We thank Dr. R Stokes for the BCG Pasteur strain and A. Talal for technical support. We also thank GenScript for help with gene synthesis.

All animals were maintained in accordance with protocols approved by the Animal Care and Use Committees at the University of British Columbia. Experiments were approved by the Animal Care and Use Committees and performed according to the Canadian Council on Animal Care Guidelines. The animal assurance welfare number is A11-0247.
1. Generation of Monomeric Avidin Fusion Proteins Expressing Plasmids
<ol>
	<li>Sub-clone monomeric avidin sequence12 into pDEST17 plasmid between the &#34;CTC&#34; and &#34;GAA&#34; sites which corresponds to 133-134bp. (i.e., between the 6-histag and the pDEST17 Attr1 recombination site) to obtain p17-Avi. 
	NOTE: The monomeric avidin DNA sequence is shown below. The three mutations introduced in wild-type Avidin to obtain monomeric avidin are shown in bolded characters. 
	gccagaaagtgctcg ctgactggga aatggaccaa cgatctgggc tccATCatga ccatcggggc tgtgaacagc 
	agaggtgaat tcacaggcac ctacatcaca gccgtaacag ccacatcaaa tgagatcaaa gagtcaccac tgcatgggac 
	acaaGCTacc atcaacaaga ggacccagcc cacctttggc ttcaccgtca attggaagtt ttcagagtcc accactgtct 
	tcacgggcca gtgcttcata gacaggaatg ggaaggaggt cctgaagacc atgtggctgc tgcggtcaag tgttaatgac 
	attggtgatg acAAAaaagc taccagggtc ggcatcaaca tcttcactcg cctgcgcaca cagaaggagt ga</li>
	<li>Design primers flanked with AttB1 and AttB2 sites corresponding to OVA polypeptide757-1035 (I-Ab- and H-2Kb-restricted epitopes) DNA sequence. Primer sequences are: Attb1-OVA 
	GGGGACAAGTTTGTACAAAAAAGCAGGCTTCCTTGAGCAGCTTGAGAGTAT and Attb2-OVA 
	GGGGACCACTTTGTACAAGAAAGCTGGGTGTTACCCTACCACCTCTCTGC. (Attb1 and Attb2 sequences are bolded).
	<ol>
		<li>PCR-amplify OVA polypeptide757-1035 DNA sequence with the primers above using the pUC57-OVA plasmid as a template.</li>
		<li>Clone the PCR products into pDONR-221 through a site-specific in vitro recombination reaction (e.g., BP Clonase) to obtain pDONR-OVA.</li>
	</ol>
	</li>
	<li>Transfer the gene of interest into p17-Avi using the LR Clonase reaction to obtain p17-Avi-OVA. 
	NOTE: For details of BP and LR recombination cloning, see the manufacturer&#39;s manual.</li>
</ol>
2. Monomeric Avidin Fusion Protein Expression, Purification, and Refolding
<ol>
	<li>Transform p17-Avi-OVA plasmid into E. coli BL21 and induce 250 mL of E. coli BL21 culture with IPTG (0.1 M) for 3 h at 37 &#176;C.</li>
	<li>Lysis of Bacteria and Inclusion Bodies Solubilization
	<ol>
		<li>Pellet the 250 mL of induced BL21 culture by 30 min of centrifugation at 4,000 x g and at 4 &#176;C.</li>
		<li>Collect pellets in 10 mL of lysis buffer (50 mM Tris-HCL, 150 mM NaCl, 6 M Guanidine-HCL, pH 1.5-2.5) and incubate for 15 min at 95&#160;&#176;C. Incubate overnight at room temperature on a rotator.</li>
		<li>Centrifuge 30 min at 15,000 x g and 4 &#176;C and collect supernatant.</li>
	</ol>
	</li>
	<li>Purify Avi-OVA from Supernatant (Solubilized Inclusion Bodies Fraction) Using Ni-NTA Columns.
	<ol>
		<li>Dilute inclusion bodies 1:2 with lysis buffer.</li>
		<li>Use 4 mL of Ni-NTA resin per 250 mL of culture-derived inclusion bodies.</li>
		<li>Wash 3x with 10 mL of lysis buffer (pH 7.0).</li>
		<li>Elute with 10 mL of elution buffer (lysis buffer pH 7.0 with 250 mM imidazole).</li>
	</ol>
	</li>
	<li>Refold eluted protein by gradual dilution (1:10) and rapid vortexing in Tris buffer (pH 7.5) containing 1 mM DTT, 200 mM NDSB256 (3-(Benzyldimethylammonio)propanesulfonate), 0.5 mM Tween 80, 500 mM arginine, and 200 mM NaCl for 30 min at room temperature.</li>
	<li>De-salt and buffer exchange refolded protein from Tris buffer into PBS with protein concentrators according to the manufacturer&#39;s protocols.</li>
	<li>Remove aggregates by centrifugation for 30 min at 3,500 x g and at 4 &#176;C, and store aliquots of soluble protein at -20 &#176;C.</li>
</ol>
3. Biotinylation of BCG Cell Surface
<ol>
	<li>Grow BCG in Middlebrook 7H9 broth with 10% OADC (oleic acid, albumin and dextrose solution) and 0.05% Tween 80 at 37 &#176;C on a shaker platform at 50 rpm until OD = 0.5-1. 
	NOTE: BCG is a biosafety level 2 pathogen and all experiments concerning BCG should be done in a biosafety cabinet with proper personal protective equipment.</li>
	<li>Wash 109 BCG 3 times with 500 &#181;L of ice-cold endotoxin free PBS plus 0.1% Tween80 (PBST) (pH 8.0). Suspend BCG pellet in sterile endotoxin free PBS.</li>
	<li>Immediately before use, prepare 1 mL of 10 mM Sulfo-NHS SS biotin in sterile filtered water.
	<ol>
		<li>Incubate bacteria with 1 mL of 0.5 mM of Sulfo-NHS SS biotin at room temperature for 30 min.</li>
	</ol>
	</li>
	<li>Wash labeled bacteria 3 times with 500 &#181;L of iced cold PBST to remove non-reacted biotinylation reagent.
	<ol>
		<li>Re-suspend pellet in 1 mL of PBST.</li>
	</ol>
	</li>
	<li>To evaluate biotinylation efficiency, stain 108 biotinylated BCG with Streptavidin-FITC (1:100, 25 &#181;L) at room temperature for 20 min.
	<ol>
		<li>Incubate stained bacteria in 1 mL of 2% PFA for 20 min at room temperature and then examine levels of biotinylation by flow cytometry analysis.</li>
	</ol>
	</li>
</ol>
4. Phenotype of Biotinylated Mycobacteria: Growth and Survival
<ol>
	<li>Grow BCG strains in Middlebrook 7H9 broth with 10% OADC (oleic acid, albumin and dextrose solution) and 0.05% Tween 80 at 37 &#176;C on a shaker platform at 50 rpm.
	<ol>
		<li>Record the optical density (OD600) of the bacterial culture over an 8-day period.</li>
	</ol>
	</li>
	<li>Use BCG-Luc (previously described9) to detect survival of bacteria in macrophages.
	<ol>
		<li>Infect RAW264.7 cells with biotinylated BCG-Luc (MOI 10:1) or untreated BCG-Luc (control) and incubated at 37 &#176;C over a 48 h time period.</li>
		<li>Wash cell monolayers and then lyse with 0.025% SDS to release ingested bacteria.</li>
		<li>Measure bioluminescence production with Luciferase assay system and luminometer. 
		NOTE: Luminescence signal is indicative of bacterial viability. Please refer to the manufacturer&#39;s manual for details of luciferase assay.</li>
	</ol>
	</li>
</ol>
5. Binding of Monomeric Avidin-Fusion Protein to Biotinylated BCG Surface
<ol>
	<li>Mix 5 x 108 biotinylated BCG with Avi-protein (10 &#956;g/mL final in PBS-T) for 1 h at room temperature on shaker platform.</li>
	<li>Wash bacteria 3 times with 500 &#181;L of iced cold PBST and stain with rabbit anti-avidin antibody (Ab) (1:100 dilution, previously described10) for 20 min at room temperature and then with FITC conjugated goat anti-rabbit IgG Ab in the same conditions.</li>
	<li>Wash bacteria 3 times with 500 &#181;L of PBST and analyze by flow cytometry to evaluate the extent of surface decoration.</li>
</ol>
6. Lyophilization of Mycobacteria
<ol>
	<li>Biotinylate bacteria according to step 3.1-3.4 and coat biotinylated bacteria with Avi-OVA according to step 5.1.</li>
	<li>Aliquot biotinylated and coated bacteria (108), wash with PBS and re-suspend in 0.5 mL lyophilization media (25% Sauton medium, 75% H2O, and 1.5% Na-glutamate).</li>
	<li>Transfer bacteria to glass vials and freeze in a -80 &#176;C freezer overnight.</li>
	<li>Lyophilize filled and frozen glass vials for 24 h using a freeze dryer.</li>
	<li>Store dried samples at room temperature and reconstitute in PBS when needed.</li>
	<li>Repeat step 3.5 to evaluate biotinylation and surface coating stability.</li>
</ol>
7. Phagocytosis Assay
<ol>
	<li>Grow RAW 264.7 macrophage cells in 10 cm diameter culture dishes in DMEM medium containing 5% FCS, 1% each of L-glutamine, HEPES, non-essential amino acids, and penicillin and streptomycin until 70-80% confluency.</li>
	<li>Seed 2 x 106 RAW 264.7 macrophage cells in a 6-well plate. Allow cells to adhere overnight at 37 &#176;C and 5% CO2.</li>
	<li>Generate DsRed BCG (previously described9) decorated with Avi-OVA (DsRed BCG-Avi-OVA) according to steps 3.1-3.4 and 5.1.</li>
	<li>Infect RAW cells with DsRed BCG-Avi-OVA or untreated DsRed BCG at MOI 20:1 for 24 h at 37 &#176;C.</li>
	<li>Wash cells three times and trypsinize using 1 mL of 0.25% trypsin at 37 &#176;C for 10 min to remove partially detached bacteria.</li>
	<li>Fix in 2.5% PFA in PBS for 20 min at room temperature.</li>
	<li>Wash 3x with PBS and analyze by flow cytometry.</li>
</ol>
8. Intracellular Trafficking of OVA Decorated Biotinylated BCG in Macrophages
<ol>
	<li>Fluorescence microscopy
	<ol>
		<li>Seed 3 x 105 RAW 264.7 macrophage cells on coverslips in a 24-well plate. Allow cells to adhere overnight at 37 &#176;C and 5% CO2.</li>
		<li>Infect macrophage cells with mycobacteria (MOI 10:1) in maintenance media without antibiotics at 37 &#176;C and 5% CO2 for 4 to 24 h.</li>
		<li>Wash cells and trypsinize to remove surface attached, non-ingested bacteria as in step 7.5.</li>
		<li>Fix infected cells in 2.5% PFA in PBS for 20 min at room temperature followed by 3 washes with PBS.</li>
		<li>Permeabilize cells in blocking/permeabilization buffer (0.1% Triton X-100, 3% BSA in PBS) for 20 min at room temperature.
		<ol>
			<li>Use specific antibody of interest (e.g., rabbit anti-avidin Ab) at 10 &#956;g/mL in permeabilization buffer for 20 min at room temperature followed by secondary antibody (e.g., FITC-goat anti-rabbit IgG) for 20 min.</li>
		</ol>
		</li>
		<li>Wash cells 3x with PBS, once with water, and mount on slides in 10 &#956;L of aqueous mounting medium to minimize fluorescence photobleaching.</li>
		<li>Examine slides by digital confocal microscopy using an epifluorescence microscope equipped with 63x/1.4 Plan-Apochromat objective. Record images using a digital camera coupled to the microscope software.</li>
	</ol>
	</li>
	<li>Immunogold Staining and Electron Microscopy
	<ol>
		<li>Seed 2 x 106 RAW 264.7 macrophage cells in 6-well plates.</li>
		<li>Fix BCG infected macrophages with 4% PFA for 4 h in room temperature.</li>
		<li>Wash samples twice with PBS.</li>
		<li>Embed samples in 4% low melting point agarose, and dehydrate in 70% ethanol.</li>
		<li>Transfer samples to acrylic resin and polymerize at 50 &#176;C.</li>
		<li>Cut out 60 nm sections with a microtome and collect sections on nickel grids.</li>
		<li>Label samples with 10 &#956;g/mL avidin antibody for 1 h at room temperature or 4 &#176;C overnight in incubation solution (PBS and 0.1% BSA) and then wash with incubation solution gold-conjugated F(ab&#39;)2 of ultra-small goat-anti-rabbit IgG (1/20) for 1 h at room temperature in incubation solution.</li>
		<li>Wash sections in distilled water, stain in 2% glutaraldehyde, wash again, air dry, and examine with electron microscope.</li>
	</ol>
	</li>
</ol>
9. Animal Immunization and Organ Processing
NOTE: All steps should be done in a biosafety cabinet.
<ol>
	<li>Pass biotinylated and protein coated bacteria through 271/2G needle 10 times to make single cell suspension.</li>
	<li>Take 1 x 106 bacteria in 100 &#956;L of endotoxin-free PBS and immunize a female C57BL/6 mice (I-Ab, H-2Kb, 5-6 week old) subcutaneously in the scruff of the neck.
	<ol>
		<li>Inject control mice with 100 &#956;L of PBS alone.</li>
	</ol>
	</li>
	<li>Euthanize immunized mice 20 days post-immunization by CO2 inhalation followed by cervical dislocation.
	<ol>
		<li>Isolate the spleen and transfer it into RPMI media.</li>
	</ol>
	</li>
	<li>Mash spleen through a 70 &#181;m cell strainer with a 5 mL syringe plunger.
	<ol>
		<li>Wash with 5 mL of RPMI. Centrifuge (800 x g, 3 min) to isolate a single cell suspension.</li>
		<li>Deplete RBC with mouse biotin positive selection kit with biotin-Ter119/Erythroid cells Ab.</li>
		<li>Centrifuge and re-suspend cells in 10 mL of complete RPMI (10% FCS, 1% L-glutamine, 1% penicillin, 1% streptomycin, and 50 &#956;M 2-ME).</li>
	</ol>
	</li>
</ol>
10. I-Ab tetramer Staining to Determine the Frequencies of Antigen-Specific CD4+ T Cells and Intracellular Cytokine Staining to Determine Frequencies of Antigen-Specific T Cells Releasing Cytokines in Immunized Animals
<ol>
	<li>Tetramer Staining
	<ol>
		<li>Stain splenocytes from control and immunized mice (~20 x 106 cells) with PE-conjugated I-Ab-OVA323-339 tetramers (1/12.5 dilution) for 1 h at 37 &#176;C in binding buffer (PBS with 2% FCS and 0.1% NaN3).</li>
		<li>Add AF647 CD4 Ab (1:25) and 7-AAD (to detect dead cells) to splenocytes for 20 min at room temperature.</li>
		<li>Analyze samples by flow cytometry.</li>
		<li>Acquire 500,000 events in the CD4 positive region to determine the frequency of tetramer positive events. 
		NOTE: Total splenocytes are defined by the SSC/FSC dot blot, live cells by exclusion of the 7-AAD positive events, and CD4 subsets by gating AF647 positive events.</li>
	</ol>
	</li>
	<li>Frequency of Antigen Specific Intracellular Cytokine Releasing T Cells
	<ol>
		<li>Transfer approximately 1 &#215; 107 splenocytes into 4 mL of complete RPMI medium in six-well plates with or without recombinant OVA (10 &#181;g/mL) and incubate for 16 h.</li>
		<li>Treat cells with Brefeldin A (1:1,000) for an additional 5 h.</li>
		<li>Wash with PBS and subject to intracellular cytokine staining as follows:
		<ol>
			<li>Stain cell samples with PE-CD8 or PE-Cy7-CD4 Ab (1:50 in binding buffer) in room temperature for 30 min.</li>
			<li>Fix in 4% PFA at room temperature for 20 min.</li>
			<li>Permeabilize using permeabilization solution, according to the manufacturer&#39;s instructions.</li>
			<li>Wash cells and label with AF647-conjugated IFN-&#947; Ab (1:50) for 20 min at room temperature.</li>
			<li>Wash cells and subject to flow cytometry analysis as described above.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Horwitz, M. A., Harth, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+vaccine+against+tuberculosis+affords+greater+survival+after+challenge+than+the+current+vaccine+in+the+guinea+pig+model+of+pulmonary+tuberculosis.">A new vaccine against tuberculosis affords greater survival after challenge than the current vaccine in the guinea pig model of pulmonary tuberculosis.</a> Infect. Immun. 71 (4), 1672-1679 (2003).</li><li>Pym, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+BCG+exporting+ESAT-6+confers+enhanced+protection+against+tuberculosis.">Recombinant BCG exporting ESAT-6 confers enhanced protection against tuberculosis.</a> Nat Med. 9 (5), 548-553 (2003).</li><li>Grode, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Increased+vaccine+efficacy+against+tuberculosis+of+recombinant+Mycobacterium+bovis+bacille+Calmette-Guerin+mutants+that+secrete+listeriolysin.">Increased vaccine efficacy against tuberculosis of recombinant Mycobacterium bovis bacille Calmette-Guerin mutants that secrete listeriolysin.</a> The J Clin Invest. 115 (9), 2472-2479 (2005).</li><li>Bastos, R. G., Borsuk, S., Seixas, F. K., Dellagostin, O. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+Mycobacterium+bovis+BCG.">Recombinant Mycobacterium bovis BCG.</a> Vaccine. 27 (47), 6495-6503 (2009).</li><li>Mederle, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmidic+versus+insertional+cloning+of+heterologous+genes+in+Mycobacterium+bovis+BCG:+impact+on+in+vivo+antigen+persistence+and+immune+responses.">Plasmidic versus insertional cloning of heterologous genes in Mycobacterium bovis BCG: impact on in vivo antigen persistence and immune responses.</a> Infect Immun. 70 (1), 303-314 (2002).</li><li>Singh, N. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Novel+Approach+to+Cancer+Immunotherapy+Tumor+Cells+Decorated+with+CD80+Generate+Effective+Antitumor+Immunity+A+Novel+Approach+to+Cancer+Immunotherapy+Tumor+Cells+Decorated+with+CD80+Generate+Effective+Antitumor+Immunity.">A Novel Approach to Cancer Immunotherapy Tumor Cells Decorated with CD80 Generate Effective Antitumor Immunity A Novel Approach to Cancer Immunotherapy Tumor Cells Decorated with CD80 Generate Effective Antitumor Immunity.</a> Cancer Res. 63 (14), 4067-4073 (2003).</li><li>Oizumi, S., Strbo, N., Pahwa, S., Deyev, V., Podack, E. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+and+cellular+requirements+for+enhanced+antigen+cross-presentation+to+CD8+cytotoxic+T+lymphocytes.">Molecular and cellular requirements for enhanced antigen cross-presentation to CD8 cytotoxic T lymphocytes.</a> J Immunol. 179 (4), 2310-2317 (2007).</li><li>Sharif-Paghaleh, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+the+efficacy+of+dendritic+cell+vaccination+by+early+detection+of+(99m)+Tc-HMPAO-labelled+CD4(+)+T+cells.">Monitoring the efficacy of dendritic cell vaccination by early detection of (99m) Tc-HMPAO-labelled CD4(+) T cells.</a> Eur J Immunol. 44 (7), 2188-2191 (2014).</li><li>Sun, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+broad-range+of+recombination+cloning+vectors+in+mycobacteria.">A broad-range of recombination cloning vectors in mycobacteria.</a> Plasmid. 62 (3), 158-165 (2009).</li><li>Laitinen, O. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rational+design+of+an+active+avidin+monomer.">Rational design of an active avidin monomer.</a> J. Biol. Chem. 278 (6), 4010-4014 (2003).</li><li>Flynn, J. L., Chan, J., Triebold, K. J., Dalton, D. K., Stewart, T. A., Bloom, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+essential+role+for+interferon+gamma+in+resistance+to+Mycobacterium+tuberculosis+infection.">An essential role for interferon gamma in resistance to Mycobacterium tuberculosis infection.</a> J Exp Med. 178 (6), 2249-2254 (1993).</li><li>Liao, T. Y. A., Lau, A., Joseph, S., Hytonen, V., Hmama, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+the+immunogenicity+of+the+Mycobacterium+bovis+BCG+vaccine+by+non-genetic+bacterial+surface+decoration+using+the+avidin-biotin+system.">Improving the immunogenicity of the Mycobacterium bovis BCG vaccine by non-genetic bacterial surface decoration using the avidin-biotin system.</a> PLoS ONE. 10 (12), e0145833 (2015).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin+and+streptavidin.">Avidin and streptavidin.</a> Methods Enzymol. 184, 51-67 (1990).</li><li>Howarth, M., Takao, K., Hayashi, Y., Ting, A. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+quantum+dots+to+surface+proteins+in+living+cells+with+biotin+ligase.">Targeting quantum dots to surface proteins in living cells with biotin ligase.</a> PNAS. 102 (21), 7583-7588 (2005).</li><li>Lesch, H. P., Kaikkonen, M. U., Pikkarainen, J. T., Yla-Herttuala, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin-biotin+technology+in+targeted+therapy.">Avidin-biotin technology in targeted therapy.</a> Expert Opin Drug Deliv. 7 (5), 551-564 (2010).</li><li>Paganelli, G., Bartolomei, M., Grana, C., Ferrari, M., Rocca, P., Chinol, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radioimmunotherapy+of+brain+tumor.">Radioimmunotherapy of brain tumor.</a> Neurol Res. 28 (5), 518-522 (2006).</li><li>Cummings, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Safety+and+immunogenicity+of+a+plant-produced+recombinant+monomer+hemagglutinin-based+influenza+vaccine+derived+from+influenza+A+(H1N1)pdm09+virus:+a+Phase+1+dose-escalation+study+in+healthy+adults.">Safety and immunogenicity of a plant-produced recombinant monomer hemagglutinin-based influenza vaccine derived from influenza A (H1N1)pdm09 virus: a Phase 1 dose-escalation study in healthy adults.</a> Vaccine. 32 (19), 2251-2259 (2014).</li><li>Kolotilin, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant-based+solutions+for+veterinary+immunotherapeutics+and+prophylactics.">Plant-based solutions for veterinary immunotherapeutics and prophylactics.</a> Vet Res. 45, 114-117 (2014).</li><li>Demonte, D., Drake, E. J., Lim, K. H., Gulick, A. M., Park, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure-based+engineering+of+streptavidin+monomer+with+a+reduced+biotin+dissociation+rate.">Structure-based engineering of streptavidin monomer with a reduced biotin dissociation rate.</a> Proteins. 81 (9), 1621-1633 (2013).</li><li>Deghmane, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipoamide+dehydrogenase+mediates+retention+of+coronin-1+on+BCG+vacuoles,+leading+to+arrest+in+phagosome+maturation.">Lipoamide dehydrogenase mediates retention of coronin-1 on BCG vacuoles, leading to arrest in phagosome maturation.</a> J Cell Sci. 120 (19), 3489-3489 (2007).</li><li>Soualhine, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mycobacterium+bovis+bacillus+Calmette-Guerin+secreting+active+cathepsin+S+stimulates+expression+of+mature+MHC+class+II+molecules+and+antigen+presentation+in+human+macrophages.">Mycobacterium bovis bacillus Calmette-Guerin secreting active cathepsin S stimulates expression of mature MHC class II molecules and antigen presentation in human macrophages.</a> J Immunol. 179 (8), 5137-5145 (2007).</li><li>Bubb, M. O., Green, F., Conradie, J. D., Tchernyshev, B., Bayer, E. A., Wilchek, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+antibodies+to+avidin+in+human+serum.">Natural antibodies to avidin in human serum.</a> ImmunolLett. 35 (3), 277-280 (1993).</li><li>Petronzelli, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Therapeutic+use+of+avidin+is+not+hampered+by+antiavidin+antibodies+in+humans.">Therapeutic use of avidin is not hampered by antiavidin antibodies in humans.</a> Cancer Biother Radiopharm. 25 (5), 563-570 (2010).</li><li>Bigini, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+fate+of+avidin-nucleic+acid+nanoassemblies+as+multifunctional+diagnostic+tools.">In vivo fate of avidin-nucleic acid nanoassemblies as multifunctional diagnostic tools.</a> ACS Nano. 8 (1), 175-187 (2014).</li></ol>

The authors have nothing to disclose.

We reported in this study a non-genetic approach for rapid and effective display of exogenous proteins on BCG surface to add either specific antigens or specific functional properties expected to efficiently improve the bacterium&#39;s immunogenicity. We demonstrated that the BCG cell surface could be easily biotinylated for instantaneous surface decoration with avidin fusion proteins. The total procedure can be performed within 2 h, while genetic transformation and selection of positive clones requires 2 to 3 months of ...

Various strategies have been proposed to replace the current TB vaccine BCG, including protein adjuvant systems, viral vectored technologies, attenuated live M.tb strains, and genetically modified BCG strains, either to introduce genes over-expressing BCG antigens that are not sufficiently expressed during infection1 or Mtb-specific antigens not present in BCG2. Genetic engineering, however, faces many barriers including the uncertain level of safety, the time-consuming process, and the low efficiency of expression vectors4,5. With regards to improving BCG, an alternate approach is needed to improve immunogenicity without the need for uncertain genetic alternations.
In this study, we introduce a novel strategy for display of recombinant proteins of interest on the BCG cell surface that is based on the well-known high-affinity avidin interaction with biotin. This approach allows rapid and reproducible attachment of recombinant avidin fusion proteins on the surface of biotinylated BCG, which facilitates broad manipulations of BCG to achieve maximal improvement of its efficacy while maintaining its excellent safety record, observed over decades of use.
Avidin affinity for biotin is extremely high (Kd = 10&#8722;15 M) and once formed, the biotin-avidin complex is very stable and can only be disrupted under denaturing conditions6. However, for this type of interaction to serve as a gene transfer method alternative, long-term but reversible display of recombinant proteins is required. Thus, we introduced here a low affinity monomeric avidin (Kd = 10&#8722;7 M) that leads to the reversible release of protein from the surface decorated BCG once ingested inside antigen presenting cells. In order to provide a proof of concept, we tested this method using a monomeric avidin chimeric protein corresponding to a surrogate antigen derived from ovalbumin (OVA)7,8. The results showed that the BCG cell surface can be easily and rapidly decorated with monomeric avidin fusion proteins and that this binding to the BCG surface is stable and reproducible without detectable changes in bacterial growth and survival. Also, we found that BCG decorated with monomeric avidin fused with OVA (AviOVA) can induce an immune response similar to that induced by BCG genetically expressing the same antigen both in vitro and in vivo. This technology of reversible display of proteins of interest on the bacterial surface is therefore an effective replacement of traditional gene transfer approaches and can provide a platform for broad manipulations of BCG and further applications in vaccine development.

<table><tbody><tr><td>Endotoxin-free RPMI 1640</td><td>StemCell Technologies&amp;nbsp;</td><td>36750</td><td></td></tr><tr><td>Sulfo-NHS SS biotin</td><td>Thermo Fisher&amp;nbsp;</td><td>21328</td><td></td></tr><tr><td>FITC-conjugated streptavidin</td><td>Sigma-Aldrich</td><td>S3762</td><td></td></tr><tr><td>Phycoerythrin (PE)-conjugated I-A&lt;sup&gt;b&lt;/sup&gt;-OVA&lt;sub&gt;323-339&lt;/sub&gt; tetramer&amp;nbsp;</td><td>MBL International&amp;nbsp;</td><td>TS-M710-1</td><td></td></tr><tr><td>7-AAD</td><td>BD Pharmingen</td><td>559925</td><td></td></tr><tr><td>TALON polyhistidine-Tag purification resin&amp;nbsp;</td><td>Clontech</td><td>635501</td><td></td></tr><tr><td>Alexa Fluor (AF) 647 conjugated rat anti-mouse CD4</td><td>BD Bioscience&amp;nbsp;</td><td>557681</td><td></td></tr><tr><td>AF647 rat anti-mouse IFN-g</td><td>BD Bioscience&amp;nbsp;</td><td>557735</td><td></td></tr><tr><td>AF647 rat anti-mouse I-A/I-E</td><td>BD Bioscience&amp;nbsp;</td><td>562367</td><td></td></tr><tr><td>PeCy7 rat anti-mouse CD4</td><td>BD Bioscience&amp;nbsp;</td><td>552775</td><td></td></tr><tr><td>PE rat anti-mouse CD8 Ab</td><td>BD Bioscience&amp;nbsp;</td><td>561095</td><td></td></tr><tr><td>AF 647 rat anti-mouse H-2k&lt;sup&gt;b&lt;/sup&gt;</td><td>BD Bioscience</td><td>562832</td><td></td></tr><tr><td>FITC-conjugated goat anti rabbit antibody</td><td>Thermo Fisher</td><td>31635</td><td></td></tr><tr><td>AF 647 rat anti-mouse CD4</td><td>BD Bioscience&amp;nbsp;</td><td>557681</td><td></td></tr><tr><td>Ultra-small gold-conjugated goat anti-rabbit IgG</td><td>Electron Microscopy Sciences</td><td>25100</td><td></td></tr><tr><td>Middlebrook 7H9 broth</td><td>BD Diagnostic Systems</td><td>271310</td><td></td></tr><tr><td>OADC</td><td>BD Diagnostic Systems</td><td>B11886</td><td></td></tr><tr><td>Tween 80</td><td>Sigma-Aldrich</td><td>P1379</td><td></td></tr><tr><td>RAW 264.7 murine macrophage cell lines</td><td>American Type Culture Collection</td><td></td><td></td></tr><tr><td>pDEST17 plasmid&amp;nbsp;</td><td>Invitrogen</td><td>11803012</td><td></td></tr><tr><td>pUC57-OVA plasmid&amp;nbsp;</td><td>GenScript</td><td>SD1176</td><td></td></tr><tr><td>BP clonase&amp;nbsp;</td><td>Invitrogen</td><td>11789020</td><td></td></tr><tr><td>LR clonase&amp;nbsp;</td><td>Invitrogen</td><td>11791043</td><td></td></tr><tr><td>pDONR221 plasmid</td><td>Invitrogen</td><td>12536017</td><td></td></tr><tr><td>Ni-NTA columns&amp;nbsp;</td><td>Qiagen</td><td>31014</td><td></td></tr><tr><td>Pierce protein concentrators&amp;nbsp;</td><td>Thermo Fisher&amp;nbsp;</td><td>88527</td><td></td></tr><tr><td>Flurosave</td><td>Calbiochem-Novabiochem</td><td>345789</td><td></td></tr><tr><td>Axioplan II epifluorescence microscope</td><td>Carl Zeiss Inc</td><td></td><td></td></tr><tr><td>CCD digital camera&amp;nbsp;</td><td>Retiga EX, QImaging</td><td></td><td></td></tr><tr><td>Tecnai G2 200kV electron microscope&amp;nbsp;</td><td>FEI Company</td><td>G2 200Kv&amp;nbsp;</td><td></td></tr><tr><td>70&amp;mu;m Falcon cell strainer&amp;nbsp;</td><td>Thermo Fisher&amp;nbsp;</td><td>87712</td><td></td></tr><tr><td>EasyStep mouse biotin positive selection kit&amp;nbsp;</td><td>StemCell</td><td>18556</td><td></td></tr><tr><td>biotin-Ter119/Ertyroid cells antibody</td><td>BioLegend</td><td>116203</td><td></td></tr><tr><td>Brefeldin A</td><td>BD Pharmingen</td><td>555029</td><td></td></tr><tr><td>Cytofix/Cytoperm kit&amp;nbsp;</td><td>BD Pharmingen</td><td>554714</td><td></td></tr><tr><td>Bright-Glo Luciferase assay system</td><td>Promega</td><td>e2620</td><td></td></tr><tr><td>Turner Biosystem luminometer&amp;nbsp;</td><td>Promega</td><td>TD-20/20</td><td></td></tr><tr><td>Leica EM UC6 microtome</td><td>&amp;nbsp;Leica Microsystems</td><td>UC6</td><td></td></tr><tr><td>Novalyphe NL 500 freeze dryer</td><td>Savant Instruments</td><td>&amp;nbsp;NL 50</td><td></td></tr><tr><td>Wheaton boroscilicate glass vials</td><td>Wheaton</td><td>&amp;nbsp;VWR 66011-675</td><td></td></tr></tbody></table>

expression of exogenous antigens in the mycobacterium bovis bcg vaccine via non-genetic surface decoration with the avidin-biotin system

Tuberculosis (TB) is a serious infectious disease and the only available vaccine M. bovis bacillus Calmette-Gu&#233;rin (BCG) is safe and effective for protection against children&#39;s severe TB meningitis and some forms of disseminated TB, but fails to protect against pulmonary TB, which is the most prevalent form of the disease. Promising strategies to improve BCG currently rely either on its transformation with genes encoding immunodominant M. tuberculosis (Mtb)-specific antigens and/or complementation with genes encoding co-factors that would stimulate antigen presenting cells. Major limitations to these approaches include low efficiency, low stability, and the uncertain level of safety of expression vectors. In this study, we present an alternative approach to vaccine improvement, which consists of BCG complementation with exogenous proteins of interest on the surface of bacteria, rather than transformation with plasmids encoding corresponding genes. First, proteins of interest are expressed in fusion with monomeric avidin in standard E. coli expression systems and then used to decorate the surface of biotinylated BCG. Animal experiments using BCG surface decorated with surrogate ovalbumin antigen demonstrate that the modified bacterium is fully immunogenic and capable of inducing specific T cell responses. Altogether, the data presented here strongly support a novel and efficient method for reshaping the current BCG vaccine that replaces the laborious conventional approach of complementation with exogenous nucleic acids.

With the general procedures described above, the feasibility of BCG surface biotinylation and decoration with surrogate antigen OVA was examined. The immunogenicity of the modified BCG was then tested in vivo. The bacterial surface was easily labeled with biotin for rapid display of avidin chimeric antigens without any detectable changes in bacterial phenotypes. The resulting modified BCG is efficiently ingested by antigen presentation cells and can induce an OVA-specific immune ...

Watch this Scientific Journal Video about Expression of Exogenous Antigens in the Mycobacterium bovis BCG Vaccine via Non-genetic Surface Decoration with the Avidin-biotin System at JoVE.com

Expression of Exogenous Antigens in the Mycobacterium bovis BCG Vaccine via Non-genetic Surface Decoration with the Avidin-biotin System

A novel technique for rapid antigen display on a bacterial surface is presented, which involves surface biotinylation followed by exposure to proteins of interest in fusion with monomeric avidin. Loading BCG with selected antigens successfully improves its immunogenicity, suggesting that surface decoration can replace traditional genetic approaches.

Expression of Exogenous Antigens in the Mycobacterium bovis BCG Vaccine via Non-genetic Surface Decoration with the Avidin-biotin System

Tuberculosis (TB) is a serious infectious disease and the only available vaccine M. bovis bacillus Calmette-Gu&#233;rin (BCG) is safe and effective for ...

expression-exogenous-antigens-mycobacterium-bovis-bcg-vaccine-via-non

Research

JoVE Journal

Immunology and Infection

9.3K Views.  University of British Columbia. Een nieuwe techniek voor snelle antigeen weergave op een bacteriële oppervlak wordt gepresenteerd, waarbij het oppervlak biotinylation gevolgd door blootstelling aan proteïnen van belang in fusie met monomere avidin. Laden van BCG met geselecteerde antigenen met succes verbetert de immunogeniciteit, suggereren dat oppervlakte decoratie traditionele genetische benaderingen kan vervangen.

Video: Expression of Exogenous Antigens in the Mycobacterium bovis BCG Vaccine via Non-genetic Surface Decoration with the Avidin-biotin System

A Functional Whole Blood Assay to Measure Viability of Mycobacteria, using Reporter-Gene Tagged BCG or M.Tb (BCG lux/M.Tb lux)

Functional assays have long played a key role in measuring of immunogenicity of a given vaccine. This is conventionally expressed as serum bactericidal titers. Studies of serum bactericidal titers in response to childhood vaccines have enabled us to develop and validate cut-off levels for protective immune responses and such cut-offs are in routine use. No such assays have been taken forward into the routine assessment of vaccines that induce primarily cell-mediated immunity in the form of effector T cell responses, such as TB vaccines. In the animal model, the performance of a given vaccine candidate is routinely evaluated in standardized bactericidal assays, and all current novel TB-vaccine candidates have been subjected to this step in their evaluation prior to phase 1 human trials. The assessment of immunogenicity and therefore likelihood of protective efficacy of novel anti-TB vaccines should ideally undergo a similar step-wise evaluation in the human models now, including measurements in bactericidal assays.
Bactericidal assays in the context of tuberculosis vaccine research are already well established in the animal models, where they are applied to screen potentially promising vaccine candidates. Reduction of bacterial load in various organs functions as the main read-out of immunogenicity. However, no such assays have been incorporated into clinical trials for novel anti-TB vaccines to date.
Although there is still uncertainty about the exact mechanisms that lead to killing of mycobacteria inside human macrophages, the interaction of macrophages and T cells with mycobacteria is clearly required. The assay described in this paper represents a novel generation of bactericidal assays that enables studies of such key cellular components with all other cellular and humoral factors present in whole blood without making assumptions about their relative individual contribution. The assay described by our group uses small volumes of whole blood and has already been employed in studies of adults and children in TB-endemic settings. We have shown immunogenicity of the BCG vaccine, increased growth of mycobacteria in HIV-positive patients, as well as the effect of anti-retroviral therapy and Vitamin D on mycobacterial survival in vitro. Here we summarise the methodology, and present our reproducibility data using this relatively simple, low-cost and field-friendly model.
Note: Definitions/Abbreviations
BCG lux = M. bovis BCG, Montreal strain, transformed with shuttle plasmid pSMT1 carrying the luxAB genes from Vibrio harveyi, under the control of the mycobacterial GroEL (hsp60) promoter. 
CFU = Colony Forming Unit (a measure of mycobacterial viability).

A Functional Whole Blood Assay to Measure Viability of Mycobacteria, using Reporter-Gene Tagged BCG or M.Tb BCG lux/M.Tb lux

We describe an alternative approach to the enumeration of mycobacteria in vitro, which uses reporter-gene tagged mycobacteria instead of colony-forming units (CFU). &#x201C;Survival&#x201D; of organisms as well as host response-markers are measured simultaneously, providing a low-cost, versatile and functional system for studies of host/pathogen interactions in the context of tuberculosis.

Functional assays have long played a key role in measuring of immunogenicity of a given vaccine. This is conventionally expressed as serum bactericidal ...

Application of Long-term cultured Interferon-&#947; Enzyme-linked Immunospot Assay for Assessing Effector and Memory T Cell Responses in Cattle

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is controlled up to 95 % of the T cells generated during the expansion phase are eliminated (i.e., contraction phase) and memory T cells remain, sometimes for a lifetime. In humans, two functionally distinct subsets of memory T cells have been described based on the expression of lymph node homing receptors. Central memory T cells express C-C chemokine receptor 7 and CD45RO and are mainly located in T-cell areas of secondary lymphoid organs. Effector memory T cells express CD45RO, lack CCR7 and display receptors associated with lymphocyte homing to peripheral or inflamed tissues. Effector T cells do not express either CCR7 or CD45RO but upon encounter with antigen produce effector cytokines, such as interferon-&#947;. Interferon-&#947; release assays are used for the diagnosis of bovine and human tuberculosis and detect primarily effector and effector memory T cell responses. Central memory T cell responses by CD4+ T cells to vaccination, on the other hand, may be used to predict vaccine efficacy, as demonstrated with simian immunodeficiency virus infection of non-human primates, tuberculosis in mice, and malaria in humans. Several studies with mice and humans as well as unpublished data on cattle, have demonstrated that interferon-&#947; ELISPOT assays measure central memory T cell responses. With this assay, peripheral blood mononuclear cells are cultured in decreasing concentration of antigen for 10 to 14 days (long-term culture), allowing effector responses to peak and wane; facilitating central memory T cells to differentiate and expand within the culture.

Long-term cultured interferon-&#947; enzyme-linked immunospot assay is used as a measure of central memory responses and correlates with protective anti-mycobacterial vaccine responses. With this assay, peripheral blood mononuclear cells are stimulated with mycobacterial antigens and interleukin-2 for 14 days, enabling differentiation and expansion of central memory T cells.

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is ...

Protective Efficacy and Pulmonary Immune Response Following Subcutaneous and Intranasal BCG Administration in Mice

Despite global coverage of intradermal BCG vaccination, tuberculosis remains one of the most prevalent infectious diseases in the world. Preclinical data have encouraged pulmonary tuberculosis vaccines as a promising strategy to prevent pulmonary disease, which is responsible for transmission. In this work, we describe the methodology used to demonstrate in the mouse model the benefits of intranasal BCG vaccination when compared to subcutaneous. Our data revealed greater protective efficacy following intranasal BCG administration. In addition, our results indicate that pulmonary vaccination triggers a higher immune response in lungs, including Th1 and Th17 responses, as well as an increase of immunoglobulin A (IgA) concentration in respiratory airways. Our data show correlation between protective efficacy and the presence of IL17-producing cells in lungs post-Mycobacterium tuberculosis challenge, suggesting a role for this cytokine in the protective response conferred by pulmonary vaccination. Finally, we detail the global workflow we have developed to study respiratory vaccination in the mouse model, which could be extrapolated to other tuberculosis vaccines, apart from BCG, targeting the mucosal response or other pulmonary routes of administration such as the intratracheal or aerosol.

We herein detail the methodology followed to compare protective efficacy and lung immune response induced by intranasal and subcutaneous immunization with BCG in mouse model. Our results show the benefits of pulmonary vaccination and suggest a role for IL17-mediated response in vaccine-induced protection.

Despite global coverage of intradermal BCG vaccination, tuberculosis remains one of the most prevalent infectious diseases in the world. Preclinical data ...

Immunogenicity Enhancement by Mycobacterium paratuberculosis in Autoimmune Encephalomyelitis

Adjuvant Activity of Mycobacterium paratuberculosis in Enhancing the Immunogenicity of Autoantigens During Experimental Autoimmune Encephalomyelitis

Experimental autoimmune encephalomyelitis (EAE) induced by myelin oligodendrocyte glycoprotein (MOG) requires immunization by a MOG peptide emulsified in complete Freund&#39;s adjuvant (CFA) containing inactivated Mycobacterium tuberculosis. The antigenic components of the mycobacterium activate dendritic cells to stimulate T-cells to produce cytokines that promote the Th1 response via toll-like receptors. Therefore, the amount and species of mycobacteria present during the antigenic challenge are directly related to the development of EAE. This methods paper presents an alternative protocol to induce EAE in C57BL/6 mice using a modified incomplete Freund&#39;s adjuvant containing the heat-killed Mycobacterium avium subspecies paratuberculosis strain K-10.
M. paratuberculosis, a member of the Mycobacterium avium complex, is the causative agent of Johne&#39;s disease in ruminants and has been identified as a risk factor for several human T-cell-mediated disorders, including multiple sclerosis. Overall, mice immunized with Mycobacterium paratuberculosis showed earlier onset and greater disease severity than mice immunized with CFA containing the strain of M. tuberculosis H37Ra at the same doses of 4 mg/mL. The antigenic determinants of Mycobacterium avium subspecies paratuberculosis (MAP)&#160;strain K-10 were able to induce a strong Th1 cellular response during the effector phase, characterized by significantly higher numbers of T-lymphocytes (CD4+ CD27+), dendritic cells (CD11c+ I-A/I-E+), and monocytes (CD11b+ CD115+) in the spleen compared to mice immunized with CFA. Furthermore, the proliferative T-cell response to the MOG peptide appeared to be highest in M. paratuberculosis-immunized mice. The use of an encephalitogen (e.g., MOG35-55) emulsified in an adjuvant containing M. paratuberculosis in the formulation may be an alternative and validated method to activate dendritic cells for priming myelin epitope-specific CD4+ T-cells during the induction phase of EAE.

Author Spotlight: Adjuvant Activity of Mycobacterium paratuberculosis in Enhancing the Immunogenicity of Autoantigens During Experimental Autoimmune Encephalomyelitis  

Here, we present an alternative protocol to actively induce experimental autoimmune encephalomyelitis in C57BL/6 mice, using the immunogenic epitope myelin oligodendrocyte glycoprotein (MOG)35-55 suspended in incomplete Freund's adjuvant containing the heat-killed Mycobacterium avium subspecies paratuberculosis.

Experimental autoimmune encephalomyelitis (EAE) induced by myelin oligodendrocyte glycoprotein (MOG) requires immunization by a MOG peptide emulsified in ...

Enrichment of Native and Recombinant Extracellular Vesicles of Mycobacteria

Most bacteria, including mycobacteria, generate extracellular vesicles (EVs). Since bacterial EVs (bEVs) contain a subset of cellular components, including metabolites, lipids, proteins, and nucleic acids, several groups have evaluated either the native or recombinant versions of bEVs for their protective potency as subunit vaccine candidates. Unlike native EVs, recombinant EVs are molecularly engineered to contain one or more immunogens of interest. Over the last decade, different groups have explored diverse approaches for generating recombinant bEVs. However, here, we report the design, construction, and enrichment of recombinant mycobacterial EVs (mEVs) in mycobacteria. Towards that, we use Mycobacterium smegmatis (Msm), an avirulent soil mycobacterium as the model system. We first describe the generation and enrichment of native EVs of Msm. Then, we describe the design and construction of recombinant mEVs that contain either mCherry, a red fluorescent reporter protein, or EsxA (Esat-6), a prominent immunogen of Mycobacterium tuberculosis. We achieve this by separately fusing mCherry and EsxA N-termini with the C-terminus of a small Msm protein Cfp-29. Cfp-29 is one of the few abundantly present proteins of MsmEVs. The protocol to generate and enrich recombinant mEVs from Msm remains identical to the generation and enrichment of native EVs of Msm.

This protocol details the enrichment of native mycobacterial extracellular vesicles (mEVs) from axenic cultures of Mycobacterium smegmatis (Msm) and how mCherry (a red fluorescent reporter)-containing recombinant MsmEVs can be designed and enriched. Lastly, it verifies the novel approach with the enrichment of MsmEVs containing the EsxA protein of Mycobacterium tuberculosis.

Most bacteria, including mycobacteria, generate extracellular vesicles (EVs). Since bacterial EVs (bEVs) contain a subset of cellular components, ...

Accelerating Tuberculosis Determination Using the Micro-CFU Method

Micro-Colony Forming Unit Assay for Efficacy Evaluation of Vaccines Against Tuberculosis

Tuberculosis (TB), the leading cause of death worldwide by an infectious agent, killed 1.6 million people in 2022, only being surpassed by COVID-19 during the 2019-2021 pandemic. The disease is caused by the bacterium Mycobacterium tuberculosis (M.tb). The Mycobacterium bovis strain Bacillus Calmette-Gu&#233;rin (BCG), the only TB vaccine, is the oldest licensed vaccine in the world, still in use. Currently, there are 12 vaccines in clinical trials and dozens of vaccines under pre-clinical development. The method of choice used to assess the efficacy of TB vaccines in pre-clinical studies is the enumeration of bacterial colonies by the colony-forming units (CFU) assay. This time-consuming assay takes 4 to 6 weeks to conclude, requires substantial laboratory and incubator space, has high reagent costs, and is prone to contamination. Here we describe an optimized method for colony enumeration, the micro-CFU (mCFU), that offers a simple and rapid solution to analyze M.tb vaccine efficacy results. The mCFU assay requires tenfold fewer reagents, reduces the incubation period threefold, taking 1 to 2 weeks to conclude, reduces lab space and reagent cost, and minimizes the health and safety risks associated with working with large numbers of M.tb. Moreover, to evaluate the efficacy of a TB vaccine, samples may be obtained from a variety of sources, including tissues from vaccinated animals infected with Mycobacteria. We also describe an optimized method to produce a unicellular, uniform, and high-quality mycobacterial culture for infection studies. Finally, we propose that these methods should be universally adopted for pre-clinical studies of vaccine efficacy determination, ultimately leading to time reduction in the development of vaccines against TB.

Author Spotlight: Optimizing CFU Determination for Efficient Assessment of TB Vaccine Efficacy and Antigen Presentation Analysis 

The determination of colony-forming units (CFU) is the gold-standard technique for quantifying bacteria, including Mycobacterium tuberculosis which can take weeks to form visible colonies. Here we describe a micro-CFU for CFU determination with increased time efficiency, reduced lab space and reagent cost, and scalability to medium and high throughput experiments.

Tuberculosis (TB), the leading cause of death worldwide by an infectious agent, killed 1.6 million people in 2022, only being surpassed by COVID-19 during ...

Medicine

Preparation and Quantification of Mycobacterium bovis BCG lux Inoculum for Infection

Source: Asai, M. et al., <a href="https://app.jove.com/v/59703">Use of the Invertebrate Galleria mellonella as an Infection Model to Study the Mycobacterium tuberculosis Complex.</a> J. Vis. Exp. (2019)
This video demonstrates the preparation and quantification of Mycobacterium bovis Bacillus Calmette-Gu&#233;rin lux inoculum using bioluminescence assay and the enumeration of colony-forming units. The prepared inoculum can be used for infection studies.

Source: Asai, M. et al., Use of the Invertebrate Galleria mellonella as an Infection Model to Study the Mycobacterium tuberculosis Complex. J. Vis. Exp. ...

JoVE Encyclopedia of Experiments

Immunology

Immunopathology

Assay and Analysis

Subcutaneous Injection of Bacterial Antigen to Induce Systemic Inflammation in a Murine Model

Source: John, S. et al., <a href="https://app.jove.com/v/62925">Primed Mycobacterial Uveitis (PMU) as a Model for Post-Infectious Uveitis.</a>&#160;J. Vis. Exp. (2021)
This video demonstrates the induction of systemic inflammation in an anesthetized mouse. The injection of mycobacterial antigen-adjuvant depots triggers cytokine release and localized inflammation. Lymphatic vessels open, enabling immune cell entry into lymph nodes and activation of T cells, which release pro-inflammatory cytokines, leading to widespread inflammation.

Source: John, S. et al., Primed Mycobacterial Uveitis (PMU) as a Model for Post-Infectious Uveitis.&#160;J. Vis. Exp. (2021)
This video demonstrates the ...

Host-Pathogen Interaction Models

An Avidin-Biotin Conjugation Technique for Presenting Target Antigens on Mycobacterium bovis BCG

Source: Liao, T. A., et al., <a href="https://app.jove.com/v/56421">Expression of Exogenous Antigens in the Mycobacterium bovis BCG Vaccine via Non-genetic Surface Decoration with the Avidin-biotin System.</a> J. Vis. Exp. (2018).
The video demonstrates a technique for loading antigens on Mycobacterium bovis BCG to improve its immunogenic properties. The method uses the avidin-biotin system to coat the bacterial surface with exogenous antigens.

1. Biotinylation of BCG Cell Surface

	Grow BCG in Middlebrook 7H9 broth with 10% OADC (oleic acid, albumin and dextrose solution) and 0.05% Tween 80 at ...

Immunotherapy

Immunogenics and Vaccine Development

A Technique to Detect Extrapulmonary Tuberculosis via Superparamagnetic Nanoprobes

Source: Lee, C., et al. <a href="https://app.jove.com/v/58227">Synthesis, Characterization, and Application of Superparamagnetic Iron Oxide Nanoprobes for Extrapulmonary Tuberculosis Detection.</a> J. Vis. Exp. (2020).
This video demonstrates a technique for the detection of extrapulmonary tuberculosis. Superparamagnetic iron oxide (SPIO) nanoprobes, conjugated to Mycobacterium-specific antibodies, are injected into a mouse previously infected with Mycobacterium bovis BCG, labeling the granuloma and providing a better imaging contrast for its detection.

All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.
1. ...

Expression of Exogenous Antigens in the Mycobacterium bovis BCG Vaccine via Non-genetic Surface Decoration with the Avidin-biotin System

Samenvatting

Meer video's verkennen