Bu proje kısmen Ulusal Enstitüsü alerji ve enfeksiyon hastalıkları gelen federal fonları ile finanse edilmiştir, Ulusal Sağlık enstitüleri, bölümü sağlık ve insan Hizmetleri, CEIRS altında HHSN272201400008C (F.K.) sözleşme; NIH U19AI109946-01 (F.K.); ve P01AI097092-04S1 (P.E.L.).

<ol>
	<li>Shaw, M. L., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Orthomyxoviridae: the viruses and their replication. , (2013).</li><li>Nelson, M. I., Holmes, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolution+of+epidemic+influenza.">The evolution of epidemic influenza.</a> Nat Rev Genet. 8 (3), 196-205 (2007).</li><li>Lauring, A. S., Andino, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quasispecies+Theory+and+the+Behavior+of+RNA+Viruses.">Quasispecies Theory and the Behavior of RNA Viruses.</a> PLoS Pathog. 6 (7), e1001005 (2010).</li><li>Henry Dunand, C. J., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preexisting+human+antibodies+neutralize+recently+emerged+H7N9+influenza+strains.">Preexisting human antibodies neutralize recently emerged H7N9 influenza strains.</a> J Clin Invest. 125 (3), 1255-1268 (2015).</li><li>Dunand, C. J. H., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Both+Neutralizing+and+Non-Neutralizing+Human+H7N9+Influenza+Vaccine-Induced+Monoclonal+Antibodies+Confer+Protection.">Both Neutralizing and Non-Neutralizing Human H7N9 Influenza Vaccine-Induced Monoclonal Antibodies Confer Protection.</a> Cell Host Microbe. 19 (6), 800-813 (2016).</li><li>Tan, G. S., Lee, P. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+Broadly+Neutralizing+Monoclonal+Antibody+That+Targets+the+Fusion+Domain+of+Group+2+Influenza+A+Virus+Hemagglutinin.">Characterization of a Broadly Neutralizing Monoclonal Antibody That Targets the Fusion Domain of Group 2 Influenza A Virus Hemagglutinin.</a> J Virol. 88 (23), 13580-13592 (2014).</li><li>Tan, G. S., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broadly-Reactive+Neutralizing+and+Non-neutralizing+Antibodies+Directed+against+the+H7+Influenza+Virus+Hemagglutinin+Reveal+Divergent+Mechanisms+of+Protection.">Broadly-Reactive Neutralizing and Non-neutralizing Antibodies Directed against the H7 Influenza Virus Hemagglutinin Reveal Divergent Mechanisms of Protection.</a> PLoS Pathog. 12 (4), e1005578 (2016).</li><li>Smith, K., Garman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+generation+of+fully+human+monoclonal+antibodies+specific+to+a+vaccinating+antigen.">Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen.</a> Nat Protoc. 4 (3), 372-384 (2009).</li><li>Steel, J., Lowen, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+virus+vaccine+based+on+the+conserved+hemagglutinin+stalk+domain.">Influenza virus vaccine based on the conserved hemagglutinin stalk domain.</a> mBio. 1 (1), (2010).</li><li>Krammer, F., Pica, N., Hai, R., Margine, I., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+hemagglutinin+influenza+virus+vaccine+constructs+elicit+broadly+protective+stalk-specific+antibodies.">Chimeric hemagglutinin influenza virus vaccine constructs elicit broadly protective stalk-specific antibodies.</a> J Virol. 87 (12), 6542-6550 (2013).</li><li>Wang, T. T., Tan, G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+a+synthetic+peptide+from+the+influenza+virus+hemagglutinin+provides+protection+against+distinct+viral+subtypes.">Vaccination with a synthetic peptide from the influenza virus hemagglutinin provides protection against distinct viral subtypes.</a> Proc Natl Acad Sci U S A. 107 (44), 18979-18984 (2010).</li><li>Impagliazzo, A., Milder, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stable+trimeric+influenza+hemagglutinin+stem+as+a+broadly+protective+immunogen.">A stable trimeric influenza hemagglutinin stem as a broadly protective immunogen.</a> Science. 349 (6254), 1301-1306 (2015).</li><li>Krammer, F., Palese, P., Steel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Universal+Influenza+Virus+Vaccine+Design+and+Antibody+Mediated+Therapies+Based+on+Conserved+Regions+of+the+Hemagglutinin.">Advances in Universal Influenza Virus Vaccine Design and Antibody Mediated Therapies Based on Conserved Regions of the Hemagglutinin.</a> Current Topics in Microbiology and Immunology. , (2014).</li><li>Wohlbold, T. J., Nachbagauer, R., Margine, I., Tan, G. S., Hirsh, A., Krammer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+soluble+headless+hemagglutinin+protects+mice+from+challenge+with+divergent+influenza+viruses.">Vaccination with soluble headless hemagglutinin protects mice from challenge with divergent influenza viruses.</a> Vaccine. 33 (29), 3314-3321 (2015).</li><li>Ekiert, D. C., Bhabha, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibody+recognition+of+a+highly+conserved+influenza+virus+epitope.">Antibody recognition of a highly conserved influenza virus epitope.</a> Science. 324 (5924), 246-251 (2009).</li><li>Ekiert, D. C., Friesen, R. H. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Highly+Conserved+Neutralizing+Epitope+on+Group+2+Influenza+A+Viruses.">A Highly Conserved Neutralizing Epitope on Group 2 Influenza A Viruses.</a> Science. 333 (6044), 843-850 (2011).</li><li>Dreyfus, C., Laursen, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Conserved+Protective+Epitopes+on+Influenza+B+Viruses.">Highly Conserved Protective Epitopes on Influenza B Viruses.</a> Science. 337 (6100), 1343-1348 (2012).</li><li>Tran, E. E. H., Podolsky, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-electron+Microscopy+Structures+of+Chimeric+Hemagglutinin+Displayed+on+a+Universal+Influenza+Vaccine+Candidate.">Cryo-electron Microscopy Structures of Chimeric Hemagglutinin Displayed on a Universal Influenza Vaccine Candidate.</a> mBio. 7 (2), e00257 (2016).</li><li>Wiley, D. C., Wilson, I. A., Skehel, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+identification+of+the+antibody-binding+sites+of+Hong+Kong+influenza+haemagglutinin+and+their+involvement+in+antigenic+variation.">Structural identification of the antibody-binding sites of Hong Kong influenza haemagglutinin and their involvement in antigenic variation.</a> Nature. 289 (5796), 373-378 (1981).</li><li>Gerhard, W., Yewdell, J., Frankel, M. E., Webster, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigenic+structure+of+influenza+virus+haemagglutinin+defined+by+hybridoma+antibodies.">Antigenic structure of influenza virus haemagglutinin defined by hybridoma antibodies.</a> Nature. 290 (5808), 713-717 (1981).</li><li>Jackson, D. C., Murray, J. M., White, D. O., Gerhard, W. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enumeration+of+antigenic+sites+of+influenza+virus+hemagglutinin.">Enumeration of antigenic sites of influenza virus hemagglutinin.</a> Infect Immun. 37 (3), 912-918 (1982).</li><li>Matsuzaki, Y., Sugawara, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitope+Mapping+of+the+Hemagglutinin+Molecule+of+A/(H1N1)pdm09+Influenza+Virus+by+Using+Monoclonal+Antibody+Escape+Mutants.">Epitope Mapping of the Hemagglutinin Molecule of A/(H1N1)pdm09 Influenza Virus by Using Monoclonal Antibody Escape Mutants.</a> J Virol. 88 (21), 12364-12373 (2014).</li><li>Tan, G. S., Krammer, F., Eggink, D., Kongchanagul, A., Moran, T. M., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pan-H1+anti-hemagglutinin+monoclonal+antibody+with+potent+broad-spectrum+efficacy+in+vivo.">A pan-H1 anti-hemagglutinin monoclonal antibody with potent broad-spectrum efficacy in vivo.</a> J Virol. 86 (11), 6179-6188 (2012).</li><li>Geneva: World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> WHO manual on animal influenza diagnosis and surveillance. , (2002).</li><li>Brauer, R., Chen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+Virus+Propagation+in+Embryonated+Chicken+Eggs.">Influenza Virus Propagation in Embryonated Chicken Eggs.</a> J Vis Exp. (97), e52421 (2015).</li><li>Mart&#237;nez-Sobrido, L., Garc&#237;a-Sastre, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+Recombinant+Influenza+Virus+from+Plasmid+DNA.">Generation of Recombinant Influenza Virus from Plasmid DNA.</a> J Vis Exp. (42), e2057 (2010).</li><li>Hoffmann, E., Stech, J., Guan, Y., Webster, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+primer+set+for+the+full-length+amplification+of+all+influenza+A+viruses.">Universal primer set for the full-length amplification of all influenza A viruses.</a> ArchVirol. 146 (12), 2275-2289 (2001).</li><li>Zhou, B., Lin, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+Influenza+B+Virus+Genomic+Amplification+Facilitates+Sequencing,+Diagnostics,+and+Reverse+Genetics.">Universal Influenza B Virus Genomic Amplification Facilitates Sequencing, Diagnostics, and Reverse Genetics.</a> J Clin Microbiol. 52 (5), 1330-1337 (2014).</li><li>Sidhu, S. S., Kossiakoff, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+and+designing+protein+function+with+restricted+diversity.">Exploring and designing protein function with restricted diversity.</a> Curr Opin Chem Biol. 11, 347-354 (2007).</li><li>Chen, C. -. W., Chang, C. -. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peptide+Scanning-assisted+Identification+of+a+Monoclonal+Antibody-recognized+Linear+B-cell+Epitope.">Peptide Scanning-assisted Identification of a Monoclonal Antibody-recognized Linear B-cell Epitope.</a> J Vis Exp. (121), e55417 (2017).</li></ol>

Yazarlar hiçbir çıkar çatışmaları bildirin.

Kaçış mutantların tespit artıkları çoğunluğu doğru olmasına rağmen bu yaklaşım önemli uyarılar nokta mutasyonlar kaçış versiyonlarının mutlaka moleküler ayak izi tarafından belirlenen antikor içinde eşleşmeyebilir ki biridir yapısal analiz. Bu konformasyon değişikliğine mutasyona uğramış kalıntı, allosteric efekti benzer konuma distal yeteneğini bir mutasyon belirli bir kalıntı, kaynaklanmaktadır. Bu yöntem yalnızca antikorları nötralize için uygulanabilir olduğunu başka bir kısıtlamadır; vitro seçici basınç eksikliği antikorlar mutantlar kaçmak için yol değil. Ancak, bu sınırlama bir panel tarafından daha önce karakterize nötralize antikorlar oluşturulan kaçış versiyonlarının kullanımı ile aşılabilir. Tan vd. H7N9 virüsü nötralize mAb bir kaçış türevi bir sigara nötralize antikor7epitope eşleştirmek için kullanılır.
Yine de, kaçış türevleri üretimi aracılığıyla antikorlar epitopları elucidating kristalografisi ve cryo-elektron mikroskobu, ikisi de ekipman geniş bir yatırım gerektiren bir alternatif sağlar. Alanin tarama veya peptid tarama/kesme mutantlar kullanarak mAbs en az bağlama bölgesinin belirlemek için diğer alternatifleri vardır. Mutagenesis tarama alanin peptid tarama doğrusal epitopları30ile sınırlı ise29, eleme sırasında çok sayıda değişik oluşturma çalışmalarında önemli miktarda gerektirebilir. Bu protokol için açıklanan yöntem hiçbir özel ekipman veya tekniği gerektirir ve hatta kaçış değişik-in ilgi antikorlar oluşturmak için değişikliğin varolan vitro nötralizasyon deneyleri kullanır.
İletişim kuralı için birden çok pasajlar (örneğin, SAP özel antikorlar) gerektiren üreten kaçış değişik yüksek antikor pasajda 0 başlangıç konsantrasyonu bağlıdır. Dikkatli yan tarafındaki err ve yarım günlük yarım maksimal inhibitör konsantrasyonu bir antikor düşük bir günlüğüne başında ve güçlü virüs büyümesi için izin vermek iyidir. Araştırmacı yüksek titresi virüs kültür düşük immünolojik basıncı varlığında viral topluluk içinde büyük bir genetik varyasyon olacak spekülasyon olabilir. Kaçış türevleri için aşağıdaki pasajlar antikor konsantrasyon yavaş yavaş artırarak seçilebilir. Önceki geçiş antikor konsantrasyon aynı miktarda koruyarak virüs büyüme azaltır olay bu viral süpernatant miktarı sonraki pasajda artırılabilir.
Evrensel grip aşıları çoğunluğu HA sapı bölgenin doğru sağlam antikor yanıtı temin için amaçtır. SAP özel antikorlar için kaçış versiyonlarının grip virüsü fitness ve immünolojik basıncı arasındaki ilişki tanımlamada önemli analizlerdir. İlginçtir, kaçış mutasyona uğramış virüs sapı özgü mAbs kaynaklanan tüm zayıflatılmış vivo içinde fare LD50 çalışmaları4' te edildi. Bu çalışmalar güçlü bir durumda aşı sapı tabanlı platformlar için sağlar. Ayrıca, bu protokol küçük molekül inhibitörleri gibi anti-yayılmacı diğer bileşikler için kaçış mutantların tanımlamak için kullanılabilir. Son olarak, bu metodoloji grip virüsü yüzey glikoproteinlerin için sınırlı değil, ama aynı zamanda daha çok diğer viral glikoproteinlerin epitopları belirlemek için uygulanabilir.

Benzer şekilde diğer RNA virüsleri, grip A virüs antijenik türevleri çok sayıda her yuvarlak çoğaltma1,2,3nesil için izin veren bir hataya polimeraz sahip. Bir virüs grip uyum ve ile antikor bağlama kaybına neden mutasyonlar yüzey glikoproteinlerin üzerinde bir birikimi yoluyla elde antijenik drift insan bağışıklık yanıtı kaçmasına hayret verici bir yeteneği var. Viral yüzey glikoproteinlerin, HA ve neuraminidase (NA), antijenik sürüklenme gerek reformulate ve aşı her yıl yönetmek gerektirir.
Teknolojik gelişmeler yalıtım ve antijen spesifik antikorların üretimi aşı indüklenen mAbs4,5,6,7,8sayısının yüksek vermiştir. Buna karşılık, geniş grip A virüsleri nötralize mAbs epitopları karakterizasyonu birkaç evrensel grip aşısı adayların9,10,11gelişimi büyük ölçüde destekli, 12,13,14. Antijenik ayak izi bir mAb elucidating nötralizasyon yapısal belirleyicileri ortaya çıkarır ve aşı tasarım bilinçli bir yaklaşım sağlar. Ancak, gerçekçi de yapısal olarak viral antijen15, epitopları eşlemek için mAbs x-ışını kristalografisi veya cryo-elektron mikroskobu aracılığıyla geniş panelleri ayırdetmek laboratuarlar için maliyet-etkin olmadığı 16 , 17 , 18.
X-ışını kristalografisi veya cryo-elektron mikroskobu pahalı donanımları, özel teknikler ve potansiyel olarak geniş bir veri oluşturmak için gereken saat miktarını gerektirir. Alternatif ve daha hızlı bir yaklaşım hataya RNA'ya bağımlı üzerinden çeşitli viral nüfus hızlı nesil kullanan RNA polimeraz epitopları mAbs19,20, belirlemek için kaçış mutantların oluşturmak için 21,22,23. Kaçış türevleri üretimi herhangi bir özel ekipman veya teknik gerektirmez ve geleneksel laboratuvar Kimyasalları ve ekipmanları ile gerçekleştirilebilir.
Burada, grip HA tanımak mAb bağlama için gerekli kritik artıkları eşleme için izin veren bir yöntem açıklanmaktadır.

<table border="0" cellpadding="0" cellspacing="0" width="1159">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Falcon 96-well clear flat bottom TC-treated culture microplate with Lid</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353072</td>
			<td style="width:429px;">Assay plate use for the microneutralization assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Falcon 96-well clear V-bottom plate</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353263</td>
			<td>Assay plate use for the hemagglutination inhibition assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">1X Minimal Essential Medium (MEM)</td>
			<td style="width:197px;">Gibco</td>
			<td align="right" style="width:119px;">11095080</td>
			<td>Infection medium</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;">Tosyl phenylalanyl chloromethyl (TPCK)-treated trypsin</td>
			<td>Sigma-Aldrich</td>
			<td style="width:119px;">T8802</td>
			<td>Cleaves immature HA0 to HA1 and HA2</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Biotinylated anti-NP primary antibody (IAV)</td>
			<td>EMD Millipore</td>
			<td style="width:119px;">MAB8258B</td>
			<td>An antibody that recognizes the NP protein of influenza A viruses</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Biotinylated anti-NP primary antibody (IBV)</td>
			<td style="width:197px;">EMD Millipore</td>
			<td style="width:119px;">MAB8260B-5</td>
			<td>An antibody that recognizes the NP protein of influenza B viruses</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Streptavidin-HRP antibody</td>
			<td>EMD Millipore</td>
			<td style="width:119px;">18-152</td>
			<td>This is used as a secondary antibody for the biotinylated anti-NP antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">HRP substrate (SIGMAFAST-OPD)</td>
			<td style="width:197px;">Sigma-Aldrich</td>
			<td style="width:119px;">P9187-5SET</td>
			<td>o-phenylenediamine dihydrochloride water soluble substrate for HRP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">96-well V-bottom plate</td>
			<td style="width:197px;">Nunc</td>
			<td align="right" style="width:119px;">249662</td>
			<td>Assay plate used for the hemagglutination assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Chicken red blood cells</td>
			<td>Lampire Biological Laboratories</td>
			<td align="right" style="width:119px;">7201403</td>
			<td>Used to assess the ability of influenza virus to agglutinate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">TRIzol</td>
			<td style="width:197px;">Ambion</td>
			<td align="right" style="width:119px;">15596026</td>
			<td>Extraction of RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Superscript III</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">12574018</td>
			<td>Reverse transcriptase</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Gel Extraction Kit</td>
			<td style="width:197px;">Qiagen</td>
			<td align="right" style="width:119px;">28704</td>
			<td>Isolation of amplified PCR product</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Lipofectamine 2000</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">11668027</td>
			<td>Transfection reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Anti-human IgG (H+L) Alexa Fluor 488</td>
			<td style="width:197px;">Invitrogen</td>
			<td style="width:119px;">A-11013</td>
			<td>Fluorescent secondary antibody for human antibodies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Anti-mouse IgG (H+L) Alexa Fluor 488</td>
			<td style="width:197px;">Invitrogen</td>
			<td style="width:119px;">A-11001</td>
			<td>Fluorescent secondary antibody for murine antibodies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">6-well polystyrene microplate</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353934</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">UltraPure Agarose</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">16500500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Nalgene long term storage Cryo-tubes</td>
			<td style="width:197px;">ThermoFisher Scientific</td>
			<td style="width:119px;">5012-0020</td>
			<td>Freezing of viral culture supernatant</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">reassortant A/California/04/09 (H1)</td>
			<td style="width:197px;">Palese Laboratory</td>
			<td style="width:119px;"></td>
			<td>reassortant virus expressing the HA and NA of A/California/04/09 (H1N1) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">reassortant A/Shanghai/1/13 (H7)</td>
			<td style="width:197px;">Palese Laboratory</td>
			<td style="width:119px;"></td>
			<td>reassortant virus expressing the HA and NA of A/Shanghai/1/13 (H7N9) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Bovine serum albumin solution (35%)</td>
			<td style="width:197px;">Sigma-Aldrich</td>
			<td style="width:119px;">A7979</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Qiagen gel extration kit</td>
			<td style="width:197px;">Qiagen</td>
			<td align="right" style="width:119px;">28704</td>
			<td>Silica-membrane-based purification of DNA fragments</td>
		</tr>
	</tbody>
</table>

generation of escape variants of neutralizing influenza virus monoclonal antibodies

Grip virüsleri uyum ve konak immün yanıt kaçmasına görmeyeteneği sergi. Virüsü yüzey glikoproteinlerin üzerinde antijenik yapılan değişiklikler aracılığıyla bir yoludur. Kaçış türevleri üretimi nasıl virüs bağışıklık algılama kaçış elucidating ve antikor bağlama için gerekli kritik artıkları belirlenmesinde güçlü bir yöntemdir. Burada, bir protokol nasıl grip A virüs kaçış türevleri viral hemagglutinin (HA) karşı yönettiği insan veya fare monoklonal antikorlar (mAbs) kullanarak oluşturmak açıklar. Bizim tekniğin kullanımı ile daha önce iki kafa veya roman kuş H7N9 HA SAP hedefleme antikorlar bağlama için gerekli kritik artıkları ile karakterizedir. İletişim kuralı diğer virüs sistemleri için kolayca adapte edilebilir. Analizleri kaçış versiyonlarının antijenik drift tek nükleotid polimorfizmleri (SNPs) conferring direnci ve virüs sağlık, belirlerken, modelleme ve aşılar ve/veya tedavi tasarımı önemlidir.

Biz daha önce kaçış türevleri için insan ve fare mAbs mevsimsel grip virüsü aşısı, H7N9 aşı veya sıralı DNA/rekombinant HA protein aşı4,5 tarafından indüklenen oluşturmak için bu yöntemi varyasyonları kullandık ,6,7. Yukarıda açıklandığı gibi antikorlar ilk bize sonraki4,5ile devam etmek için belirli hangi protokolü hakkında bilgilendirmek için HI ve microneutralization deneyleri kullanarak karakterize. Antikorlar 07-5D 03, 07-5F01, 07-5G 01, 07-4B03, 07-4E02 ve 07-4D 05 HI ve nötralizasyon kuş H7N9 virüs (A/Shanghai/1/2013) (Tablo 1) karşı olan bulunmuştur ve böylece Protokolü 1 (Adım 2.1) kullanılmıştır. MAbs etkisiz hale güvenmiyorlarsa 41-5E04, 045-051310-2B06, 042-100809-2F04 ve S6-B01 (Tablo 1), gibi HI aktivite ile Protokolü 2 (Adım 2.2) kaçış türevlerini oluşturmak için kullanılmıştır. Kaçış mutant eşleme antikorlar birçoğu viral HA4,5 (şekil 4) farklı yerlerde kritik artıkları tanımak ortaya koydu. Var HI-pozitif antikorlar çoğunluğu kaçış iken, H7 HA daha önce raporlanmış antijenik sitelere yakın mutant artıkları, HI-negatif antikorlar sapı bölge4' te,5 kaçış mutantların nokta mutasyonları ile oluşturulan .
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antikor</td>
			<td>Merhaba etkinliği</td>
			<td>NEUT aktivite</td>
		</tr>
		<tr>
			<td>07-5D 03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5F01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5G 01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4B03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4E02</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4D 05</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>41-5E04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>045-051310-2B06</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>042-100809-2F04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>S6-B01</td>
			<td>-</td>
			<td>+</td>
		</tr>
	</tbody>
</table>
Tablo 1: Antikor HI ve nötralizasyon etkinlik tablosunun. On H7 özel mAbs ile deneysel bir H7N9 aşı aşı bireyler izole farklı vitro antiviral faaliyetleri5sergi.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td colspan="4">İleri astar (5'-3')</td>
			<td colspan="4">Astar (5'-3') ters</td>
			<td colspan="2">Thermocylcer koşulları</td>
		</tr>
		<tr>
			<td>IAV</td>
			<td colspan="4">TATTCGTCTCAGGGAGCAAAAGCAGGGG</td>
			<td colspan="4">ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT</td>
			<td colspan="2">60 dk 42 ºC, 94 ° C'nin 2 dk/5 döngüsü için 20 94 ° C'nin s, 30 50 ºC s ve 3 dk 30 sn için 68 ° C'nin 40 devredir 20 94 ºC takiben s, 30 58 ° C'nin s ve 3 dk 30 sn ile 68 ºC 10 min için bir son uzantısı saat için 68 ºC</td>
		</tr>
		<tr>
			<td>IBV</td>
			<td colspan="4">GGGGGGAGCAGAAGCAGAGC</td>
			<td colspan="4">CCGGGTTATTAGTAGTAACAAGAGC</td>
			<td colspan="2">60 dk, 30 dk 55 ºC, 94 ° C'nin 2 dk/5 döngüsü için 20 94 ° C'nin 45 ºC s, 30 40 ºC 40 devredir 20 94 ºC tarafından takip için 3 dk 30 sn, 68 ºC ve s s , 30 58 ° C'nin s ve 3 dk 30 sn ile 68 ºC 10 min için bir son uzantısı saat için 68 ºC</td>
		</tr>
	</tbody>
</table>
Tablo 2: evrensel grip virüsü astar. Grip A27 ve B28 virüsleri ve onların anılan sıraya göre thermocycler koşulları astar çift HA kesimleri amplifikasyon için.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56067/56067fig1.jpg"> 
Şekil 1: HI tahlil. (A) A şematik bir HI tahlil kurmak iki fare H1 özgü mAbs 7B2 (kafa özgü) ve 6F12 (SAP-özel bir 96-şey V-alt plaka ve (B) bir HI tahlil23sonuçlarını örneği kullanarak) etkinliğini test etmek için. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56067/56067fig2.jpg"> 
Resim 2: Microneutralization tahlil. İki insan mAbs 4 d 055 ve CR911417etkinliğini test etmek bir microneutralization tahlil ayarlamak için bir şema. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56067/56067fig3.jpg"> 
Şekil 3: üretimi kaçış mutantların. Önerilen metodoloji HI ve antikor tarafından sergilenen microneutralization aktivite bağımlı olacaktır. (B) nötralize HI-negatif antikor antikor miktarlarda artan ile birden çok pasajlar içerebilir(a)karşı kaçış mutantların üretimi nötralize HI-pozitif antikorlar yumurta, tek bir pasajda gerektirir hücre doku kültürü. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig3large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56067/56067fig4.jpg"> 
Şekil 4: bir epitope Haritası roman kuş H7N9 kaçış mutant türevleri ile oluşturulan HA örneği. Aşı indüklenen antikorlar H7N9 grip aşı kaçış mutant varyantlarını oluşturmak için kullanılan bir aday ile aşı bireyler izole. Her kalıntı kırmızı temsil kritik amino asitler bir mAb verimli bağlama için gerekli konumunu belirtti. Veri Dunand-Henry ve ark., 20154adapte edildi. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig4large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>

Watch this Scientific Journal Video about Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies at JoVE.com

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Biz bir yöntem tarafından grip A virüs viral hemagglutinin hedef insan veya fare monoklonal antikorlar bağlama için gerekli kritik artıkları tanımlamak açıklar. İletişim kuralı diğer virüs yüzey glikoproteinlerin ve onların karşılık gelen nötralize antikorlar için adapte edilebilir.

Grip virüsü monoklonal antikorları nötralize kaçış türevleri üretimi

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

generation-escape-variants-neutralizing-influenza-virus-monoclonal

Research

JoVE Journal

Immunology and Infection

11.6K Görüntüleme.  Icahn School of Medicine at Mount Sinai. Biz bir yöntem tarafından grip A virüs viral hemagglutinin hedef insan veya fare monoklonal antikorlar bağlama için gerekli kritik artıkları tanımlamak açıklar. İletişim kuralı diğer virüs yüzey glikoproteinlerin ve onların karşılık gelen nötralize antikorlar için adapte edilebilir.

Video: Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contribution of specific mutations in viral proteins in viral replication and/or pathogenesis and, also, viral vectors using recombinant influenza viruses expressing foreign proteins 3.

Rescue of influenza A viruses from plasmid DNA is a basic and essential experimental technique that allows influenza researchers to generate recombinant viruses to study multiple aspects in the biology of influenza virus, and to be used as potential vectors or vaccines.

Plazmid DNA Rekombinant Grip Virüsü Üretimi

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

İmmünoloji ve Enfeksiyon

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

Virüs mutasyon Frekans RNA Virüsler ve Karakterizasyonu Fidelity Varyantlar izolasyonu

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

High-throughput Detection Method for Influenza Virus

Influenza virus is a respiratory pathogen that causes a high degree of morbidity and mortality every year in multiple parts of the world. Therefore, precise diagnosis of the infecting strain and rapid high-throughput screening of vast numbers of clinical samples is paramount to control the spread of pandemic infections. Current clinical diagnoses of influenza infections are based on serologic testing, polymerase chain reaction, direct specimen immunofluorescence and cell culture 1,2.
Here, we report the development of a novel diagnostic technique used to detect live influenza viruses. We used the mouse-adapted human A/PR/8/34 (PR8, H1N1) virus 3 to test the efficacy of this technique using MDCK cells 4. MDCK cells (104 or 5 x 103 per well) were cultured in 96- or 384-well plates, infected with PR8 and viral proteins were detected using anti-M2 followed by an IR dye-conjugated secondary antibody. M2 5 and hemagglutinin 1 are two major marker proteins used in many different diagnostic assays. Employing IR-dye-conjugated secondary antibodies minimized the autofluorescence associated with other fluorescent dyes. The use of anti-M2 antibody allowed us to use the antigen-specific fluorescence intensity as a direct metric of viral quantity. To enumerate the fluorescence intensity, we used the LI-COR Odyssey-based IR scanner. This system uses two channel laser-based IR detections to identify fluorophores and differentiate them from background noise. The first channel excites at 680 nm and emits at 700 nm to help quantify the background. The second channel detects fluorophores that excite at 780 nm and emit at 800 nm. Scanning of PR8-infected MDCK cells in the IR scanner indicated a viral titer-dependent bright fluorescence. A positive correlation of fluorescence intensity to virus titer starting from 102-105 PFU could be consistently observed. Minimal but detectable positivity consistently seen with 102-103 PFU PR8 viral titers demonstrated the high sensitivity of the near-IR dyes. The signal-to-noise ratio was determined by comparing the mock-infected or isotype antibody-treated MDCK cells.
Using the fluorescence intensities from 96- or 384-well plate formats, we constructed standard titration curves. In these calculations, the first variable is the viral titer while the second variable is the fluorescence intensity. Therefore, we used the exponential distribution to generate a curve-fit to determine the polynomial relationship between the viral titers and fluorescence intensities. Collectively, we conclude that IR dye-based protein detection system can help diagnose infecting viral strains and precisely enumerate the titer of the infecting pathogens.

This method describes the use of Infrared dye based imaging system for detection of H1N1 in bronchioalveolar lavage (BAL) fluid of infected mice at a high sensitivity. This methodology can be performed in a 96- or 384-well plate, requires &lt;10 &mu;l volume of test material and has the potential for concurrent screening of multiple pathogens.

Gribi için yüksek verimlilik Tespit Yöntemi

Influenza virus is a respiratory pathogen that causes a high degree of morbidity and mortality every year in multiple parts of the world. Therefore, ...

Influenza Virus Propagation in Embryonated Chicken Eggs

Influenza infection is associated with about 36,000 deaths and more than 200,000 hospitalizations every year in the United States. The continuous emergence of new influenza virus strains due to mutation and re-assortment complicates the control of the virus and necessitates the permanent development of novel drugs and vaccines. The laboratory-based study of influenza requires a reliable and cost-effective method for the propagation of the virus. Here, a comprehensive protocol is provided for influenza A virus propagation in fertile chicken eggs, which consistently yields high titer viral stocks. In brief, serum pathogen-free (SPF) fertilized chicken eggs are incubated at 37 &#176;C and 55-60% humidity for 10 &#8211; 11 days. Over this period, embryo development can be easily monitored using an egg candler. Virus inoculation is carried out by injection of virus stock into the allantoic cavity using a needle. After 2 days of incubation at 37 &#176;C, the eggs are chilled for at least 4 hr at 4 &#176;C. The eggshell above the air sac and the chorioallantoic membrane are then carefully opened, and the allantoic fluid containing the virus is harvested. The fluid is cleared from debris by centrifugation, aliquoted and transferred to -80 &#176;C for long-term storage. The large amount (5-10 ml of virus-containing fluid per egg) and high virus titer which is usually achieved with this protocol has made the usage of eggs for virus preparation our favorable method, in particular for in vitro studies which require large quantities of virus in which high dosages of the same virus stock are needed.

Fertile chicken eggs are widely used to produce large amounts of human influenza A virus as they provide a convenient and cost-effective system to prove high yields of virus.

Embriyone Tavuk Yumurta Grip Virüsü Yayılım

Influenza infection is associated with about 36,000 deaths and more than 200,000 hospitalizations every year in the United States. The continuous ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, including the development of immunotherapeutics. However, the techniques to identify and produce such antibodies tend to be arduous and sometimes the heavy and light chain pair of the antibodies are dissociated. Here, we describe a relatively simple, straightforward protocol to produce human recombinant monoclonal antibodies from human peripheral blood mononuclear cells using immortalization with Epstein-Barr Virus (EBV) and Toll-like receptor 9 activation. With an adequate staining, B cells producing antibodies can be isolated for subsequent immortalization and clonal expansion. The antibody transcripts produced by the immortalized B cell clones can be amplified by PCR, sequenced as corresponding heavy and light chain pairs and cloned into immunoglobulin expression vectors. The antibodies obtained with this technique can be powerful tools to study relevant human immune responses, including autoimmunity, and create the basis for new therapeutics.

Synthesis of human monoclonal antibodies is the first step in studies aimed at unraveling the pathophysiological mechanisms of auto-antibody-mediated immune responses. We have developed a protocol to generate recombinant human immunoglobulin G (IgG) monoclonal antibodies from blood sorted B cells, including B-cell isolation, antibody cloning and in vitro synthesis.

Ölümsüzleştirilmiştir Sıralama B hücrelerinden Rekombinant İnsan IgG Monoklonal Antikorlarının Üretimi

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding molecules is time-consuming and laborious due to the complicated handling and lack of alternatives. The aim of this protocol is to provide one standard method for the generation of monoclonal antibodies using hybridoma technology. This technology combines two steps. Step 1 is an appropriate immunization of the animal and step 2 is the fusion of B lymphocytes with immortal myeloma cells in order to generate hybrids possessing both parental functions, such as the production of antibody molecules and immortality. The generated hybridoma cells were then recloned and diluted to obtain stable monoclonal cell cultures secreting the desired monoclonal antibody in the culture supernatant. The supernatants were tested in enzyme-linked immunosorbent assays (ELISA) for antigen specificity. After the selection of appropriate cell clones, the cells were transferred to mass cultivation in order to produce the desired antibody molecule in large amounts. The purification of the antibodies is routinely performed by affinity chromatography. After purification, the antibody molecule can be characterized and validated for the final test application. The whole process takes 8 to 12 months of development, and there is a high risk that the antibody will not work in the desired test system.

An optimized protocol is presented for the generation of monoclonal antibodies based on the hybridoma technology. Mice were immunized with an immunoconjugate. Spleen cells were fused by PEG and an electric impulse with immortal myeloma cells. Antibody-producing hybridoma cells were selected by HAT and antigen-specific ELISA screening.

Hibridoma teknolojisi ile murin monoklonal antikorlar üretilmesi

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding ...

Influenza A Virus Studies in a Mouse Model of Infection

Influenza viruses cause over 500,000 deaths worldwide1 and are associated with an annual cost of 12 - 14 billion USD in the United States alone considering direct medical and hospitalization expenses and work absenteeism2. Animal models are crucial in Influenza A virus (IAV) studies to evaluate viral pathogenesis, host-pathogen interactions, immune responses, and the efficacy of current and/or novel vaccine approaches as well as antivirals. Mice are an advantageous small animal model because their immune system is evolutionarily similar to that found in humans, they are available from commercial vendors as genetically identical subjects, there are multiple strains that can be exploited to evaluate the genetic basis of infections, and they are relatively inexpensive and easy to manipulate. To recapitulate IAV infection in humans via the airways, mice are first anesthetized prior to intranasal inoculation with infectious IAVs under proper biosafety containment. After infection, the pathogenesis of IAVs is determined by monitoring daily the morbidity (body weight loss) and mortality (survival) rate. In addition, viral pathogenesis can also be evaluated by assessing virus replication in the upper (nasal mucosa) or lower (lungs) respiratory tract of infected mice. Humoral responses upon IAV infection can be rapidly evaluated by non-invasive bleeding and secondary antibody detection assays aimed at detecting the presence of total or neutralizing antibodies. Here, we describe the common methods used to infect mice intranasally (i.n) with IAV and evaluate pathogenesis, humoral immune responses and protection efficacy.

Influenza A viruses (IAVs) are important human respiratory pathogens. To understand the pathogenicity of IAVs and to perform preclinical testing of novel vaccine approaches, animal models mimicking human physiology are required. Here, we describe techniques to evaluate IAV pathogenesis, humoral responses and vaccine efficacy using a mouse model of infection.

Grip A virüs enfeksiyonu bir fare modeli çalışmalarda

Influenza viruses cause over 500,000 deaths worldwide1 and are associated with an annual cost of 12 - 14 billion USD in the United States alone ...

Measuring Influenza Neutralizing Antibody Responses to A(H3N2) Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

Neutralizing antibodies against hemagglutinin (HA) of influenza viruses are considered the main immune mechanism that correlates with protection for influenza infections. Microneutralization (MN) assays are often used to measure neutralizing antibody responses in human sera after influenza vaccination or infection. Madine Darby Canine Kidney (MDCK) cells are the commonly used cell substrate for MN assays. However, currently circulating 3C.2a and 3C.3a A(H3N2) influenza viruses have acquired altered receptor binding specificity. The MDCK-SIAT1 cell line with increased &#945;-2,6 sialic galactose moieties on the surface has proven to provide improved infectivity and more faithful replications than conventional MDCK cells for these contemporary A(H3N2) viruses. Here, we describe a MN assay using MDCK-SIAT1 cells that has been optimized to quantify neutralizing antibody titers to these contemporary A(H3N2) viruses. In this protocol, heat inactivated sera containing neutralizing antibodies are first serially diluted, then incubated with 100 TCID50/well of influenza A(H3N2) viruses to allow antibodies in the sera to bind to the viruses. MDCK-SIAT1 cells are then added to the virus-antibody mixture, and incubated for 18 - 20 h at 37 &#176;C, 5% CO2 to allow A(H3N2) viruses to infect MDCK-SIAT1 cells. After overnight incubation, plates are fixed and the amount of virus in each well is quantified by an enzyme-linked immunosorbent assay (ELISA) using anti-influenza A nucleoprotein (NP) monoclonal antibodies. Neutralizing antibody titer is defined as the reciprocal of the highest serum dilution that provides &#8805;50% inhibition of virus infectivity.

Measuring Influenza Neutralizing Antibody Responses to AH3N2 Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

Influenza neutralizing antibodies correlate with protection of influenza infections. Microneutralization assays measure neutralizing antibodies in human sera and are often used for influenza human serology. We describe a microneutralization assay using MDCK-SIAT1 cells to measure neutralizing antibody titers to contemporary 3C.2a and 3C.3a A(H3N2) viruses following influenza vaccination or infection.

MDCK-SIAT1 hücreleri kullanarak antikor yanıt için Microneutralization tarafından insan Sera A(H3N2) virüsleri nötralize grip ölçme deneyi

Neutralizing antibodies against hemagglutinin (HA) of influenza viruses are considered the main immune mechanism that correlates with protection for ...

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the antibody needs to distinguish between highly related structures (e.g., a normal protein and a mutated version thereof). The current way of generating such discriminative mAbs involves extensive screening of multiple Ab-producing B cells, which is both costly and time consuming. We propose here a rapid and cost-effective method for the generation of discriminative, fully human mAbs starting from human blood circulating B lymphocytes. The originality of this strategy is due to the selection of specific antigen binding B cells combined with the counter-selection of all other cells, using readily available Peripheral Blood Mononuclear Cells (PBMC). Once specific B cells are isolated, cDNA (complementary deoxyribonucleic acid) sequences coding for the corresponding mAb are obtained using single cell Reverse Transcription-Polymerase Chain Reaction (RT-PCR) technology and subsequently expressed in human cells. Within as little as 1 month, it is possible to produce milligrams of highly discriminative human mAbs directed against virtually any desired antigen naturally detected by the B cell repertoire.

We describe a method for the production of human antibodies specific for an antigen of interest, starting from rare B cells circulating in human blood. Generation of these natural antibodies is efficient and rapid, and the antibodies obtained can discriminate between highly related antigens.

Kanda dolaşan nadir antijen spesifik B hücreleri Discriminative insan monoklonal antikorların üretimi

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the ...

Generation of Monoclonal Antibodies Against Natural Products

The analysis of the bioactive components present in foods and natural products has become a popular area of study in many fields, including traditional Chinese medicine and food safety/toxicology. Many of the classical analysis techniques require expensive equipment and/or expertise. Notably, enzyme-linked immunosorbent assays (ELISAs) have become an emerging method for the analysis of foods and natural products. This method is based on antibody-mediated detection of the target components. However, as many of the bioactive components in natural products are small (&lt;1,000 Da) and do not induce an immune response, creating monoclonal antibodies (mAbs) against them is often difficult. In this protocol, we provide a detailed explanation of the steps required to generate mAbs against target molecules as well as those needed to create the associated indirect competitive (ic)ELISA for the rapid analysis of the compound in multiple samples. The procedure describes the synthesis of the artificial antigen (i.e., the hapten-carrier conjugate), immunization, cell fusion, monoclonal hybridoma preparation, characterization of the mAb, and the ELISA-based application of the mAb. The hapten-carrier conjugate was synthesized by the sodium periodate method and evaluated by MALDI-TOF-MS. After immunization, splenocytes were isolated from the immunized mouse with the highest antibody titer and fused with the hypoxanthine-aminopterin-thymidine (HAT)-sensitive mouse myeloma cell line Sp2/0 -Ag14 using a polyethylene glycol (PEG)-based method. The hybridomas secreting mAbs reactive to the target antigen were screened by icELISA for specificity and cross-reactivity. Furthermore, the limiting dilution method was applied to prepare monoclonal hybridomas. The final mAbs were further characterized by icELISA and then utilized in an ELISA-based application for the rapid and convenient detection of the example hapten (naringin (NAR)) in natural products.

This article provides a detailed protocol for the preparation and evaluation of monoclonal antibodies against natural products for use in various immunoassays. This procedure includes immunization, cell fusion, indirect competitive ELISA for positive clone screening, and monoclonal hybridoma preparation. The specifications for antibody characterization using MALDI-TOF-MS and ELISA analyses are also provided.

Doğal ürünler karşı monoklonal antikorların üretimi

The analysis of the bioactive components present in foods and natural products has become a popular area of study in many fields, including traditional ...