the great potential of Ha-CoV-2 as a robust platform for rapid quantification of SARS-CoV-2 variants and their susceptibility to neutralizing antibodies.

Author Spotlight: A Pseudotype Virus System for Assessing Omicron Subvariants and Neutralizing Antibodies in SARS-CoV-2 Research

This protocol describes the application of a novel hybrid alphavirus-SARS-CoV-2 pseudovirus (Ha-CoV-2) as a platform for rapid quantification of infectivity of SARS-CoV-2 variants and their sensitivity to neutralizing antibodies.

The coronavirus disease 2019 pandemic (COVID-19) has highlighted the need for rapid assays to accurately measure the infectivity of emerging SARS-CoV-2 ...

Generation of Influenza Virus Escape Variants against Neutralizing Antibodies

Source: Leon, P. E., et al. <a href="https://app.jove.com/v/56067">Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies.</a> J. Vis. Exp. (2017).
This video demonstrates a technique for generating escape variants of neutralizing influenza virus monoclonal antibodies. Antibody-neutralized virus suspension is injected into embryonated chicken eggs to propagate escape variants selectively. This results in a virus population predominantly of escape variants, confirmed via a Hemagglutination assay.

NOTE: HA-specific antibodies that inhibit viral replication can generally be categorized into i) ones that bind on or adjacent of the receptor binding ...

JoVE Encyclopedia of Experiments

Immunology

Antibody-Based Technologies

Characterization and Functional Analysis

Generating  Recombinant Live-Attenuated Influenza Viruses for Vaccines

Source: P&#233;rez-Gir&#243;n, J. V. et al, <a href="https://app.jove.com/v/52803">Intranasal Administration of Recombinant Influenza Vaccines in Chimeric Mouse Models to Study Mucosal Immunity.</a>&#160;J. Vis. Exp. (2015)
The video showcases a method to create cold-adapted recombinant influenza viruses. It involves transfecting human cells with bi-directional plasmids, followed by incubation at lower temperature incubation to yield viruses suitable for vaccine production, characterized by reduced replication in warmer conditions.

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video