This work was supported in part by the I-CORE program (grants No. 41/11), the Israel Science Foundation (grant No. 908/15), and the European Crohn&#39;s and Colitis Organization (ECCO).

Ethical approval for the study was granted by the Sheba Local Research Ethics Committee and all methods were performed in accordance with the relevant guidelines and regulations. The protocol received a patient consent exception from the local Ethical Review Board, since the fecal material that were used were already submitted to the microbiology core as part of clinical workup and without identifiable patient information other than age, gender, and microbial results. Written, informed consent was obtained from healthy volunteers and the Institutional Review Board approved the study. Some of those samples have already been included in a previous analysis1.
1. Sample Handling
<ol>
	<li>Collect an approximately 5 mm2 smear (roughly the size of a pencil eraser) from a fresh fecal sample with a sterile swab in a test tube (see Table of Materials). Store all swabs containing fecal samples at -80 &#176;C within 24 h. The fecal swabs can remain there until further processing.</li>
</ol>
2. DNA Extraction
<ol>
	<li>Thaw the Extraction and Dilution solutions at room temperature (see Table of Materials).</li>
	<li>Transfer the fecal swab into an empty 2 mL collection tube (see Table of Materials). Adjust the swab stick size by cutting it using a clean scissors to enable tube closure with minimum cross-contamination. Add 250 &#956;L of Extraction solution to each collection tube containing the fecal swab and vortex to mix.</li>
	<li>Heat the samples for 10 min in a boiling water bath (95&#8211;100 &#176;C). Add 250 &#956;L of Dilution solution to each sample and vortex to mix.</li>
	<li>Store the 2 mL tubes containing the extracted DNA and the swab at 4 &#176;C.</li>
</ol>
3. PCR and Library Preparation
For steps 3.1 and 3.2, work in a PCR workstation that provides clean, template and amplicon free environment.
<ol>
	<li>Label the primers (Table 1) according to their barcode. Dilute each primer in double distilled water (DDW) to a 50 &#956;M concentration and store at -20 &#176;C.</li>
	<li>Use a 96-well plate for PCR reactions. Each plate can contain 32 different samples, which are tagged by 32 different index primers. Thaw the forward primer and the 32 reverse primers at room temperature and dilute them to 5 &#956;M.</li>
	<li>Prepare PCR reaction mixes for 100 reactions (final volume in each well will be 20 &#956;l) by mixing 100 &#956;L of 5 &#956;M Forward primer, 1 mL 2X PCR Master mix, and 400 &#956;L DDW. Put 15 &#956;L of this PCR mix in each well (total of 96 wells). Add 1 &#956;L of each 5 &#956;M Reverse indexed primer to 3 different wells (32 different primers in triplicates gives a total of 96 wells).</li>
	<li>In a pre-PCR dedicated zone, meaning a clean bench that is template and amplicon free, add 4 &#956;L of each extracted DNA sample to reaction mixtures (each extracted DNA sample is amplified in triplicate &#8212; 32 samples per 96-well plate).</li>
	<li>Run PCR with the following settings: initial denaturation of 94 &#176;C for 3 min; followed by 35 cycles of denaturation at 94 &#176;C for 1 min, annealing at 55 &#176;C for 1 min, and extension at 72 &#176;C for 1 min; and a final extension at 72 &#176;C for 10 min.</li>
	<li>On a different bench, which will be defined as a post-PCR dedicated zone, combine each triplicate PCR reaction into a single volume tube (60 &#956;L per sample).</li>
	<li>To assess the quality of PCR amplicons, run 4 &#956;L of each combined-PCR reaction on an ethidium bromide-stained 1% agarose gel. Under UV wavelength of 260 nm, the positive amplicons will appear in an expected band size of 375&#8211;425 bp. Only these amplicons will be included in the subsequent steps. 
	NOTE: Each sample is amplified in triplicate, meaning that each sample is amplified in 3 different PCR reactions. Do not scale up.</li>
</ol>
4. Library Quantification and Cleaning
<ol>
	<li>In order to get an equimolar concentration pool of all PCR samples, quantify each amplicon by a double stranded DNA (dsDNA quantify reagent) florescent nucleic acid stain (see Table of Materials), suitable for the simultaneous quantification of a large amount of samples. 
	NOTE: Since the size range of the amplicon is equivocal, the actual amount in nanograms is used to load an equimolar concentration.</li>
	<li>Combine 500 ng of each sample into a single, sterile tube. Vortex to mix.</li>
	<li>Run 200 &#956;L of the pooled library on an Ethidium Bromide-stained 1% agarose gel. Extract the 375&#8211;425 bp bands from the gel using a gel extraction kit according to the manufacturer&#39;s instructions (see Table of Materials) and elute the pooled library in 80 &#956;L DDW. 
	NOTE: The pooled library should be size selected to reduce non-specific amplification products from host DNA.</li>
	<li>Measure the final library concentration using a highly sensitive dsDNA detecting kit according to the manufacturer&#39;s instructions (see Table of Materials). Measure the accurate library size using a highly sensitive separation and analysis kit for DNA libraries according to the manufacturer&#39;s instructions (see Table of Materials).</li>
</ol>
5. Sequencing
<ol>
	<li>Dilute the pooled library to 7 pM with addition of 20% control library (see Table of Materials), according to the sequencing machine protocol.</li>
	<li>For sequencing, use custom designed read primers that are complimentary to the V4 amplification primers (see Table 1).</li>
	<li>Use a third custom designed sequencing primer that reads the barcode in an additional cycle (see Table 1) and generates paired-end reads of 175 bases in length in each direction, according to the manufacturer&#39;s specifications.</li>
	<li>Run the sequencing machine and obtain FASTQ files according to the manufacturer&#39;s protocol.</li>
</ol>
6. Data Processing
<ol>
	<li>Stitch together and process the overlapping paired-end FASTQ files in a data curation pipeline implemented in QIIME 2 version 2017.7.017. Demultiplex the reads according to sample specific barcodes.</li>
	<li>Use DADA218 for quality control and sequence variant (SVs) detection. Truncate reads at 13 bases from the 3&#39; end and 15 bases from the 5&#39; end, discard reads with more than 2 expected errors. Identify and remove the chimeras using the consensus method &#8212; chimeras are detected in samples individually, and sequences found chimeric in a sufficient fraction of samples are removed.</li>
	<li>Perform SVs taxonomic classification using a Naive Bayes fitted classifier, trained on the August 2013 99% identity Greengenes database6, for 175 long reads and the Forward/Reverse primer set.</li>
	<li>Rarefy all samples to depth of 2,146 sequences.</li>
	<li>Use Unweighted UniFrac for measurement of &#946;-diversity (between sample diversity19,20) on the rarefied samples, to avoid a sample size effect.</li>
	<li>Use the resulting distance matrix to perform a principal coordinates analysis (PCoA). 
	NOTE: The data processing script and mapping files are provided as supplementary material (Supplementary Material 1 and 2).</li>
</ol>

<ol>
	<li>Braun, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fecal+microbial+characterization+of+hospitalized+patients+with+suspected+infectious+diarrhea+shows+significant+dysbiosis.">Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis.</a> Scientific Reports. 7, 1088 (2017).</li><li>De Filippo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+diet+in+shaping+gut+microbiota+revealed+by+a+comparative+study+in+children+from+Europe+and+rural+Africa.">Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa.</a> Proceedings of the National Academy of Sciences of the United States of America. 107, 14691-14696 (2010).</li><li>Yatsunenko, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+gut+microbiome+viewed+across+age+and+geography.">Human gut microbiome viewed across age and geography.</a> Nature. 486, 222-227 (2012).</li><li>Rodriguez, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+composition+of+the+gut+microbiota+throughout+life,+with+an+emphasis+on+early+life.">The composition of the gut microbiota throughout life, with an emphasis on early life.</a> Microbial Ecology in Health and Disease. 26, 26050 (2015).</li><li>Turnbaugh, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+obesity-associated+gut+microbiome+with+increased+capacity+for+energy+harvest.">An obesity-associated gut microbiome with increased capacity for energy harvest.</a> Nature. 444, 1027-1031 (2006).</li><li>McDonald, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+Greengenes+taxonomy+with+explicit+ranks+for+ecological+and+evolutionary+analyses+of+bacteria+and+archaea.">An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea.</a> The ISME Journal. 6, 610-618 (2012).</li><li>Bakken, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Treating+Clostridium+difficile+infection+with+fecal+microbiota+transplantation.">Treating Clostridium difficile infection with fecal microbiota transplantation.</a> Clinical Gastroenterology and Hepatology. 9, 1044-1049 (2011).</li><li>Khoruts, A., Dicksved, J., Jansson, J. K., Sadowsky, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changes+in+the+composition+of+the+human+fecal+microbiome+after+bacteriotherapy+for+recurrent+Clostridium+difficile-associated+diarrhea.">Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea.</a> Journal of Clinical Gastroenterology. 44, 354-360 (2010).</li><li>Nood, E. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Duodenal+infusion+of+donor+feces+for+recurrent+Clostridium+difficile.">Duodenal infusion of donor feces for recurrent Clostridium difficile.</a> The New England Journal of Medicine. 368, 407-415 (2013).</li><li>Koplan, J. P., Benfari Ferraro, M. J., Fineberg, H. V., Rosenberg, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Value+of+stool+cultures.">Value of stool cultures.</a> The Lancet. 316, 413-416 (1980).</li><li>Platts-Mills, J. A., Liu, J., Houpt, E. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+concepts+in+diagnostics+for+infectious+diarrhea.">New concepts in diagnostics for infectious diarrhea.</a> Mucosal Immunology. 6, 876-885 (2013).</li><li>Bokulich, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quality-filtering+vastly+improves+diversity+estimates+from+Illumina+amplicon+sequencing.">Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing.</a> Nature Methods. 10, 57-59 (2013).</li><li>Leek, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tackling+the+widespread+and+critical+impact+of+batch+effects+in+high-throughput+data.">Tackling the widespread and critical impact of batch effects in high-throughput data.</a> Nature Reviews Genetics. 11, (2010).</li><li>Dubilier, N., McFall-Ngai, M., Zhao, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Create+a+global+microbiome+effort.">Create a global microbiome effort.</a> Nature. 526, 631-634 (2015).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+patterns+of+16S+rRNA+diversity+at+a+depth+of+millions+of+sequences+per+sample.">Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample.</a> PNAS. 108, 4516-4522 (2011).</li><li>Flores, G. E., Henley, J. B., Fierer, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+direct+PCR+approach+to+accelerate+analyses+of+human-associated+microbial+communities.">A direct PCR approach to accelerate analyses of human-associated microbial communities.</a> PloS One. 7, (2012).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=QIIME+allows+analysis+of+high-throughput+community+sequencing+data.">QIIME allows analysis of high-throughput community sequencing data.</a> Nature Methods. 7, 335-336 (2010).</li><li>Callahan, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DADA2:+High-resolution+sample+inference+from+Illumina+amplicon+data.">DADA2: High-resolution sample inference from Illumina amplicon data.</a> Nature Methods. 13, 581-583 (2016).</li><li>Lozupone, C., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UniFrac:+A+new+phylogenetic+method+for+comparing+microbial+communities.">UniFrac: A new phylogenetic method for comparing microbial communities.</a> Applied and Environmental Microbiology. 71, 8228-8235 (2005).</li><li>Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UniFrac:+An+effective+distance+metric+for+microbial+community+comparison.">UniFrac: An effective distance metric for microbial community comparison.</a> The ISME Journal. 5, 169-172 (2011).</li><li>Srinivasan, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+16S+rRNA+gene+for+identification+of+a+broad+range+of+clinically+relevant+bacterial+pathogens.">Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens.</a> PloS One. 10, e0117617 (2015).</li><li>Hiergeist, A., Gl&#228;sner, J., Reischl, U., Gessner, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analyses+of+intestinal+microbiota:+culture+versus+sequencing.">Analyses of intestinal microbiota: culture versus sequencing.</a> ILAR Journal. 56, 228-240 (2015).</li><li>Didelot, X., Bowden, R., Wilson, D. J., Peto, T. E. A., Crook, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transforming+clinical+microbiology+with+bacterial+genome+sequencing.">Transforming clinical microbiology with bacterial genome sequencing.</a> Nature Reviews Genetics. 13, 601-612 (2012).</li><li>Salipante, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+16S+rRNA+next-generation+sequencing+of+polymicrobial+clinical+samples+for+diagnosis+of+complex+bacterial+infections.">Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections.</a> PloS One. 8, e65226 (2013).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultra-high-throughput+microbial+community+analysis+on+the+Illumina+HiSeq+and+MiSeq+platforms.">Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms.</a> The ISME Journal. 6, 1621-1624 (2012).</li></ol>

The authors have nothing to disclose.

16S rRNA-amplicon and metagenomics shotgun sequencing have gained popularity in clinical microbiology applications21,22,23. These techniques are advantageous in their increased ability to capture culturable and non-culturable taxa, providing data about the relative abundance of the pathogenic inoculum, and their ability to identify more precisely a polymicrobial infectious fingerprint24. The advances in the field of microbiome research have generated vast amounts of data that are not easily comparable due to a lack of consistency in the various approaches. In recent years, several consortiums have attempted to address some of these issues. This protocol follows similar library preparation as the earth microbiome project (EMP). However, added is a detailed step-by-step protocol for DNA extraction from fecal samples through analyses pipeline.
Previously, 16S rRNA sequencing has been used to characterize the microbial composition patterns of fecal samples from healthy non-hospitalized subjects and from hospitalized patients with suspected infectious diarrhea, and to traditional culture results. The results from that analysis showed that hospitalized patients have profound increases in taxa from Proteobacteria phylum1. Described here is an integrated protocol of broadly used methods for 16S rRNA gene amplicon sequencing using the direct PCR columns-free approach that was originally designed for extraction of plant DNA16. This approach can efficiently and quickly extract good-quality amplified-DNA libraries targeting the V4 variable region of the 16S rRNA gene from a large number of samples suitable for high-throughput 16S rRNA sequencing.
As this is a DNA-based sequencing method, data on both aerobes and anaerobes microbial communities present in an individual fecal sample are obtained. The protocol adopted the primers that were originally designed15 against the V4 region of the 16S rRNA gene. Importantly, the reverse amplification primer contain a twelve base barcode sequence that supports pooling of up to 2,167 different samples in each lane15. The forward amplification primer includes nine extra bases in the adapter region that support paired-end sequencing on the sequencing platform25 (Table 1 and Supplementary Material 3). This approach enabled handling a library composed of 250 fecal samples that were sequenced on one lane with a running depth of 10622.57 &#177; 1211.34 (mean &#177; standard error) reads per sample at a cost of ~30 dollars per sample.
To ensure quality control, we suggest using the following negative controls; i) PCR without DNA template, ii) PCR on DNA extracted from a clean sterile swab, and iii) PCR on mixed extraction and dilution solution. As for positive controls, we recommend including samples that originated from the same stool sample but went through different library preparation with different reverse barcoded primers and samples from previous runs as internal quality control. Of note, other optional positive controls to be used are those microbiome measurement standards provided by NIST. The average reads coverage for the negative controls is remarkably lower in comparison to the actual stool samples (Table 1) and was composed primarily from the Mycoplasma taxa. We further showed the consistency of the sequencing results obtained using samples that each originated from the same fecal material but that went through different library preparation (Figure 3). This result also confirms that, when using our integrated method, there is no cross-contamination between samples.
In this protocol we introduce an integrated uniformed, feasible protocol to analyze large numbers of samples. This protocol aims to guide scientists interested in initiating the use of 16S rRNA-amplicon sequencing in a robust, reproductive, easy to use, inexpensive, detailed way from fecal collection to data analyses, using important controls. Using this standardized detailed guided protocol, may minimize batch effects and allow more comparable sequencing results between different labs.

Concentrated efforts have been made to better understand microbiome diversity and abundance, as another aspect of capturing difference and similarities between individuals in healthy and pathological conditions. Age2,3, geography4, lifestyle5,6, and illness5 were shown to be associated with the composition of the gut microbiome, but many conditions and populations have not yet been fully characterized. Recently it has been reported that the microbiome can be modified for therapeutic applications7,8,9. Therefore, additional insight into the relationship between various physiological conditions and the microbial composition is the first step toward optimization of potential future modifications.
The traditional microbial culture methods are limited by low yields10,11, and are conceptualized as a binary state where a bacteria is either present in the gut or not. High-throughput DNA-based sequencing has revolutionized microbial ecology, enabling the capture of all members of the microbial community. However, sequence read length and quality remain significant barriers to accurate taxonomy assignment12. Furthermore, high-throughput based experiments may suffer from batch effects, where measurements are affected by non-biological or non-scientific variables13. In recent years, several programs have been established to study the human microbiome, including the American Gut project, the United States (US) Human Microbiome Project, and the United Kingdom (UK) MetaHIT project. These initiatives have generated vast amounts of data that are not easily comparable due to a lack of consistency in their approaches. A variety of international projects such as the International Human Microbiome Consortium, the International Human Microbiome Standards project, and the National Institute of Standards and Technology (NIST) attempted to address some of these issues14, and developed standards for microbiome measurements which should enable the achievement of reliable reproductive results. Described here is an integrated protocol of several broadly used methods15,16 for 16S rRNA high-throughput sequencing (16S-seq) starting from fecal sample collection thru data analyses. The protocol describes a column-free PCR approach, originally designed for direct extraction of plant DNA16, to enable the simultaneous handling of large numbers of fecal samples in a relatively short time with high quality amplified DNA for targeted sequencing of the microbial variable V4 region on a common sequencing platform. This protocol aims to guide scientists interested in initiating the use of 16S rRNA-amplicon sequencing in a robust, reproductive, easy to use, detailed way, using important controls. Having a guided and detailed step-by step protocol may minimize batch effect and thus will allow more comparable sequencing results between labs.

<table><tbody><tr><td>Primers</td><td>Integrated DNA Technologies (IDT)</td><td></td><td></td></tr><tr><td>Extraction solution</td><td>Sigma-Aldrich</td><td>E7526</td><td></td></tr><tr><td>Dilution solution</td><td>Sigma-Aldrich</td><td>D5688</td><td></td></tr><tr><td>Kapa HiFi HotStart ReadyMix PCR Kit</td><td>KAPABIOSYSTEMS</td><td>KK2601</td><td>PCR Master mix</td></tr><tr><td>Quant-iT PicoGreen dsDNA Reagent kit</td><td>Invitrogen</td><td>P7589</td><td>dsDNA quantify reagent</td></tr><tr><td>MinElute Gel extraction kit</td><td>Qiagen</td><td>28606</td><td></td></tr><tr><td>Agarose</td><td>Amresco</td><td>0710-250G</td><td></td></tr><tr><td>Ultra Pure Water Dnase and Rnase Free</td><td>Biological Industries</td><td>01-866-1A</td><td></td></tr><tr><td>Qubit dsDNA HS assay kit</td><td>Molecular probes</td><td>Q32854</td><td>dsDNA detecting kit</td></tr><tr><td>High Sensitivity D1000</td><td>Agilent Technologies</td><td>Screen Tape 5067-5582</td><td>separation and analysis</td></tr><tr><td>Screen Tape Assay</td><td>Agilent Technologies</td><td>Reagents 5067-5583</td><td>for DNA libraries</td></tr><tr><td>PhiX Control v3</td><td>Illumina</td><td>15017666</td><td>control library</td></tr><tr><td>MiSeq Reagent Kit v2 (500 cycle)</td><td>Illumina</td><td>MS-102-2003</td><td></td></tr><tr><td>Ethidium Bromide</td><td>Amresco</td><td>E406-10mL-TAM</td><td></td></tr><tr><td>2 mL collection tubes</td><td>SARSTEDT</td><td>72.695.400</td><td>Safe Seal collection tubes</td></tr><tr><td>Plastic stick swab in PP test tube</td><td>STERILE INTERIOR</td><td>23117</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>PCR Machine</td><td>Applied Biosystems</td><td>2720 Thermal Cycler</td><td></td></tr><tr><td>Sequncing Machine</td><td>Illumina</td><td>Miseq</td><td></td></tr><tr><td>PCR workstation</td><td>Biosan</td><td>UV-cleaner</td><td></td></tr><tr><td>scissors</td><td></td><td></td><td></td></tr><tr><td>vortexer</td><td>Scientific Industries</td><td>Vortex-Genie 2</td><td></td></tr></tbody></table>

guided protocol for fecal microbial characterization by 16s rrna-amplicon sequencing

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. Deviations from what is considered a healthy microbiota composition (dysbiosis) may impair vital functions leading to pathologic conditions. Recent and ongoing research efforts have been directed toward the characterization of associations between microbial composition and human health and disease.
Advances in high-throughput sequencing technologies enable characterization of the gut microbial composition. These methods include 16S rRNA-amplicon sequencing and shotgun sequencing. 16S rRNA-amplicon sequencing is used to profile taxonomical composition, while shotgun sequencing provides additional information about gene predictions and functional annotation. An advantage in using a targeted sequencing method of the 16S rRNA gene variable region is its substantially lower cost compared to shotgun sequencing. Sequence differences in the 16S rRNA gene are used as a microbial fingerprint to identify and quantify different taxa within an individual sample.
Major international efforts have enlisted standards for 16S rRNA-amplicon sequencing. However, several studies report a common source of variation caused by batch effect. To minimize this effect, uniformed protocols for sample collection, processing, and sequencing must be implemented. This protocol proposes the integration of broadly used protocols starting from fecal sample collection to data analyses. This protocol includes a column-free, direct-PCR approach that enables simultaneous handling and DNA extraction of large numbers of fecal samples, along with PCR amplification of the V4 region. In addition, the protocol describes the analysis pipeline and provides a script using the latest version of QIIME (QIIME 2 version 2017.7.0 and DADA2). This step-by-step protocol is aimed to guide those interested in initiating the use of 16S rRNA-amplicon sequencing in a robust, reproductive, easy to use, detailed way.

A schematic illustration of the protocol is shown in Figure 1.
We have prospectively collected stool samples from hospitalized patients with suspected infectious diarrhea. Those samples were submitted to the Clinical Microbiology Lab at the Sheba Medical Center between February and May 2015, as was previously described1. Stool samples were subjected to conventional microbiological culture performed at the Clinical Microbiology Lab and to broad range high-throughput 16S-seq in parallel. In addition, stool samples from healthy adults were sequenced for comparison.
In this analysis, the focus was on the quality control of the data, and show representative results of the output obtained from QIIME217. Initially, sequencing results achieved in 6 negative control samples were reviewed for quality control including: i) PCR without template, ii) PCR on clean and sterile swabs in extraction and dilution solution, and iii) PCR on mixed extraction and dilution solutions. Table 2 shows that all negative control samples had &#8804;118 total reads (average of 29 sequences), primarily from the Mycoplasma taxa, while all other samples analyzed showed mean total reads of 10622.57 (&#177;1211.34 standard error) and no Mycoplasma read passed the quality control of the main samples.
Sixteen samples that each originated from the same stool sample but went through different library preparation with different reverse barcoded primers were used as positive controls. Those 16 samples included 8 with positive cultures for Campylobacter, Salmonella, or Shigella that were reported by the clinical microbiology lab, and 8 that were reported as having negative cultures. An area plot at the phyla level is shown in Figure 2. Samples that originated from the same stool sample but went through different library preparation with different reverse barcoded primers show very consistent relative abundance (Mantel test between duplicates of phylum level taxonomic relative abundance values simulated p-value = 1 x 10-04 based on 9999 replicates).
Principal coordinates analysis (PCoA), which reduces dimensionality of the input data, was used on the UniFrac matrix to visually explore sample separation and similarity. In Figure 3A, sequenced samples that originated from the same original stool sample but went through different library preparation are colored the same. Indeed, those are located relatively closely in the PCoA plot (Mantel test between duplicates PC1 PC2 values simulated p-value = 1e-04 based on 9999 replicates). In addition, the average unweighted unifrac beta diversity distance between samples in this study is 0.706, while the average distance between two duplicates is 0.235 (Wilcoxon rank sum test p-value = 4.205 x 10-11). Interestingly, samples that were culture positive for Campylobacter, Salmonella, or Shigella enteropathogens showed significantly different PC1 values (Wilcoxon rank sum test p-value = 0.011) in comparison to samples with negative culture results. Figure 3B shows the same PCoA plot but now samples are colored by the relative abundance of Proteobacteria. Samples with high Proteobacteria abundance had significantly different PC1 values (Spearman correlation r = -0.533, p-value = 0.000975). Those results are consistent with previous analysis of this data, where hospitalized patients have profound increases in taxa from Proteobacteria phylum1. Here we showed that PC1 is correlated with Proteobacteria abundance, with culture positive samples clustering mostly on the one side of the PC1 axis and culture negative samples clustering mostly on the other side, together with the healthy samples.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56845/56845fig1.jpg" /> 
Figure 1: Flow chart from fecal samples to relative microbial abundance. 1) Sample handling: Left, fecal samples are collected in a sterile swab tube. Right, the swab stick size is adjusted by cutting it to enable the closure of 2ml tube, and storage. 2) DNA extraction: DNA is extracted by direct PCR columns-free approach. 3) Library preparation: Left, 4 &#956;L of extracted DNA is amplified with Forward/Reverse-index primers. Each reverse primer contains a 12 base barcode. Each sample is amplified in triplicate. A 96-well plate contains 32 different barcodes. Right, combine each barcode triplicate into a single volume tube. A 96-well plate contains 96 different barcodes. 4) Library quantification: Upper panel, screening for positive samples, amplicons were detected on Ethidium Bromide-stained 1% agarose gel. Lower panel, quantification of the positive amplicons to reach equimolar concentration of 500 ng amplicon from each sample into a single library pool. 5) Library purification: Upper panel, the pooled library is gel extracted for size selection and purification. Lower panel, the library exact size and concentration is measured. 6) Sequencing: high-throughput sequencing of the pooled library. 7) The sequencing data is analyzed by a bioinformatic pipeline for 16S rRNA-amplicon microbial ecology. <a href="https://cloudflare.jove.com/files/ftp_upload/56845/56845fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56845/56845fig2.jpg" /> 
Figure 2: Consistent relative abundance between samples that originated from the same stool sample but went through different library preparation. Taxonomic relative abundance at the phylum level is shown per sample as indicated. Relative abundance is shown for 16 fecal samples obtained from hospitalized patients with suspected infectious diarrhea that each went through different library preparation (Duplicate 1 and 2) with different reverse barcoded primers and of 3 healthy controls. <a href="https://cloudflare.jove.com/files/ftp_upload/56845/56845fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56845/56845fig3.jpg" /> 
Figure 3: Phylogenetic diversity show consistent results for samples that originated from the same stool sample but went through different library preparation. Principal coordinates analysis (PCoA) that reduces dimensionality of the input data was used on the UniFrac matrix to visually explore sample separation and similarity. The distance between two samples represents the difference in their microbiome composition. (A) Unweighted UniFrac PCoA plot. Each point represents a single sequenced sample. Samples originated from the same original stool sample are colored the same. Samples from hospitalized patients with positive stool culture reported by the clinical microbiology1 are marked by squares, hospitalized patients with culture negative in triangles1, and healthy adults from a separate sequencing run1 are marked with filled in circles. (B) Same PCoA as in A, but samples are now colored by their relative abundance of Proteobacteria, as indicated. <a href="https://cloudflare.jove.com/files/ftp_upload/56845/56845fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer name</td>
			<td>Primer sequence</td>
			<td>Primer description</td>
		</tr>
		<tr>
			<td>Forward primer</td>
			<td>AATGATACGGCGACCACCGAGATCTACAC - TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA</td>
			<td>5&#39; adapter sequence - Forward primer pad - Forward primer linker - Forward primer&#160;</td>
		</tr>
		<tr>
			<td>Reverse index primer</td>
			<td>CAAGCAGAAGACGGCATACGAGAT - XXXXXXXXXXXX - AGTCAGTCAG - CC - GACTACHVGGGTWTCTAAT</td>
			<td>Reverse complement of 3&#39; adapter sequence -&#160; Golay barcode - Reverse primer pad - Reverse primer linker -&#160; Reverse primer</td>
		</tr>
		<tr>
			<td>Read 1 sequencing primer</td>
			<td>TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA</td>
			<td>Forward primer pad -&#160; Forward primer linker -&#160; Forward primer</td>
		</tr>
		<tr>
			<td>Read 2 sequencing primer</td>
			<td>AGTCAGTCAG - CC - GGACTACHVGGGTWTCTAAT</td>
			<td>Reverse primer pad -&#160; Reverse primer linker -&#160; Reverse primer</td>
		</tr>
		<tr>
			<td>Index sequence primer</td>
			<td>ATTAGAWACCCBDGTAGTCC - GG - CTGACTGACT</td>
			<td>Reverse complement of reverse primer -&#160; Reverse complement of reverse primer linker -&#160; Reverse complement of reverse primer pad</td>
		</tr>
	</tbody>
</table>
Table 1: Primer list.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Sample</td>
			<td>Number of reads post 
			initial quality control in 
			QIIME</td>
		</tr>
		<tr>
			<td>PCR on clean swabs in extraction and dilution solution -1</td>
			<td>118</td>
		</tr>
		<tr>
			<td>PCR on clean swabs in extraction and dilution solution -2</td>
			<td>39</td>
		</tr>
		<tr>
			<td>PCR without template -1</td>
			<td>0</td>
		</tr>
		<tr>
			<td>PCR without template -2</td>
			<td>0</td>
		</tr>
		<tr>
			<td>PCR on extraction and dilution solutions mix - 1&#160;</td>
			<td>16</td>
		</tr>
		<tr>
			<td>PCR on extraction and dilution solutions mix - 2</td>
			<td>0</td>
		</tr>
		<tr>
			<td>Samples (mean &#177; standard error)</td>
			<td>10622.57 &#177; 1211.34</td>
		</tr>
	</tbody>
</table>
Table 2: Number of reads for negative controls and for fecal samples.
Supplementary Material 1: Data processing script. <a href="http://cloudflare.jove.com/files/ftp_upload/56845/56845_Suppl1_script.txt">Please click here to download this file.</a>
Supplementary Material 2: Mapping file. <a href="http://cloudflare.jove.com/files/ftp_upload/56845/56845_Suppl2_map.txt">Please click here to download this file.</a>
Supplementary Material 3: Primer scheme. <a href="http://cloudflare.jove.com/files/ftp_upload/56845/56845_Suppl3_schematic_primers_representation.pptx">Please click here to download this file.</a>

Watch this Scientific Journal Video about Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing at JoVE.com

Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

This manuscript describes a detailed standardized protocol of high-throughput 16S rRNA-amplicon sequencing. The protocol introduces an integrated, uniformed, feasible, and inexpensive protocol starting from fecal sample collection through data analyses. This protocol enables analysis of large numbers of samples with rigorous standards and several controls.

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. ...

guided-protocol-for-fecal-microbial-characterization-16s-rrna

Nanyang Technological University

Research

JoVE Journal

Biology

19.5K Views.  Sheba Medical Center. Dit manuscript beschrijft een gedetailleerde gestandaardiseerde protocol voor high-throughput 16S rRNA-amplicon sequencing. Het protocol introduceert een protocol van het geïntegreerde, geüniformeerde haalbaar en goedkoop vanaf fecale sample collectie door middel van data-analyses. Dit protocol maakt analyse van grote aantallen monsters met strenge normen en diverse besturingselementen.

Video: Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to abiotic stresses and diseases. As the plant microbiome can be highly complex, low-cost, high-throughput methods such as amplicon-based sequencing of the 16S rRNA gene are often preferred for characterizing its microbial composition and diversity. However, the selection of appropriate methodology when conducting such experiments is critical for reducing biases that can make analysis and comparisons between samples and studies difficult. This protocol describes in detail a standardized methodology for the collection and extraction of DNA from soil, rhizosphere, and root samples. Additionally, we highlight a well-established 16S rRNA amplicon sequencing pipeline that allows for the exploration of the composition of bacterial communities in these samples, and can easily be adapted for other marker genes. This pipeline has been validated for a variety of plant species, including sorghum, maize, wheat, strawberry, and agave, and can help overcome issues associated with the contamination from plant organelles.

Here, we describe a protocol to obtain amplicon sequence data of soil, rhizosphere, and root endosphere microbiomes. This information can be used to investigate the composition and diversity of plant-associated microbial communities, and is suitable for the use with a wide range of plant species.

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...

Genetics

Isolation, Propagation, and Identification of Bacterial Species with Hydrocarbon Metabolizing Properties from Aquatic Habitats

Hydrocarbon pollutants are recalcitrant to degradation and their accumulation in the environment is toxic to all life forms. Bacteria encode numerous catalytic enzymes and are naturally capable of metabolizing hydrocarbons. Scientists harness biodiversity in aquatic ecosystems to isolate bacteria with biodegradation and bioremediation potential. Such isolates from the environment provide a rich set of metabolic pathways and enzymes, which can be further utilized to scale up the degradation process at an industrial scale. In this article, we outline the general process of isolation, propagation, and identification of bacterial species from aquatic habitats and screen their ability to utilize hydrocarbons as the sole carbon source in vitro using simple techniques. The present protocol describes the isolation of various bacterial species and their subsequent identification using the 16S rRNA analysis. The protocol also presents steps for characterizing the hydrocarbon degrading potential of bacterial isolates. This protocol will be useful for researchers trying to isolate bacterial species from environmental habitats for their biotechnological applications.

We present the process of isolating, propagating, and characterizing hydrocarbon-degrading bacteria from aquatic habitats. The protocol outlines bacterial isolation, identification by the 16S rRNA method, and testing of their hydrocarbon-degrading potential. This article would help researchers in characterizing microbial biodiversity in environmental samples, and specifically screen for microbes with bioremediation potential.

Hydrocarbon pollutants are recalcitrant to degradation and their accumulation in the environment is toxic to all life forms. Bacteria encode numerous ...

Environment

Applying Advanced In Vitro Culturing Technology to Study the Human Gut Microbiota

The human gut microbiota plays a vital role in both human health and disease. Studying the gut microbiota using an in vivo model, is difficult due to its complex nature, and its diverse association with mammalian components. The goal of this protocol is to culture the gut microbiota in vitro, which allows for the study of the gut microbiota dynamics, without having to consider the contribution of the mammalian milieu. Using in vitro culturing technology, the physiological conditions of the gastro intestinal tract are simulated, including parameters such as pH, temperature, anaerobiosis, and transit time. The intestinal surface of the colon is simulated by adding mucin-coated carriers, creating a mucosal phase, and adding further dimension. The gut microbiota is introduced by inoculating with the human fecal material. Upon inoculation with this complex mixture of bacteria, specific microbes are enriched in the different longitudinal (ascending, transverse and descending colons) and transversal (luminal and mucosal) environments of the in vitro model. It is crucial to allow the system to reach a steady state, in which the community and the metabolites produced remain stable. The experimental results in this manuscript demonstrate how the inoculated gut microbiota community develops into a stable community over time. Once steady state is achieved, the system can be used to analyze bacterial interactions and community functions or to test the effects of any additives on the gut microbiota, such as food, food components, or pharmaceuticals.

Here, we present a protocol for culturing the gut microbiota of the colon in vitro, using a series of bioreactors that simulate the physiological conditions of the gastro intestinal tract.

The human gut microbiota plays a vital role in both human health and disease. Studying the gut microbiota using an in vivo model, is difficult due to its ...

Bioengineering

An In Vitro Batch-culture Model to Estimate the Effects of Interventional Regimens on Human Fecal Microbiota

The emerging role of the gut microbiome in several human diseases demands a breakthrough of new tools, techniques and technologies. Such improvements are needed to decipher the utilization of microbiome modulators for human health benefits. However, the large-scale screening and optimization of modulators to validate microbiome modulation and predict related health benefits may be practically difficult due to the need for large number of animals and/or human subjects. To this end, in vitro or ex vivo models can facilitate preliminary screening of microbiome modulators. Herein, it is optimized and demonstrated an ex vivo fecal microbiota culture system that can be used for examining the effects of various interventions of gut microbiome modulators including probiotics, prebiotics and other food ingredients, aside from nutraceuticals and drugs, on the diversity and composition of the human gut microbiota. Inulin, one of the most widely studied prebiotic compounds and microbiome modulators, is used as an example here to examine its effect on the healthy fecal microbiota composition and its metabolic activities, such as fecal pH and the fecal levels of organic acids including lactate and short-chain fatty acids (SCFAs). The protocol may be useful for studies aimed at estimating the effects of different interventions of modulators on fecal microbiota profiles and at predicting their health impacts.

This protocol describes an in vitro batch-culture fermentation system of human fecal microbiota, using inulin (a well-known prebiotic and one of the most widely studied microbiota modulators) to demonstrate the use of this system in estimating effects of specific interventions on fecal microbiota composition and metabolic activities.

The emerging role of the gut microbiome in several human diseases demands a breakthrough of new tools, techniques and technologies. Such improvements are ...

Immunology and Infection

Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the long-lasting gold standards is to sequence 16S ribosomal RNA (rRNA) gene amplicons generated by domain-level PCR reactions amplifying from genomic DNA. Traditionally, this was performed by cloning and Sanger (capillary electrophoresis) sequencing of PCR amplicons. The advent of next-generation sequencing has tremendously simplified and increased the sequencing depth for 16S rRNA gene sequencing. The introduction of benchtop sequencers now allows small labs to perform their 16S rRNA sequencing in-house in a matter of days. Here, an approach for 16S rRNA gene amplicon sequencing using a benchtop next-generation sequencer is detailed. The environmental DNA is first amplified by PCR using primers that contain sequencing adapters and barcodes. They are then coupled to spherical particles via emulsion PCR. The particles are loaded on a disposable chip and the chip is inserted in the sequencing machine after which the sequencing is performed. The sequences are retrieved in fastq format, filtered and the barcodes are used to establish the sample membership of the reads. The filtered and binned reads are then further analyzed using publically available tools. An example analysis where the reads were classified with a taxonomy-finding algorithm within the software package Mothur is given. The method outlined here is simple, inexpensive and straightforward and should help smaller labs to take advantage from the ongoing genomic revolution.

Characterizing microbial community has been a longstanding goal in environmental microbiology. Next-generation sequencing methods now allow for the characterization of microbial communities at an unprecedented depth with minimal cost and labor. We detail here our approach to sequence bacterial 16S ribosomal RNA genes using a benchtop sequencer.

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the ...

Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information.

We describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs for characterization of bacterial communities using 16S rRNA gene amplicon sequencing. The method allows for a common processing approach for multiple sample types and accommodates a number of downstream analytic processes.

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing ...

Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective and widely available vaccines are lacking for a majority of these diseases, necessitating the development of novel disease mitigation strategies. To this end, a promising avenue of disease control involves targeting the vector microbiome, the community of microbes inhabiting the vector. The vector microbiome plays a pivotal role in pathogen dynamics, and manipulations of the microbiome have led to reduced vector abundance or pathogen transmission for a handful of vector-borne diseases. However, translating these findings into disease control applications requires a thorough understanding of vector microbial ecology, historically limited by insufficient technology in this field. The advent of next-generation sequencing approaches has enabled rapid, highly parallel sequencing of diverse microbial communities. Targeting the highly-conserved 16S rRNA gene has facilitated characterizations of microbes present within vectors under varying ecological and experimental conditions. This technique involves amplification of the 16S rRNA gene, sample barcoding via PCR, loading samples onto a flow cell for sequencing, and bioinformatics approaches to match sequence data with phylogenetic information. Species or genus-level identification for a high number of replicates can typically be achieved through this approach, thus circumventing challenges of low detection, resolution, and output from traditional culturing, microscopy, or histological staining techniques. Therefore, this method is well-suited for characterizing vector microbes under diverse conditions but cannot currently provide information on microbial function, location within the vector, or response to antibiotic treatment. Overall, 16S next-generation sequencing is a powerful technique for better understanding the identity and role of vector microbes in disease dynamics.

Here we present a next-generation sequencing protocol for 16S rRNA sequencing which enables identification and characterization of microbial communities within vectors. This method involves DNA extraction, amplification and barcoding of samples through PCR, sequencing on a flow-cell, and bioinformatics to match sequence data to phylogenetic information.

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective ...

Microbiota Analysis Using Two-step PCR and Next-generation 16S rRNA Gene Sequencing

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the immune system. Perturbation of the healthy gut microbiome has been suggested to play a role in the development of inflammatory diseases, including multiple sclerosis (MS). Environmental and genetic factors can influence the composition of the microbiome; therefore, identification of microbial communities linked with a disease phenotype has become the first step towards defining the microbiome&#8217;s role in health and disease. Use of 16S rRNA metagenomic sequencing for profiling bacterial community has helped in advancing microbiome research. Despite its wide use, there is no uniform protocol for 16S rRNA-based taxonomic profiling analysis. Another limitation is the low resolution of taxonomic assignment due to technical difficulties such as smaller sequencing reads, as well as use of only forward (R1) reads in the final analysis due to low quality of reverse (R2) reads. There is need for a simplified method with high resolution to characterize bacterial diversity in a given biospecimen. Advancements in sequencing technology with the ability to sequence longer reads at high resolution have helped to overcome some of these challenges. Present sequencing technology combined with a publicly available metagenomic analysis pipeline such as R-based Divisive Amplicon Denoising Algorithm-2 (DADA2) has helped advance microbial profiling at high resolution, as DADA2 can assign sequence at the genus and species levels. Described here is a guide for performing bacterial profiling using two-step amplification of the V3-V4 region of the 16S rRNA gene, followed by analysis using freely available analysis tools (i.e., DADA2, Phyloseq, and METAGENassist). It is believed that this simple and complete workflow will serve as an excellent tool for researchers interested in performing microbiome profiling studies.

Described here is a simplified standard operating procedure for microbiome profiling using 16S rRNA metagenomic sequencing and analysis using freely available tools. This protocol will help researchers who are new to the microbiome field as well as those requiring updates on methods to achieve bacterial profiling at a higher resolution.

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the ...

Fecal Microbiota Transplantation and Detection of Prevalence of IgA-Coated Bacteria in the Gut

Gut microbiota exert pleiotropic roles in human health and disease. Fecal microbiota transplantation (FMT) is an effective method to investigate the biological function of intestinal bacteria as a whole or at the species level. Several different FMT methods have been published. Here, we present an FMT protocol that successfully depletes gut microbiota in a matter of days, followed by transplantation of fecal microbiota from fresh or frozen donor intestinal contents to conventional mice. Real time-PCR is applied to test the efficacy of bacterial depletion. Sequencing of the 16S ribosomal RNA (rRNA) is then applied to test the relative abundance and identity of gut microbiota in recipient mice. We also present a flow cytometry-based detection method of immunoglobulin A (IgA)-coated bacteria in the gut.

We established an efficient way to deplete intestinal bacteria in three days, and subsequently transplant fecal microbiota via gavage of fecal fluid prepared from fresh or frozen intestinal contents in mice. We also present an optimized method to detect the frequency of IgA-coated bacteria in the gut.

Gut microbiota exert pleiotropic roles in human health and disease. Fecal microbiota transplantation (FMT) is an effective method to investigate the ...

16S rRNA Sequencing: A PCR-based Technique to Identify Bacterial Species

Source: Ewa Bukowska-Faniband1, Tilde Andersson1, Rolf Lood1 
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 00 Lund, Sweden
Planet Earth is a habitat for millions of bacterial species, each of which has specific characteristics. Identification of bacterial species is widely used in microbial ecology to determine biodiversity of environmental samples and medical microbiology to diagnose infected patients. Bacteria can be classified using conventional microbiology methods, such as microscopy, growth on specific media, biochemical and serological tests, and antibiotic sensitivity assays. In recent decades, molecular microbiology methods have revolutionized bacterial identification. A popular method is 16S ribosomal RNA (rRNA) gene sequencing. This method is not only faster and more accurate than conventional methods, but also allows identification of strains that are difficult to grow in laboratory conditions. Furthermore, differentiation of strains at the molecular level enables discrimination between phenotypically identical bacteria (1-4).
16S rRNA joins with a complex of 19 proteins to form a 30S subunit of the bacterial ribosome (5). It is encoded by the 16S rRNA gene, which is present and highly conserved in all bacteria due to its essential function in ribosome assembly; however, it also contains variable regions which may serve as fingerprints for particular species. These features have made the 16S rRNA gene an ideal genetic fragment to be used in identification, comparison, and phylogenetic classification of bacteria (6).
16S rRNA gene sequencing is based on the polymerase chain reaction (PCR) (7-8) followed by DNA sequencing (9). PCR is a molecular biology method used to amplify specific fragments of DNA through a series of cycles that include:
i) Denaturation of a double stranded DNA template 
ii) Annealing of primers (short oligonucleotides) that are complementary to the template 
iii) Extension of primers by the DNA polymerase enzyme, which synthesizes a new DNA strand
A schematic overview of the method is shown in Figure 1.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10510/10510fig1.jpg" /> 
Figure 1: Schematic overview of the PCR reaction. <a href="https://www.jove.com/files/ftp_upload/10510/10510fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
There are several factors that are important for a successful PCR reaction, one of which is quality of the DNA template. Isolation of chromosomal DNA from bacteria can be performed using standard protocols or commercial kits. Special care should be taken to obtain DNA that is free of contaminants that can inhibit the PCR reaction.
Conserved regions of the 16S rRNA gene permit the design of universal primer pairs (one forward and one reverse) that can bind to and amplify the target region in any bacterial species. The target region can vary in size. While some primer pairs can amplify most of the 16S rRNA gene, others amplify only parts of it. Examples of commonly used primers are shown in Table 1 and their binding sites are depicted in Figure 2.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer name</td>
			<td>Sequence (5&#39;&#8594;3&#39;)</td>
			<td>Forward/ reverse</td>
			<td>Reference</td>
		</tr>
		<tr>
			<td>8F b)</td>
			<td>AGAGTTTGATCCTGGCTCAG</td>
			<td>forward</td>
			<td>-1</td>
		</tr>
		<tr>
			<td>27F</td>
			<td>AGAGTTTGATCMTGGCTCAG</td>
			<td>forward</td>
			<td>-10</td>
		</tr>
		<tr>
			<td>515F</td>
			<td>GTGCCAGCMGCCGCGGTAA</td>
			<td>forward</td>
			<td>-11</td>
		</tr>
		<tr>
			<td>911R</td>
			<td>GCCCCCGTCAATTCMTTTGA</td>
			<td>reverse</td>
			<td>-12</td>
		</tr>
		<tr>
			<td>1391R</td>
			<td>GACGGGCGGTGTGTRCA</td>
			<td>reverse</td>
			<td>-11</td>
		</tr>
		<tr>
			<td>1492R</td>
			<td>GGTTACCTTGTTACGACTT</td>
			<td>reverse</td>
			<td>-11</td>
		</tr>
	</tbody>
</table>
Table 1: Examples of standard oligonucleotides used in amplification of 16S rRNA genes a). 
a) The expected lengths of the PCR product generated using the different primer combinations can be estimated by calculating the distance between the binding sites for the forward and the reverse primer (see Figure 2), e.g. the size of the PCR product using primer pair 8F-1492R is ~1500 bp, and for primer pair 27F-911R ~900 bp. 
b) also known as fD1
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10510/10510fig2.jpg" /> 
Figure 2: Representative figure of the 16S rRNA sequence and the primer-binding sites. Conserved regions are colored in grey and variable regions are filled with diagonal lines. To allow for the highest resolution, primer 8F and 1492R (name based on location on rRNA sequence) are used to amplify the whole sequence, allowing for the sequencing of several variable regions of the gene. <a href="https://www.jove.com/files/ftp_upload/10510/10510fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Cycling conditions for PCR (i.e. the temperature and time required for the DNA to be denatured, annealed with primers, and synthesized) are dependent on the type of polymerase that is used and the properties of the primers. It is recommended to follow the manufacturer&#39;s guidelines for a particular polymerase.
After the PCR program is completed, the products are analyzed by agarose gel electrophoresis. A successful PCR yields a single band of expected size. The product must be purified prior to sequencing to remove residual primers, deoxyribonucleotides, polymerase, and buffer which were present in the PCR reaction. The purified DNA fragments are usually sent for sequencing to commercial sequencing services; however, some institutions perform DNA sequencing at their own core facilities.
The DNA sequence is automatically generated from a DNA chromatogram by a computer and must be carefully checked for quality, as manual editing is sometimes needed. Following this step, the gene sequence is compared with sequences deposited in the 16S rRNA database. The regions of similarity are identified, and the most similar sequences are delivered.

16S rRNA Sequencing: Identifying Bacterial Species by PCR

Source: Ewa Bukowska-Faniband1, Tilde Andersson1, Rolf Lood1
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, ...

Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

Samenvatting

Meer video's verkennen