The authors acknowledge financial support from the National Key Research and Development Program of China (2016YFC1200500 to Xiao-Guang Chen), the National Natural Science Foundation of China (81672054 and 81371846), the Research Team Programme of the Natural Science Foundation of Guangdong (2014A030312016), and the Scientific and Technological Programme of Guangzhou (201508020263). We gratefully acknowledge Professor Jonathan Carlson (Colorado State University) for kindly providing the pUCA and p7NS1-GFP plasmids and for critically reading this manuscript.

All protocols were approved by the Ethical Committee of Southern Medical University.
1. Designing an Artificial Intron
NOTE: The artificial intron used in this work is 65 bp in length, and the sequence is 5&#39;-GTAAGAGTCGATCGACGCGTTACTAACTGGTACCTCTTCTTTTTTTTTTGATATCCTGCAG-3&#39;.
<ol>
	<li>Place the HpaI restriction site on both ends of artificial intron so that HpaI digestion can release the intron from plasmids (see Figure 1A).</li>
	<li>Place the two XbaI restriction sites in the intron so that XbaI digestion can be used to insert small-RNA expression sequences.</li>
	<li>Order the chemical synthesis of full-length DNA sequences of the artificial intron from a DNA manufacturer. The synthetic DNA created is from cloning into a standard pUC19 plasmid. 
	NOTE: The essential components of the artificial intron include several consensus nucleotide elements, including a 5&#39; donor splice site (DS) with the sequence GUAAGAGU, a conserved branch-point sequence (BPS) with the sequence UACUAAC, a poly-pyrimidine tract (PPT) with the sequence UCUUC(U)10, and a 3&#39;-acceptor splice site (AS) with the sequence GAUAUCCUGCAG (Figure 1A). Two XbaI restriction sites were introduced between the DS and BPS that can be used to insert small-RNA expression sequences. The ability to effectively splice this artificial intron from mammalian and mosquito cells has been previously confirmed14.</li>
</ol>
2. Designing an Artificial Intronic Small RNA Expression Cassette
NOTE: For overexpression or knockdown of endogenous miRNA, sequences encoding precursor miRNA or a miRNA sponge were inserted between the DS and BPS. To serve as an example, an endogenous precursor miRNA from Ae. albopictus aal-let-7 was selected to construct recombinant viral vectors for miRNA overexpression and knockdown. An anti-let-7 sponge was designed according to previously described methods15. To knock down target genes in larvae, we designed specific artificial miRNA (amiRNA) or short hairpin RNA (shRNA) sequences using online software16,17; to serve as an example, V-ATPase subunit A mRNA (accession no. AY864912) was selected as a target gene in this study. The amiRNA will be referred to as amiVTP hereafter. All the sequences details of pre-miRNA, sponge, amiRNA, and shRNA are described in Supplemental Table 1.
<ol>
	<li>Order the chemical synthesis of full-length cDNA sequences of the precursor miRNAs, miRNA sponges, and shRNA with XbaI restriction sites on both ends from a DNA manufacturer.</li>
	<li>After receiving the ordered DNA, spin the tubes containing DNA blocks at 10,000-14,000 x g for 1 min to ensure that all dried DNA is at the bottom of the tube.</li>
	<li>Resuspend the dried DNA in DNase-free water to achieve a final concentration of 10 ng/&#181;L.</li>
	<li>Digest the plasmid backbone and DNA sequences with XbaI at 37 &#176;C for 1 h, and then dephosphorylate the 5&#39; ends of the linearized plasmid backbone with calf intestinal alkaline phosphatase (CIAP) according to the manufacturer&#39;s protocol.</li>
	<li>Inactivate CIAP by heating for 60 min at 65 &#176;C.</li>
	<li>Run a 1.0% agarose gel and cut the linearized backbone. Then extract the DNA from the gel slice using a gel extraction kit following the manufacturer&#39;s instructions.</li>
	<li>Ligate the DNA fragment into the backboneby T4 DNA ligase (5 U/&#181;L) at 22 &#176;C for 1 h.</li>
	<li>Transform the products of the ligation reaction from step 2.7 into competent Escherichia coli (E. coli) cells and plate on a Lysogeny Broth (LB) agar plate containing Ampicillin (at a concentration of 100 &#181;g/mL).
	<ol>
		<li>Perform the transformation through a heat shock method18, and use the appropriate E. coli strain. For example, use E. coli strain DH5&#945; for heat shock transformation.</li>
	</ol>
	</li>
	<li>Pick a single colony from step 2.8 and incubate in a culture of 3 mL enriched medium containing Ampicillin (at a concentration of 100 &#181;g/mL).</li>
	<li>Extract the plasmid DNA from the bacterial culture using a mini-prep kit following the manufacturer&#39;s instructions. Send the sample to a DNA sequencing company. 
	NOTE: For overexpression or knockdown of endogenous miRNA, the sequences encoding precursor miRNA or a miRNA sponge were inserted between the two XbaI sites. All miRNA expression or sponge constructs must be shorter than 400 bp (10% of the viral genome length) due to the packaging limit of the virus19.</li>
</ol>
3. Generating a rAeaDV Construct by Cloning a miRNA or shRNA Expression Cassette into a Plasmid Backbone
NOTE: pUCA, an infectious clone consisting of a pUCA plasmid containing the AaeDV genome (3,981 nt)19, was kindly provided by Prof. Jonathan Carlson and has been previously described in detail11. p7NS1-DsRed expresses a non-structural protein 1 (NS1)-red fluorescent protein (DsRed) fusion protein from the p7 promoter and has been described in detail elsewhere14. A human-specific miR-941-1 precursor20 and its sponge, a scrambled shRNA (CGACGACTATCGTGCAATTTCAAGAG AATTGCACGATAGTCGTCG), were also subcloned into AaeDV as a negative control.
<ol>
	<li>Ligate the pre-miRNA, sponge, shRNA or an amiVTP expression cassette into the HpaI site of the AaeDV NS1-coding region in the pUCA plasmid backbone as described in the protocol step 2.4 to 2.7.</li>
	<li>Transform the DNA into Stbl3 competent E. coli cells and select a positive clone as described in step 2.8 to 2.10.</li>
	<li>Following this, extract the rAaeDV plasmid from the bacterial cells using a maxi prep kit following the manufacturer&#39;s instructions. 
	NOTE: Stbl3 or Stbl4 E. coli cells should be utilized for rAaeDV DNA transformation to minimize undesired ITR recombination. A maxi prep should be used to extract the rAaeDV plasmid to obtain a large quantity of DNA (&#62;100 &#181;g). Before generating the virus, the sequence integrity of the rAaeDV plasmid should always be analyzed by DNA sequencing21.</li>
</ol>
4. Transfecting C6/36 Cells with rAaeDV Plasmids
<ol>
	<li>Culture C6/36 cells in Roswell Park Memorial Institute (RPMI) 1640 medium containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin in a 28 &#176;C incubator.</li>
	<li>On day 0, plate the cells in ten 25 cm2 culture flasks 18-20 h before transfection by splitting 90-95% confluent cells in a 1:2 dilution. 
	NOTE: By day 1, the cells should reach 90-95% confluence.</li>
	<li>On day 1, transfect the cells with the series of rAaeDV plasmids22.
	<ol>
		<li>Dilute 10 &#181;g DNA in 600 &#181;L of RPMI-1640 medium in a microcentrifuge tube and mix gently. Meanwhile, prepare 600 &#181;L of RPMI-1640 medium and 25 &#181;L of transfection reagent per transfection.</li>
		<li>Incubate for 5-10 min at room temperature (RT). Then, add 625 &#181;L of the 1640- transfection reagent mixture to the 1640-plasmid DNA mixture.</li>
		<li>Incubate this mixture for 20-30 min at RT. Before transfection, wash the cells twice with 2 mL of RPMI-1640 medium.</li>
		<li>After the RT incubation (step 4.3.3), add the1640-transfection reagent DNA plasmid mixture to the 25 cm2 culture flask and incubate for 6 h at 28 &#176;C.</li>
		<li>At approximately 6 h post-transfection, remove the transfection media, wash the cells twice with 5 mL of RPMI-1640 medium, and then add RPMI-1640 medium with 10% FBS. 
		NOTE: rAaeDV shows high rates of infection (95%) in Ae. albopictus larvae; however, in our experience, in nearly 50% of infected larvae, the infection was restricted to primary infection sites (e.g., anal papillae and bristle cells) without dissemination23. Therefore, if there is a need to infect larvae in multiple tissues, a defective recombinant virus expressing fluorescent protein should be co-infected to enable the visualization of infection sites. For example, to produce defective recombinant virus expressing DsRed, p7NS1-DsRed should be co-transfected with a helper plasmid into C6/36 cells according to the procedure described above (the cotransfection concentration ratio should be 2:1).</li>
	</ol>
	</li>
</ol>
5. Harvesting rAaeDV Virions from Transfected C6/36 Cells
<ol>
	<li>Harvest the cells 5 days after transfection. Dislodge and suspend the cells in the dishes by a 5 mL glass dropper, pipetting up and down with the culture medium. Transfer all cell suspensions to sterile 15-mL tubes.</li>
	<li>Freeze at -80 &#176;C or in a dry ice/ethanol bath for 30 min and then thaw at 37 &#176;C. Vortex for 1 min. Repeat the freeze-and-thaw procedure 3 times.</li>
	<li>Centrifuge the sample at 4,800 x g for 20 min at 4 &#176;C.Collect the supernatant and discard the pellet. Then, pass the supernatant through a 0.22 &#181;m disposable syringe filter. Aliquot and store the final purified virion stocks at -80 &#176;C. 
	NOTE: Avoid repeated freeze-thaw cycles.</li>
</ol>
6. Quantifying rAaeDV
<ol>
	<li>Prepare the DNA standards. Linearize all rAaeDV plasmids with HpaI, and purify the digested products with a gel extraction kit24.</li>
	<li>Construct the absolute quantitative standard curve and measure the titer of virus according to previously described methods25.</li>
</ol>
7. Mosquito Transduction
<ol>
	<li>Wash 100 1st instar Ae. albopictus larvae three times using deionized water, and then, transfer the larvae into a beaker containing 95 mL deionized water. Add 5 mL of the rAaeDV stocks (final concentration of 1.00 x 1010 copies/mL).</li>
	<li>Incubate for 24 h at 28 &#176;C, wash the larvae three times using deionized water, and then transfer the larvae back to the plates and feed regularly.</li>
	<li>Monitor the level of target gene expression in the larvae with qPCR or Western blot (representative results are shown in Figures 3 and 4). 
	NOTE: The fluorescence signal detection method can be used to isolate the infected larvae more precisely. For example, to detect fluorescent signals from larvae infected with recombinant virus expressing DsRed, the larvae can be placed on a concavity slide and observed under an inverted fluorescence microscope every 8 h until 2 days post-infection. Once fluorescent larvae are detected, they should be separated into individual plastic test cups to allow for subsequent continuous observation. Larvae with multiple tissues infected can be identified using this method.</li>
</ol>

<ol>
	<li>Tolle, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosquito-borne+diseases.">Mosquito-borne diseases.</a> Current problems in pediatric and adolescent health care. 39, 97-140 (2009).</li><li>Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+Virus.">Zika Virus.</a> The New England journal of medicine. 374, 1552-1563 (2016).</li><li>Roberts, D. R., Andre, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insecticide+resistance+issues+in+vector-borne+disease+control.">Insecticide resistance issues in vector-borne disease control.</a> The American journal of tropical medicine and hygiene. 50, 21-34 (1994).</li><li>Attaran, A., Roberts, D. R., Curtis, C. F., Kilama, W. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Balancing+risks+on+the+backs+of+the+poor.">Balancing risks on the backs of the poor.</a> Nature medicine. 6, 729-731 (2000).</li><li>Volohonsky, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+Expression+of+the+Anti-parasitic+Factor+TEP1+in+the+Malaria+Mosquito+Anopheles+gambiae.">Transgenic Expression of the Anti-parasitic Factor TEP1 in the Malaria Mosquito Anopheles gambiae.</a> PLoS pathogens. 13, 1006113 (2017).</li><li>Galizi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+sex+ratio+distortion+system+for+the+control+of+the+human+malaria+mosquito.">A synthetic sex ratio distortion system for the control of the human malaria mosquito.</a> Nature communications. 5, 3977 (2014).</li><li>Bourtzis, K., Lees, R. S., Hendrichs, J., Vreysen, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=More+than+one+rabbit+out+of+the+hat:+Radiation,+transgenic+and+symbiont-based+approaches+for+sustainable+management+of+mosquito+and+tsetse+fly+populations.">More than one rabbit out of the hat: Radiation, transgenic and symbiont-based approaches for sustainable management of mosquito and tsetse fly populations.</a> Acta tropica. 157, 115-130 (2016).</li><li>Kumar, S. S., Puttaraju, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improvised+microinjection+technique+for+mosquito+vectors.">Improvised microinjection technique for mosquito vectors.</a> The Indian journal of medical research. 136, 971-978 (2012).</li><li>Attardo, G. M., Higgs, S., Klingler, K. A., Vanlandingham, D. L., Raikhel, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference-mediated+knockdown+of+a+GATA+factor+reveals+a+link+to+anautogeny+in+the+mosquito+Aedes+aegypti.">RNA interference-mediated knockdown of a GATA factor reveals a link to anautogeny in the mosquito Aedes aegypti.</a> Proceedings of the National Academy of Sciences of the United States of America. 100, 13374-13379 (2003).</li><li>Singh, A. D., Wong, S., Ryan, C. P., Whyard, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+delivery+of+double-stranded+RNA+in+larvae+of+the+yellow+fever+mosquito,+Aedes+aegypti:+implications+for+pest+mosquito+control.">Oral delivery of double-stranded RNA in larvae of the yellow fever mosquito, Aedes aegypti: implications for pest mosquito control.</a> Journal of insect science. 13, 69 (2013).</li><li>Ward, T. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aedes+aegypti+transducing+densovirus+pathogenesis+and+expression+in+Aedes+aegypti+and+Anopheles+gambiae+larvae.">Aedes aegypti transducing densovirus pathogenesis and expression in Aedes aegypti and Anopheles gambiae larvae.</a> Insect molecular biology. 10, 397-405 (2001).</li><li>Carlson, J., Suchman, E., Buchatsky, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Densoviruses+for+control+and+genetic+manipulation+of+mosquitoes.">Densoviruses for control and genetic manipulation of mosquitoes.</a> Advances in virus research. 68, 361-392 (2006).</li><li>Barreau, C., Jousset, F. X., Bergoin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogenicity+of+the+Aedes+albopictus+parvovirus+(AaPV),+a+denso-like+virus,+for+Aedes+aegypti+mosquitoes.">Pathogenicity of the Aedes albopictus parvovirus (AaPV), a denso-like virus, for Aedes aegypti mosquitoes.</a> Journal of invertebrate pathology. 68, 299-309 (1996).</li><li>Liu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+non-defective+recombinant+densovirus+vectors+for+microRNA+delivery+in+the+invasive+vector+mosquito,+Aedes+albopictus.">Development of non-defective recombinant densovirus vectors for microRNA delivery in the invasive vector mosquito, Aedes albopictus.</a> Scientific reports. 6, 20979 (2016).</li><li>Ortega, M. M., Bouamar, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guidelines+on+Designing+MicroRNA+Sponges:+From+Construction+to+Stable+Cell+Line.">Guidelines on Designing MicroRNA Sponges: From Construction to Stable Cell Line.</a> Methods in molecular biology. 1509, 221-233 (2017).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+plasmid+DNA+into+E.+coli+using+the+heat+shock+method.">Transformation of plasmid DNA into E. coli using the heat shock method.</a> Journal of visualized experiments : JoVE. , e253 (2007).</li><li>Afanasiev, B. N., Kozlov, Y. V., Carlson, J. O., Beaty, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Densovirus+of+Aedes+aegypti+as+an+expression+vector+in+mosquito+cells.">Densovirus of Aedes aegypti as an expression vector in mosquito cells.</a> Experimental parasitology. 79, 322-339 (1994).</li><li>Hu, H. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolution+of+the+human-specific+microRNA+miR-941.">Evolution of the human-specific microRNA miR-941.</a> Nature communications. 3, 1145 (2012).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proceedings of the National Academy of Sciences of the United States of America. 74, 5463-5467 (1977).</li><li>Dalby, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advanced+transfection+with+Lipofectamine+2000+reagent:+primary+neurons,+siRNA,+and+high-throughput+applications.">Advanced transfection with Lipofectamine 2000 reagent: primary neurons, siRNA, and high-throughput applications.</a> Methods (San Diego, Calif). 33, 95-103 (2004).</li><li>Gu, J. B., Dong, Y. Q., Peng, H. J., Chen, X. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+recombinant+AeDNA+containing+the+insect-specific+toxin,+BmK+IT1,+displayed+an+increasing+pathogenicity+on+Aedes+albopictus.">A recombinant AeDNA containing the insect-specific toxin, BmK IT1, displayed an increasing pathogenicity on Aedes albopictus.</a> The American journal of tropical medicine and hygiene. 83, 614-623 (2010).</li><li>Hou, Y., Zhang, H., Miranda, L., Lin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serious+overestimation+in+quantitative+PCR+by+circular+(supercoiled)+plasmid+standard:+microalgal+pcna+as+the+model+gene.">Serious overestimation in quantitative PCR by circular (supercoiled) plasmid standard: microalgal pcna as the model gene.</a> PloS one. 5, 9545 (2010).</li><li>Ding, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+rAAV9+to+Overexpress+or+Knockdown+Genes+in+Mouse+Hearts.">Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts.</a> Journal of visualized experiments : JoVE. , (2016).</li></ol>

The authors declare that they have no competing financial interests.

It is important to overcome two of the key barriers that limit rAaeDV construction. The first is the production of defective recombinant virus. It has been reported that MDV can be used as a vector to express appropriately sized foreign genes, such as scorpion insect-specific neurotoxins20 and the GFP protein; however, regardless of the construction strategy, once the ORFs of MDV are inserted or replaced with exogenous genes, virions cannot form independently unless a helper plasmid is cotransfected to supply the missing...

Mosquito-borne diseases such as malaria, dengue fever, zika fever, and yellow fever, are major international public health problems that continue to account for a significant fraction of the global infectious disease burden1,2. Conventional insecticides, which have been used in response to vectors, are a major component of sustainable integrated mosquito control strategy for the prevention of mosquito-borne diseases. However, such strategies have proven to be relatively ineffective or undesirable due to the associated negative environmental impacts as well as the evolution of resistance in mosquito populations3,4. For these reasons, there is an urgent need for alternative methods of mosquito control, and the use of transgenic methods to produce sterile male mosquitoes and the release of pathogen-resistant mosquitoes have arisen as promising new control strategies. To develop effective new control methods, such as safe and effective approaches for in vivo gene delivery, the comprehensive analysis of mosquito gene function is required.
Direct microinjection of plasmid DNA, double stranded RNA (dsRNA) or small interfering RNA (siRNA) is the most commonly used in vivo gene delivery method in mosquitoes. In fact, the production of transgenic strains of mosquitoes still rely on a process of embryo microinjection5,6,7. However, microinjection has several limitations.First, this technique is technically demanding and involves complicated procedures. Second, injection causes a physical insult to the embryo, larvae, pupae, and adult, which directly affects the viability of the target organism. Third, it is difficult to immobilize mosquito larvae for microinjection because most live in an aquatic habitat and possess a characteristic wriggling movement. Fourth, the size of 1st-2nd instar larvae is 10- to 20-fold smaller than that of 4th instar and older larvae, and the cuticles of the former are more delicate. These features make it difficult to manipulate 1st-2nd instar larvae compared to those in older stages. Combined, these factors contribute to a reduced post-injection survival rate for larvae (approximately 5%) compared to adults8. Viral-based delivery systems have been developed to overcome the associated extracellular and intracellular barriers. These systems have the advantages of easy manipulation, high transduction efficiency, long-term and robust levels of expression, and the ability to produce persistent effects in vivo. Therefore, gene delivery systems utilizing retroviruses, lentiviruses, and adenoviruses have been widely used inmammalian cell lines and model species. The Sindbis viral expression system had been previously used to analyze the gene function in the adult mosquito; besides the biosafety concerns, however, the injection is still a necessary process for viral infection9. Although, the oral delivery by soaking larvae in the dsRNA solution has been reported previously as a feasible delivery method, it is unsuitable for small RNA function analysis10. So, effective viral delivery methods must still be developed for mosquitoes.
Mosquito densoviruses (MDVs) are part of the Densovirinae subfamily of Parvoviridae, and all but one fall within the genus Brevidensovirus11. MDV virions are non-enveloped and consist of a single-stranded DNA (ssDNA) genome and an icosahedral capsid (20 nm in diameter). The viral genome is approximately 4 kb in size and is replicated within the nuclei of host cells. MDVs are relatively stable in the environment and show a narrow host range with high specificity for mosquitoes. These viruses have the potential to spread and persist naturally in mosquito populations and can invade almost all organs and tissues of these insects, including the midgut, Malpighian tubules, fat body, musculature, neurons, and salivary glands12.
Intact MDV genomes can be subcloned into plasmid vectors to produce plasmid-based infectious clones; when these clones are delivered into mosquito cells, the viral genome is extracted from the plasmid vector, and infectious viral particles are produced. Because MDV has a small ssDNA genome, infectious clones are easily constructed and the viral genome can be easily manipulated11,13. These characteristics make MDV a valuable agent for examining mosquito biology. However, because nearly all of the viral genome sequence is essential for viral proliferation, the creation of recombinant virus through the replacement or insertion of foreign genes causes a loss in viral packaging and/or replication abilities, which creates a barrier for the development of MDVs as gene delivery vectors. Herein, we report using an artificial intronic small-RNA expression strategy to develop a non-defective rAaeDV in vivo RNA delivery system that has the advantages of easy plasmid construction and the maintenance of a functional virus that can produce stable and long-term expression in host cells without the need for wild-type virus. Additionally, this method allows for the easy transduction of larvae.
The protocols for the following steps are described in this study: 1) design of rAaeDVs encoding an intronic small-RNA expression cassette, 2) production of recombinant virus particles using the C6/36 packaging cell line, 3) quantitative analysis of cell-free rAaeDV genome copy numbers, and 4) infection of Ae. albopictus larvae by direct introduction of virus into the water body of the larval habitat. Overall, this work demonstrated that specific small RNAs or target genes can be overexpressed or knocked down in mosquito larvae using the developed MDV delivery system.

<table><tbody><tr><td>Centrifuge machine</td><td>Thermo Scientific</td><td>75004260</td><td></td></tr><tr><td>Centrifuge System</td><td>Beckman Coulter</td><td>363118</td><td></td></tr><tr><td>GeneJET Gel Extraction Kit</td><td>Thermo Scientific</td><td>K0691</td><td></td></tr><tr><td>E.Z.N.A. Plasmid Midi Kit</td><td>Omega Biotech</td><td>D6904</td><td></td></tr><tr><td>Purified Agar</td><td>OXOID</td><td>LP0028A</td><td></td></tr><tr><td>FastAP Thermosensitive Alkaline Phosphatase (1 U/&amp;micro;L)</td><td>Thermo Scientific</td><td>EF0651</td><td></td></tr><tr><td>FastDigest &lt;em&gt;HpaI&lt;/em&gt;</td><td>Thermo Scientific</td><td>FD1034</td><td></td></tr><tr><td>FastDigest &lt;em&gt;XbaI&lt;/em&gt;</td><td>Thermo Scientific</td><td>FD0684</td><td></td></tr><tr><td>T4 DNA Ligase (5 U/&amp;micro;L)</td><td>Thermo Scientific</td><td>EL0011</td><td></td></tr><tr><td>TransStbl3 Chemically Competent Cell</td><td>Beijing Transgen Biotech</td><td>CD521-01</td><td></td></tr><tr><td>Ampicillin&amp;nbsp;</td><td>Beijing Tiangen Biotech</td><td>RT501</td><td></td></tr><tr><td>Proteinase K</td><td>Promega</td><td>MC5008</td><td></td></tr><tr><td>SuperReal PreMix Plus (SYBR Green)</td><td>Beijing Tiangen Biotech</td><td>FP205</td><td></td></tr></tbody></table>

use of a recombinant mosquito densovirus as a gene delivery vector for the functional analysis of genes in mosquito larvae

In vivo microinjection is the most commonly used gene transfer technique for analyzing the gene functions in individual mosquitoes. However, this method requires a more technically demanding operation and involves complicated procedures, especially when used in larvae due to their small size, relatively thin and fragile cuticle, and high mortality, which limit its application. In contrast, viral vectors for gene delivery have been developed to surmount extracellular and intracellular barriers. These systems have the advantages of easy manipulation, high gene transduction efficiency, long-term maintenance of gene expression, and the ability to produce persistent effects in vivo. Mosquito densoviruses (MDVs) are mosquito-specific, small single-stranded DNA viruses that can effectively deliver foreign nucleic acids into mosquito cells; however, the replacement or insertion of foreign genes to create recombinant viruses typically causes a loss of packaging and/or replication abilities, which is a barrier to the development of these viruses as delivery vectors.
Herein, we report using an artificial intronic small-RNA expression strategy to develop a non-defective recombinant Aedes aegypti densovirus (AaeDV) in vivo delivery system. Detailed procedures for the construction, packaging and quantitative analysis of the rAaeDV vectors, and for larval infection are described.
This study demonstrates, for the first time, the feasibility of developing a non-defective recombinant MDV micro RNA (miRNA) expression system, and thus providing a powerful tool for the functional analysis of genes in mosquito and establishing a basis for the application of viral paratransgenesis for controlling mosquito-borne diseases. We demonstrated that Aedes albopictus 1st instar larvae could be easily and effectively infected by introducing the virus into the water body of the larvae breeding site and that the developed rAaeDVs could be used to overexpress or knock down the expression of a specific target gene in larvae, providing a tool for the functional analysis of mosquito genes.

Strategies for rAaeDV construction&#160; 
A defective rAaeDV vector was generated to express the DsRed gene in mosquito larvae. The resulting plasmid contained a NS1-DsRed fusion protein cassette with the VP protein deleted (Figure 1A). rAaeDV plasmids containing expression constructs for miRNA, miRNA sponge, shRNA and amiRNA were designed (shown in Figure 1B). For example, ...

Watch this Scientific Journal Video about Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae at JoVE.com

Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae

We report using an artificial intronic small RNA expression strategy to develop a non-defective recombinant Aedes aegypti densovirus (AaeDV) in vivo delivery system. A detailed procedure for the construction, packaging, and quantitative analysis of the rAaeDV vectors as well as for larval infection is described.

In vivo microinjection is the most commonly used gene transfer technique for analyzing the gene functions in individual mosquitoes. However, this method ...

use-recombinant-mosquito-densovirus-as-gene-delivery-vector-for

Research

JoVE Journal

Developmental Biology

6.7K Views.  Southern Medical University. Wij rapporteren met behulp van een kunstmatige intronic kleine RNA expressie strategie te ontwikkelen van een niet-defecte recombinant Aedes aegypti densovirus (AaeDV) in vivo uitvoeringssysteem. Een gedetailleerde procedure voor de bouw, de verpakking en de kwantitatieve analyse van de rAaeDV vectoren evenals wat larvale infectie wordt beschreven.

Video: Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae

Transfection and Mutagenesis of Target Genes in Mosquito Cells by Locked Nucleic Acid-modified Oligonucleotides

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new infections each year. Despite decades of research, there is still no vaccine against malaria, highlighting the need for novel control strategies. One innovative approach is the use of genetically modified mosquitoes to effectively control malaria parasite transmission. Deliberate alterations of cell signaling pathways in the mosquito, via targeted mutagenesis, have been found to regulate parasite development 1. From these studies, we can begin to identify potential gene targets for transformation. Targeted mutagenesis has traditionally relied upon the homologous recombination between a target gene and a large DNA molecule. However, the construction and use of such complex DNA molecules for generation of stably transformed cell lines is costly, time consuming and often inefficient. Therefore, a strategy using locked nucleic acid-modified oligonucleotides (LNA-ONs) provides a useful alternative for introducing artificial single nucleotide substitutions into episomal and chromosomal DNA gene targets (reviewed in 2). LNA-ON-mediated targeted mutagenesis has been used to introduce point mutations into genes of interest in cultured cells of both yeast and mice 3,4. We show here that LNA-ONs can be used to introduce a single nucleotide change in a transfected episomal target that results in a switch from blue fluorescent protein (BFP) expression to green fluorescent protein (GFP) expression in both Anopheles gambiae and Anopheles stephensi cells. This conversion demonstrates for the first time that effective mutagenesis of target genes in mosquito cells can be mediated by LNA-ONs and suggests that this technique may be applicable to mutagenesis of chromosomal targets in vitro and in vivo.

Oligonucleotides can be used to site specifically substitute a single nucleotide of transfected target genes in both Anopheles gambiae and Anopheles stephensi cells.

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new ...

Immunology and Infection

Alphavirus Transducing System:  Tools for Visualizing Infection in Mosquito Vectors

Alphavirus transducing systems (ATSs) are important tools for expressing genes of interest (GOI) during infection. ATSs are derived from cDNA clones of mosquito-borne RNA viruses (genus Alphavirus; family Togaviridae). The Alphavirus genus contains about 30 different mosquito-borne virus species. Alphaviruses are enveloped viruses and contain single-stranded RNA genomes (~11.7 Kb). Alphaviruses transcribe a subgenomic mRNA that encodes the structural proteins of the virus required for encapsidation of the genome and maturation of the virus. Alphaviruses are usually highly lytic in vertebrate cells, but persistently infect susceptible mosquito cells with minimal cytopathology. These attributes make them excellent tools for gene expression in mosquito vectors. The most common ATSs in use are derived from Sindbis virus (SINV). The broad species tropism of SINV allows for infection of insect, avian, and mammalian cells8. However, ATSs have been derived from other alphaviruses as well9,10,20. Foreign gene expression is made possible by the insertion of an additional viral subgenomic RNA initiation site or promoter. ATSs in which an exogenous gene sequence is positioned 5' to the viral structural genes is used for stable protein expression in insects. ATSs, in which a gene sequence is positioned 3' to the structural genes, is used to trigger RNAi and silence expression of that gene in the insect.
ATSs have proven to be valuable tools for understanding vector-pathogen interactions, molecular details of viral replication and maintenance infectious cycles3,4,11,19,21. In particular, the expression of fluorescent and bioluminescent reporters has been instrumental tracking the viral infection in the vector and virus transmission5,14-16,18. Additionally, the vector immune response has been described using two strains of SINV engineered to express GFP2,9.
Here, we present a method for the production of SINV containing a fluorescent reporter (GFP) from the cDNA infectious clone. Infectious, full-length RNA is transcribed from the linearized cDNA clone. Infectious RNA is introduced into permissive target cells by electroporation. Transfected cells generate infectious virus particles expressing the GOI. Harvested virus is used to infect mosquitoes, as described here, or other host species (not shown herein). Vector competence is assessed by detecting fluorescence outside the midgut or by monitoring virus transmission7. Use of a fluorescent reporter as the GOI allows for convenient estimation of virus spread throughout a cell culture, for determination of rate of infection, dissemination in exposed mosquitoes, virus transmission from the mosquito and provides a rapid gauge of vector competence.

Methods for using alphavirus transducing systems to express fluorescent reporters in vitro and in adult mosquitoes are described. This technique may be adapted to express any protein of interest in lieu of or in addition to a reporter.

Alphavirus transducing systems (ATSs) are important tools for expressing genes of interest (GOI) during infection.  ATSs are derived from cDNA clones of ...

Injection of dsRNA into Female A. aegypti Mosquitos

Reverse genetic approaches have proven extremely useful for determining  which genes underly resistance to vector pathogens in mosquitoes.  This video protocol illustrates a method used by the James lab to inject dsRNA into female A. aegypti mosquitoes, which harbor the dengue virus.  The technique for calibrating injection needles, manipulating the injection setup, and injecting dsRNA into the thorax is illustrated.

Reverse genetic approaches have proven extremely useful for determining which genes underly resistance to vector pathogens in mosquitoes. This video protocol illustrates a method used by the James lab to inject dsRNA into female A. aegypti mosquitoes, which harbor the dengue virus. The technique for calibrating injection needles, manipulating the injection setup, and injecting dsRNA into the thorax is illustrated.

Reverse genetic approaches have proven extremely useful for determining  which genes underly resistance to vector pathogens in mosquitoes.  This video ...

Biology

Protocol for RNAi Assays in Adult Mosquitoes (A. gambiae)

Reverse genetic approaches have proven extremely useful for determining  which genes underly resistance to vector pathogens in mosquitoes.  This video protocol illustrates a method used by the Dimopoulos lab to inject dsRNA into Anopheles gambiae mosquitoes, which harbor the malaria parasite.  The technique manipulating the injection setup and injecting dsRNA into the thorax is illustrated.

Protocol for RNAi Assays in Adult Mosquitoes A. gambiae

Reverse genetic approaches have proven extremely useful for determining which genes underly resistance to vector pathogens in mosquitoes. This video protocol illustrates a method used by the Dimopoulos lab to inject dsRNA into Anopheles gambiae mosquitoes, which harbor the malaria parasite. The technique manipulating the injection setup and injecting dsRNA into the thorax is illustrated.

Reproducible dsRNA Microinjection and Oviposition Bioassay in Mosquitoes and House Flies

Synthetic dsRNAs, used to induce RNA interference, may have dose dependent phenotypic effects. These effects are difficult to define if the dsRNAs are delivered using a non-quantitative method. Accurate delivery of known quantities of nucleic acids or other chemicals is critical to measure the efficacy of the compound being tested and to allow reliable comparison between compounds.
Here we provide a reproducible, quantitative microinjection protocol that ensures accurate delivery of specific doses of dsRNA, reducing the mortality typically induced by injection injury. These modifications include the addition of Rhodamine B, a graduated injection needle, and an improved recovery method borrowed from Isoe and Collins. This method allows calculation of dose responses and facilitates comparisons between compounds. Versions of this method have been successfully used on three genera of mosquitoes as well as house flies to assess the reduction in fecundity resulting from gene silencing of ribosomal RNA transcripts.
This protocol provides strategies to reduce several challenges of small insect microinjection. Together, mechanical delivery of dsRNAs accompanied by visual verification, identification of effective locations for delivery, and inclusion of a post-injection recovery period ensure accurate dosing and low injury mortality. This protocol also describes an oviposition bioassay for uniform determination of effects on fecundity.

This protocol describes a microinjection methodology that we have standardized and used for several years to deliver specific quantities of nucleic acids directly to the hemolymph of mosquitoes and house flies. This protocol results in minimal injection mortality and allows dose correlated measurements of fecundity.

Synthetic dsRNAs, used to induce RNA interference, may have dose dependent phenotypic effects. These effects are difficult to define if the dsRNAs are ...

Environment

Using the GAL4-UAS System for Functional Genetics in Anopheles gambiae

The bipartite GAL4-UAS system is a versatile and powerful tool for functional genetic analysis. The essence of the system is to cross transgenic 'driver' lines that express the yeast transcription factor GAL4 in a tissue specific manner, with transgenic 'responder' lines carrying a candidate gene/RNA interference construct whose expression is controlled by Upstream Activation Sequences (UAS) that bind GAL4. In the ensuing progeny, the gene or silencing construct is thus expressed in a prescribed spatiotemporal manner, enabling the resultant phenotypes to be assayed and gene function inferred. The binary system enables flexibility in experimental approaches to screen phenotypes generated by transgene expression in multiple tissue-specific patterns, even if severe fitness costs are induced. We have adapted this system for Anopheles gambiae, the principal malaria vector in Africa.
In this article, we provide some of the common procedures used during GAL4-UAS analysis. We describe the An. gambiae GAL4-UAS lines already generated, as well as the cloning of new responder constructs for upregulation and RNAi knockdown. We specify a step by step guide for sexing of mosquito pupae to establish genetic crosses, that also includes screening progeny to follow inheritance of fluorescent gene markers that tag the driver and responder insertions. We also present a protocol for clearing An. gambiae embryos to study embryonic development. Finally, we introduce potential adaptions of the method to generate driver lines through CRISPR/Cas9 insertion of GAL4 downstream of target genes.

Using the GAL4-UAS System for Functional Genetics in Anopheles gambiae

The bipartite GAL4-UAS system is a versatile tool for modification of gene expression in a controlled spatiotemporal manner which permits functional genetic analysis in Anopheles gambiae. The procedures described for using this system are a semi-standardized cloning strategy, sexing and screening of pupae for fluorescent protein markers and embryo fixation.

The bipartite GAL4-UAS system is a versatile and powerful tool for functional genetic analysis. The essence of the system is to cross transgenic 'driver' ...

Genetics

Indel Detection following CRISPR/Cas9 Mutagenesis using High-resolution Melt Analysis in the Mosquito Aedes aegypti

Mosquito gene editing has become routine in several laboratories with the establishment of systems such as transcription-activator-like effector nucleases (TALENs), zinc-finger nucleases (ZFNs), and homing endonucleases (HEs). More recently, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) technology has offered an easier and cheaper alternative for precision genome engineering. Following nuclease action, DNA repair pathways will fix the broken DNA ends, often introducing indels. These out-of-frame mutations are then used for understanding gene function in the target organisms. A drawback, however, is that mutant individuals carry no dominant marker, making identification and tracking of mutant alleles challenging, especially at scales needed for many experiments. 
High-resolution melt analysis (HRMA) is a simple method to identify variations in nucleic acid sequences and utilizes PCR melting curves to detect such variations. This post-PCR analysis method uses fluorescent double-stranded DNA-binding dyes with instrumentation that has temperature ramp control data capture capability and is easily scaled to 96-well plate formats. Described here is a simple workflow using HRMA for the rapid detection of CRISPR/Cas9-induced indels and the establishment of mutant lines in the mosquito Ae. aegypti. Critically, all steps can be performed with a small amount of leg tissue and do not require sacrificing the organism, allowing genetic crosses or phenotyping assays to be performed after genotyping.

Indel Detection following CRISPR/Cas9 Mutagenesis using High-resolution Melt Analysis in the Mosquito Aedes aegypti

This article details a protocol for rapid identification of indels induced by CRISPR/Cas9 and selection of mutant lines in the mosquito Aedes aegypti using high-resolution melt analysis.

Mosquito gene editing has become routine in several laboratories with the establishment of systems such as transcription-activator-like effector nucleases ...

Chitosan/Interfering RNA Nanoparticle Mediated Gene Silencing in Disease Vector Mosquito Larvae

Vector mosquitoes inflict more human suffering than any other organism&#8212;and kill more than one million people each year. The mosquito genome projects facilitated research in new facets of mosquito biology, including functional genetic studies in the primary African malaria vector Anopheles gambiae and the dengue and yellow fever vector Aedes aegypti. RNA interference- (RNAi-) mediated gene silencing has been used to target genes of interest in both of these disease vector mosquito species. Here, we describe a procedure for preparation of chitosan/interfering RNA nanoparticles that are combined with food and ingested by larvae. This technically straightforward, high-throughput, and relatively inexpensive methodology, which is compatible with long double stranded RNA (dsRNA) or small interfering RNA (siRNA) molecules, has been used for the successful knockdown of a number of different genes in A. gambiae and A. aegypti larvae. Following larval feedings, knockdown, which is verified through qRT-PCR or in situ hybridization, can persist at least through the late pupal stage. This methodology may be applicable to a wide variety of mosquito and other insect species, including agricultural pests, as well as other non-model organisms. In addition to its utility in the research laboratory, in the future, chitosan, an inexpensive, non-toxic and biodegradable polymer, could potentially be utilized in the field.

Here we describe a procedure for inhibiting gene function in disease vector mosquitoes through the use of chitosan/interfering RNA nanoparticles that are ingested by larvae.

Vector mosquitoes inflict more human suffering than any other organism&#8212;and kill more than one million people each year. The mosquito genome projects ...

RNAi Trigger Delivery into Anopheles gambiae Pupae

RNA interference (RNAi), a naturally occurring phenomenon in eukaryotic organisms, is an extremely valuable tool that can be utilized in the laboratory for functional genomic studies. The ability to knockdown individual genes selectively via this reverse genetic technique has allowed many researchers to rapidly uncover the biological roles of numerous genes within many organisms, by evaluation of loss-of-function phenotypes. In the major human malaria vector Anopheles gambiae, the predominant method used to reduce the function of targeted genes involves injection of double-stranded (dsRNA) into the hemocoel of the adult mosquito. While this method has been successful, gene knockdown in adults excludes the functional assessment of genes that are expressed and potentially play roles during pre-adult stages, as well as genes that are expressed in limited numbers of cells in adult mosquitoes. We describe a method for the injection of Serine Protease Inhibitor 2 (SRPN2) dsRNA during the early pupal stage and validate SRPN2 protein knockdown by observing decreased target protein levels and the formation of melanotic pseudo-tumors in SRPN2 knockdown adult mosquitoes. This evident phenotype has been described previously for adult stage knockdown of SRPN2 function, and we have recapitulated this adult phenotype by SRPN2 knockdown initiated during pupal development. When used in conjunction with a dye-labeled dsRNA solution, this technique enables easy visualization by simple light microscopy of injection quality and distribution of dsRNA in the hemocoel.

RNAi Trigger Delivery into Anopheles gambiae Pupae

RNA interference (RNAi) is an extremely valuable tool for uncovering gene function. However, the ability to target genes using RNAi during pre-adult stages is limited in the major human malaria vector Anopheles gambiae. We describe an RNAi protocol to reduce gene function via direct injection during pupal development.

RNA interference (RNAi), a naturally occurring phenomenon in eukaryotic organisms, is an extremely valuable tool that can be utilized in the laboratory ...

Effective Oral RNA Interference (RNAi) Administration to Adult Anopheles gambiae Mosquitoes

RNA interference has been a heavily utilized tool for reverse genetic analysis for two decades. In adult mosquitoes, double-stranded RNA (dsRNA) administration has been accomplished primarily via injection, which requires significant time and is not suitable for field applications. To overcome these limitations, here we present a more efficient method for robust activation of RNAi by oral delivery of dsRNA to adult Anopheles gambiae. Long dsRNAs were produced in Escherichia coli strain HT115 (DE3), and a concentrated suspension of heat-killed dsRNA-containing bacteria in 10% sucrose was offered on cotton balls ad-libitum to adult mosquitoes. Cotton balls were replaced every 2 days for the duration of the treatment. Use of this method to target doublesex (a gene involved in sex differentiation) or fork head (which encodes a salivary gland transcription factor) resulted in reduced target gene expression and/or protein immunofluorescence signal, as measured by quantitative Real-Time PCR (qRT-PCR) or fluorescence confocal microscopy, respectively. Defects in salivary gland morphology were also observed. This highly flexible, user-friendly, low-cost, time-efficient method of dsRNA delivery could be broadly applicable to target genes important for insect vector physiology and beyond.

Effective Oral RNA Interference RNAi Administration to Adult Anopheles gambiae Mosquitoes

The oral administration of dsRNA produced by bacteria, a delivery method for RNA interference (RNAi) that is routinely used in Caenorhabditis elegans, was successfully applied here to adult mosquitoes. Our method allows for robust reverse genetics studies and transmission-blocking vector studies without the use of injection.

Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae

Samenvatting

Meer video's verkennen