This work was supported in part by the I-CORE program (grants No. 41/11), the Israel Science Foundation (grant No. 908/15), and the European Crohn&#39;s and Colitis Organization (ECCO).

Ethical approval for the study was granted by the Sheba Local Research Ethics Committee and all methods were performed in accordance with the relevant guidelines and regulations. The protocol received a patient consent exception from the local Ethical Review Board, since the fecal material that were used were already submitted to the microbiology core as part of clinical workup and without identifiable patient information other than age, gender, and microbial results. Written, informed consent was obtained from healthy volunteers and the Institutional Review Board approved the study. Some of those samples have already been included in a previous analysis1.
1. Sample Handling
<ol>
	<li>Collect an approximately 5 mm2 smear (roughly the size of a pencil eraser) from a fresh fecal sample with a sterile swab in a test tube (see Table of Materials). Store all swabs containing fecal samples at -80 &#176;C within 24 h. The fecal swabs can remain there until further processing.</li>
</ol>
2. DNA Extraction
<ol>
	<li>Thaw the Extraction and Dilution solutions at room temperature (see Table of Materials).</li>
	<li>Transfer the fecal swab into an empty 2 mL collection tube (see Table of Materials). Adjust the swab stick size by cutting it using a clean scissors to enable tube closure with minimum cross-contamination. Add 250 &#956;L of Extraction solution to each collection tube containing the fecal swab and vortex to mix.</li>
	<li>Heat the samples for 10 min in a boiling water bath (95&#8211;100 &#176;C). Add 250 &#956;L of Dilution solution to each sample and vortex to mix.</li>
	<li>Store the 2 mL tubes containing the extracted DNA and the swab at 4 &#176;C.</li>
</ol>
3. PCR and Library Preparation
For steps 3.1 and 3.2, work in a PCR workstation that provides clean, template and amplicon free environment.
<ol>
	<li>Label the primers (Table 1) according to their barcode. Dilute each primer in double distilled water (DDW) to a 50 &#956;M concentration and store at -20 &#176;C.</li>
	<li>Use a 96-well plate for PCR reactions. Each plate can contain 32 different samples, which are tagged by 32 different index primers. Thaw the forward primer and the 32 reverse primers at room temperature and dilute them to 5 &#956;M.</li>
	<li>Prepare PCR reaction mixes for 100 reactions (final volume in each well will be 20 &#956;l) by mixing 100 &#956;L of 5 &#956;M Forward primer, 1 mL 2X PCR Master mix, and 400 &#956;L DDW. Put 15 &#956;L of this PCR mix in each well (total of 96 wells). Add 1 &#956;L of each 5 &#956;M Reverse indexed primer to 3 different wells (32 different primers in triplicates gives a total of 96 wells).</li>
	<li>In a pre-PCR dedicated zone, meaning a clean bench that is template and amplicon free, add 4 &#956;L of each extracted DNA sample to reaction mixtures (each extracted DNA sample is amplified in triplicate &#8212; 32 samples per 96-well plate).</li>
	<li>Run PCR with the following settings: initial denaturation of 94 &#176;C for 3 min; followed by 35 cycles of denaturation at 94 &#176;C for 1 min, annealing at 55 &#176;C for 1 min, and extension at 72 &#176;C for 1 min; and a final extension at 72 &#176;C for 10 min.</li>
	<li>On a different bench, which will be defined as a post-PCR dedicated zone, combine each triplicate PCR reaction into a single volume tube (60 &#956;L per sample).</li>
	<li>To assess the quality of PCR amplicons, run 4 &#956;L of each combined-PCR reaction on an ethidium bromide-stained 1% agarose gel. Under UV wavelength of 260 nm, the positive amplicons will appear in an expected band size of 375&#8211;425 bp. Only these amplicons will be included in the subsequent steps. 
	NOTE: Each sample is amplified in triplicate, meaning that each sample is amplified in 3 different PCR reactions. Do not scale up.</li>
</ol>
4. Library Quantification and Cleaning
<ol>
	<li>In order to get an equimolar concentration pool of all PCR samples, quantify each amplicon by a double stranded DNA (dsDNA quantify reagent) florescent nucleic acid stain (see Table of Materials), suitable for the simultaneous quantification of a large amount of samples. 
	NOTE: Since the size range of the amplicon is equivocal, the actual amount in nanograms is used to load an equimolar concentration.</li>
	<li>Combine 500 ng of each sample into a single, sterile tube. Vortex to mix.</li>
	<li>Run 200 &#956;L of the pooled library on an Ethidium Bromide-stained 1% agarose gel. Extract the 375&#8211;425 bp bands from the gel using a gel extraction kit according to the manufacturer&#39;s instructions (see Table of Materials) and elute the pooled library in 80 &#956;L DDW. 
	NOTE: The pooled library should be size selected to reduce non-specific amplification products from host DNA.</li>
	<li>Measure the final library concentration using a highly sensitive dsDNA detecting kit according to the manufacturer&#39;s instructions (see Table of Materials). Measure the accurate library size using a highly sensitive separation and analysis kit for DNA libraries according to the manufacturer&#39;s instructions (see Table of Materials).</li>
</ol>
5. Sequencing
<ol>
	<li>Dilute the pooled library to 7 pM with addition of 20% control library (see Table of Materials), according to the sequencing machine protocol.</li>
	<li>For sequencing, use custom designed read primers that are complimentary to the V4 amplification primers (see Table 1).</li>
	<li>Use a third custom designed sequencing primer that reads the barcode in an additional cycle (see Table 1) and generates paired-end reads of 175 bases in length in each direction, according to the manufacturer&#39;s specifications.</li>
	<li>Run the sequencing machine and obtain FASTQ files according to the manufacturer&#39;s protocol.</li>
</ol>
6. Data Processing
<ol>
	<li>Stitch together and process the overlapping paired-end FASTQ files in a data curation pipeline implemented in QIIME 2 version 2017.7.017. Demultiplex the reads according to sample specific barcodes.</li>
	<li>Use DADA218 for quality control and sequence variant (SVs) detection. Truncate reads at 13 bases from the 3&#39; end and 15 bases from the 5&#39; end, discard reads with more than 2 expected errors. Identify and remove the chimeras using the consensus method &#8212; chimeras are detected in samples individually, and sequences found chimeric in a sufficient fraction of samples are removed.</li>
	<li>Perform SVs taxonomic classification using a Naive Bayes fitted classifier, trained on the August 2013 99% identity Greengenes database6, for 175 long reads and the Forward/Reverse primer set.</li>
	<li>Rarefy all samples to depth of 2,146 sequences.</li>
	<li>Use Unweighted UniFrac for measurement of &#946;-diversity (between sample diversity19,20) on the rarefied samples, to avoid a sample size effect.</li>
	<li>Use the resulting distance matrix to perform a principal coordinates analysis (PCoA). 
	NOTE: The data processing script and mapping files are provided as supplementary material (Supplementary Material 1 and 2).</li>
</ol>

<ol>
	<li>Braun, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fecal+microbial+characterization+of+hospitalized+patients+with+suspected+infectious+diarrhea+shows+significant+dysbiosis.">Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis.</a> Scientific Reports. 7, 1088 (2017).</li><li>De Filippo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+diet+in+shaping+gut+microbiota+revealed+by+a+comparative+study+in+children+from+Europe+and+rural+Africa.">Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa.</a> Proceedings of the National Academy of Sciences of the United States of America. 107, 14691-14696 (2010).</li><li>Yatsunenko, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+gut+microbiome+viewed+across+age+and+geography.">Human gut microbiome viewed across age and geography.</a> Nature. 486, 222-227 (2012).</li><li>Rodriguez, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+composition+of+the+gut+microbiota+throughout+life,+with+an+emphasis+on+early+life.">The composition of the gut microbiota throughout life, with an emphasis on early life.</a> Microbial Ecology in Health and Disease. 26, 26050 (2015).</li><li>Turnbaugh, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+obesity-associated+gut+microbiome+with+increased+capacity+for+energy+harvest.">An obesity-associated gut microbiome with increased capacity for energy harvest.</a> Nature. 444, 1027-1031 (2006).</li><li>McDonald, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+Greengenes+taxonomy+with+explicit+ranks+for+ecological+and+evolutionary+analyses+of+bacteria+and+archaea.">An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea.</a> The ISME Journal. 6, 610-618 (2012).</li><li>Bakken, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Treating+Clostridium+difficile+infection+with+fecal+microbiota+transplantation.">Treating Clostridium difficile infection with fecal microbiota transplantation.</a> Clinical Gastroenterology and Hepatology. 9, 1044-1049 (2011).</li><li>Khoruts, A., Dicksved, J., Jansson, J. K., Sadowsky, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changes+in+the+composition+of+the+human+fecal+microbiome+after+bacteriotherapy+for+recurrent+Clostridium+difficile-associated+diarrhea.">Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea.</a> Journal of Clinical Gastroenterology. 44, 354-360 (2010).</li><li>Nood, E. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Duodenal+infusion+of+donor+feces+for+recurrent+Clostridium+difficile.">Duodenal infusion of donor feces for recurrent Clostridium difficile.</a> The New England Journal of Medicine. 368, 407-415 (2013).</li><li>Koplan, J. P., Benfari Ferraro, M. J., Fineberg, H. V., Rosenberg, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Value+of+stool+cultures.">Value of stool cultures.</a> The Lancet. 316, 413-416 (1980).</li><li>Platts-Mills, J. A., Liu, J., Houpt, E. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+concepts+in+diagnostics+for+infectious+diarrhea.">New concepts in diagnostics for infectious diarrhea.</a> Mucosal Immunology. 6, 876-885 (2013).</li><li>Bokulich, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quality-filtering+vastly+improves+diversity+estimates+from+Illumina+amplicon+sequencing.">Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing.</a> Nature Methods. 10, 57-59 (2013).</li><li>Leek, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tackling+the+widespread+and+critical+impact+of+batch+effects+in+high-throughput+data.">Tackling the widespread and critical impact of batch effects in high-throughput data.</a> Nature Reviews Genetics. 11, (2010).</li><li>Dubilier, N., McFall-Ngai, M., Zhao, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Create+a+global+microbiome+effort.">Create a global microbiome effort.</a> Nature. 526, 631-634 (2015).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+patterns+of+16S+rRNA+diversity+at+a+depth+of+millions+of+sequences+per+sample.">Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample.</a> PNAS. 108, 4516-4522 (2011).</li><li>Flores, G. E., Henley, J. B., Fierer, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+direct+PCR+approach+to+accelerate+analyses+of+human-associated+microbial+communities.">A direct PCR approach to accelerate analyses of human-associated microbial communities.</a> PloS One. 7, (2012).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=QIIME+allows+analysis+of+high-throughput+community+sequencing+data.">QIIME allows analysis of high-throughput community sequencing data.</a> Nature Methods. 7, 335-336 (2010).</li><li>Callahan, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DADA2:+High-resolution+sample+inference+from+Illumina+amplicon+data.">DADA2: High-resolution sample inference from Illumina amplicon data.</a> Nature Methods. 13, 581-583 (2016).</li><li>Lozupone, C., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UniFrac:+A+new+phylogenetic+method+for+comparing+microbial+communities.">UniFrac: A new phylogenetic method for comparing microbial communities.</a> Applied and Environmental Microbiology. 71, 8228-8235 (2005).</li><li>Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UniFrac:+An+effective+distance+metric+for+microbial+community+comparison.">UniFrac: An effective distance metric for microbial community comparison.</a> The ISME Journal. 5, 169-172 (2011).</li><li>Srinivasan, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+16S+rRNA+gene+for+identification+of+a+broad+range+of+clinically+relevant+bacterial+pathogens.">Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens.</a> PloS One. 10, e0117617 (2015).</li><li>Hiergeist, A., Gl&#228;sner, J., Reischl, U., Gessner, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analyses+of+intestinal+microbiota:+culture+versus+sequencing.">Analyses of intestinal microbiota: culture versus sequencing.</a> ILAR Journal. 56, 228-240 (2015).</li><li>Didelot, X., Bowden, R., Wilson, D. J., Peto, T. E. A., Crook, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transforming+clinical+microbiology+with+bacterial+genome+sequencing.">Transforming clinical microbiology with bacterial genome sequencing.</a> Nature Reviews Genetics. 13, 601-612 (2012).</li><li>Salipante, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+16S+rRNA+next-generation+sequencing+of+polymicrobial+clinical+samples+for+diagnosis+of+complex+bacterial+infections.">Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections.</a> PloS One. 8, e65226 (2013).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultra-high-throughput+microbial+community+analysis+on+the+Illumina+HiSeq+and+MiSeq+platforms.">Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms.</a> The ISME Journal. 6, 1621-1624 (2012).</li></ol>

The authors have nothing to disclose.

16S rRNA-amplicon and metagenomics shotgun sequencing have gained popularity in clinical microbiology applications21,22,23. These techniques are advantageous in their increased ability to capture culturable and non-culturable taxa, providing data about the relative abundance of the pathogenic inoculum, and their ability to identify more precisely a polymicrobial infectious fingerprint24. The advances in the field of microbiome research have generated vast amounts of data that are not easily comparable due to a lack of consistency in the various approaches. In recent years, several consortiums have attempted to address some of these issues. This protocol follows similar library preparation as the earth microbiome project (EMP). However, added is a detailed step-by-step protocol for DNA extraction from fecal samples through analyses pipeline.
Previously, 16S rRNA sequencing has been used to characterize the microbial composition patterns of fecal samples from healthy non-hospitalized subjects and from hospitalized patients with suspected infectious diarrhea, and to traditional culture results. The results from that analysis showed that hospitalized patients have profound increases in taxa from Proteobacteria phylum1. Described here is an integrated protocol of broadly used methods for 16S rRNA gene amplicon sequencing using the direct PCR columns-free approach that was originally designed for extraction of plant DNA16. This approach can efficiently and quickly extract good-quality amplified-DNA libraries targeting the V4 variable region of the 16S rRNA gene from a large number of samples suitable for high-throughput 16S rRNA sequencing.
As this is a DNA-based sequencing method, data on both aerobes and anaerobes microbial communities present in an individual fecal sample are obtained. The protocol adopted the primers that were originally designed15 against the V4 region of the 16S rRNA gene. Importantly, the reverse amplification primer contain a twelve base barcode sequence that supports pooling of up to 2,167 different samples in each lane15. The forward amplification primer includes nine extra bases in the adapter region that support paired-end sequencing on the sequencing platform25 (Table 1 and Supplementary Material 3). This approach enabled handling a library composed of 250 fecal samples that were sequenced on one lane with a running depth of 10622.57 &#177; 1211.34 (mean &#177; standard error) reads per sample at a cost of ~30 dollars per sample.
To ensure quality control, we suggest using the following negative controls; i) PCR without DNA template, ii) PCR on DNA extracted from a clean sterile swab, and iii) PCR on mixed extraction and dilution solution. As for positive controls, we recommend including samples that originated from the same stool sample but went through different library preparation with different reverse barcoded primers and samples from previous runs as internal quality control. Of note, other optional positive controls to be used are those microbiome measurement standards provided by NIST. The average reads coverage for the negative controls is remarkably lower in comparison to the actual stool samples (Table 1) and was composed primarily from the Mycoplasma taxa. We further showed the consistency of the sequencing results obtained using samples that each originated from the same fecal material but that went through different library preparation (Figure 3). This result also confirms that, when using our integrated method, there is no cross-contamination between samples.
In this protocol we introduce an integrated uniformed, feasible protocol to analyze large numbers of samples. This protocol aims to guide scientists interested in initiating the use of 16S rRNA-amplicon sequencing in a robust, reproductive, easy to use, inexpensive, detailed way from fecal collection to data analyses, using important controls. Using this standardized detailed guided protocol, may minimize batch effects and allow more comparable sequencing results between different labs.

Concentrated efforts have been made to better understand microbiome diversity and abundance, as another aspect of capturing difference and similarities between individuals in healthy and pathological conditions. Age2,3, geography4, lifestyle5,6, and illness5 were shown to be associated with the composition of the gut microbiome, but many conditions and populations have not yet been fully characterized. Recently it has been reported that the microbiome can be modified for therapeutic applications7,8,9. Therefore, additional insight into the relationship between various physiological conditions and the microbial composition is the first step toward optimization of potential future modifications.
The traditional microbial culture methods are limited by low yields10,11, and are conceptualized as a binary state where a bacteria is either present in the gut or not. High-throughput DNA-based sequencing has revolutionized microbial ecology, enabling the capture of all members of the microbial community. However, sequence read length and quality remain significant barriers to accurate taxonomy assignment12. Furthermore, high-throughput based experiments may suffer from batch effects, where measurements are affected by non-biological or non-scientific variables13. In recent years, several programs have been established to study the human microbiome, including the American Gut project, the United States (US) Human Microbiome Project, and the United Kingdom (UK) MetaHIT project. These initiatives have generated vast amounts of data that are not easily comparable due to a lack of consistency in their approaches. A variety of international projects such as the International Human Microbiome Consortium, the International Human Microbiome Standards project, and the National Institute of Standards and Technology (NIST) attempted to address some of these issues14, and developed standards for microbiome measurements which should enable the achievement of reliable reproductive results. Described here is an integrated protocol of several broadly used methods15,16 for 16S rRNA high-throughput sequencing (16S-seq) starting from fecal sample collection thru data analyses. The protocol describes a column-free PCR approach, originally designed for direct extraction of plant DNA16, to enable the simultaneous handling of large numbers of fecal samples in a relatively short time with high quality amplified DNA for targeted sequencing of the microbial variable V4 region on a common sequencing platform. This protocol aims to guide scientists interested in initiating the use of 16S rRNA-amplicon sequencing in a robust, reproductive, easy to use, detailed way, using important controls. Having a guided and detailed step-by step protocol may minimize batch effect and thus will allow more comparable sequencing results between labs.

<table>
	<tbody>
		<tr>
			<td>Primers</td>
			<td>Integrated DNA Technologies (IDT)</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Extraction solution</td>
			<td>Sigma-Aldrich</td>
			<td>E7526</td>
			<td></td>
		</tr>
		<tr>
			<td>Dilution solution</td>
			<td>Sigma-Aldrich</td>
			<td>D5688</td>
			<td></td>
		</tr>
		<tr>
			<td>Kapa HiFi HotStart ReadyMix PCR Kit</td>
			<td>KAPABIOSYSTEMS</td>
			<td>KK2601</td>
			<td>PCR Master mix</td>
		</tr>
		<tr>
			<td>Quant-iT PicoGreen dsDNA Reagent kit</td>
			<td>Invitrogen</td>
			<td>P7589</td>
			<td>dsDNA quantify reagent</td>
		</tr>
		<tr>
			<td>MinElute Gel extraction kit</td>
			<td>Qiagen</td>
			<td>28606</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Amresco</td>
			<td>0710-250G</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra Pure Water Dnase and Rnase Free</td>
			<td>Biological Industries</td>
			<td>01-866-1A</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit dsDNA HS assay kit</td>
			<td>Molecular probes</td>
			<td>Q32854</td>
			<td>dsDNA detecting kit</td>
		</tr>
		<tr>
			<td>High Sensitivity D1000</td>
			<td>Agilent Technologies</td>
			<td>Screen Tape 5067-5582</td>
			<td>separation and analysis</td>
		</tr>
		<tr>
			<td>Screen Tape Assay</td>
			<td>Agilent Technologies</td>
			<td>Reagents 5067-5583</td>
			<td>for DNA libraries</td>
		</tr>
		<tr>
			<td>PhiX Control v3</td>
			<td>Illumina</td>
			<td>15017666</td>
			<td>control library</td>
		</tr>
		<tr>
			<td>MiSeq Reagent Kit v2 (500 cycle)</td>
			<td>Illumina</td>
			<td>MS-102-2003</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium Bromide</td>
			<td>Amresco</td>
			<td>E406-10mL-TAM</td>
			<td></td>
		</tr>
		<tr>
			<td>2 mL collection tubes</td>
			<td>SARSTEDT</td>
			<td>72.695.400</td>
			<td>Safe Seal collection tubes</td>
		</tr>
		<tr>
			<td>Plastic stick swab in PP test tube</td>
			<td>STERILE INTERIOR</td>
			<td>23117</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PCR Machine</td>
			<td>Applied Biosystems</td>
			<td>2720 Thermal Cycler</td>
			<td></td>
		</tr>
		<tr>
			<td>Sequncing Machine</td>
			<td>Illumina</td>
			<td>Miseq</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR workstation</td>
			<td>Biosan</td>
			<td>UV-cleaner</td>
			<td></td>
		</tr>
		<tr>
			<td>scissors</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>vortexer</td>
			<td>Scientific Industries</td>
			<td>Vortex-Genie 2</td>
			<td></td>
		</tr>
	</tbody>
</table>

guided protocol for fecal microbial characterization by 16s rrna-amplicon sequencing

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. Deviations from what is considered a healthy microbiota composition (dysbiosis) may impair vital functions leading to pathologic conditions. Recent and ongoing research efforts have been directed toward the characterization of associations between microbial composition and human health and disease.
Advances in high-throughput sequencing technologies enable characterization of the gut microbial composition. These methods include 16S rRNA-amplicon sequencing and shotgun sequencing. 16S rRNA-amplicon sequencing is used to profile taxonomical composition, while shotgun sequencing provides additional information about gene predictions and functional annotation. An advantage in using a targeted sequencing method of the 16S rRNA gene variable region is its substantially lower cost compared to shotgun sequencing. Sequence differences in the 16S rRNA gene are used as a microbial fingerprint to identify and quantify different taxa within an individual sample.
Major international efforts have enlisted standards for 16S rRNA-amplicon sequencing. However, several studies report a common source of variation caused by batch effect. To minimize this effect, uniformed protocols for sample collection, processing, and sequencing must be implemented. This protocol proposes the integration of broadly used protocols starting from fecal sample collection to data analyses. This protocol includes a column-free, direct-PCR approach that enables simultaneous handling and DNA extraction of large numbers of fecal samples, along with PCR amplification of the V4 region. In addition, the protocol describes the analysis pipeline and provides a script using the latest version of QIIME (QIIME 2 version 2017.7.0 and DADA2). This step-by-step protocol is aimed to guide those interested in initiating the use of 16S rRNA-amplicon sequencing in a robust, reproductive, easy to use, detailed way.

A schematic illustration of the protocol is shown in Figure 1.
We have prospectively collected stool samples from hospitalized patients with suspected infectious diarrhea. Those samples were submitted to the Clinical Microbiology Lab at the Sheba Medical Center between February and May 2015, as was previously described1. Stool samples were subjected to conventional microbiological culture performed at the Clinical Microbiology Lab and to broad range high-throughput 16S-seq in parallel. In addition, stool samples from healthy adults were sequenced for comparison.
In this analysis, the focus was on the quality control of the data, and show representative results of the output obtained from QIIME217. Initially, sequencing results achieved in 6 negative control samples were reviewed for quality control including: i) PCR without template, ii) PCR on clean and sterile swabs in extraction and dilution solution, and iii) PCR on mixed extraction and dilution solutions. Table 2 shows that all negative control samples had &#8804;118 total reads (average of 29 sequences), primarily from the Mycoplasma taxa, while all other samples analyzed showed mean total reads of 10622.57 (&#177;1211.34 standard error) and no Mycoplasma read passed the quality control of the main samples.
Sixteen samples that each originated from the same stool sample but went through different library preparation with different reverse barcoded primers were used as positive controls. Those 16 samples included 8 with positive cultures for Campylobacter, Salmonella, or Shigella that were reported by the clinical microbiology lab, and 8 that were reported as having negative cultures. An area plot at the phyla level is shown in Figure 2. Samples that originated from the same stool sample but went through different library preparation with different reverse barcoded primers show very consistent relative abundance (Mantel test between duplicates of phylum level taxonomic relative abundance values simulated p-value = 1 x 10-04 based on 9999 replicates).
Principal coordinates analysis (PCoA), which reduces dimensionality of the input data, was used on the UniFrac matrix to visually explore sample separation and similarity. In Figure 3A, sequenced samples that originated from the same original stool sample but went through different library preparation are colored the same. Indeed, those are located relatively closely in the PCoA plot (Mantel test between duplicates PC1 PC2 values simulated p-value = 1e-04 based on 9999 replicates). In addition, the average unweighted unifrac beta diversity distance between samples in this study is 0.706, while the average distance between two duplicates is 0.235 (Wilcoxon rank sum test p-value = 4.205 x 10-11). Interestingly, samples that were culture positive for Campylobacter, Salmonella, or Shigella enteropathogens showed significantly different PC1 values (Wilcoxon rank sum test p-value = 0.011) in comparison to samples with negative culture results. Figure 3B shows the same PCoA plot but now samples are colored by the relative abundance of Proteobacteria. Samples with high Proteobacteria abundance had significantly different PC1 values (Spearman correlation r = -0.533, p-value = 0.000975). Those results are consistent with previous analysis of this data, where hospitalized patients have profound increases in taxa from Proteobacteria phylum1. Here we showed that PC1 is correlated with Proteobacteria abundance, with culture positive samples clustering mostly on the one side of the PC1 axis and culture negative samples clustering mostly on the other side, together with the healthy samples.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56845/56845fig1.jpg" /> 
Figure 1: Flow chart from fecal samples to relative microbial abundance. 1) Sample handling: Left, fecal samples are collected in a sterile swab tube. Right, the swab stick size is adjusted by cutting it to enable the closure of 2ml tube, and storage. 2) DNA extraction: DNA is extracted by direct PCR columns-free approach. 3) Library preparation: Left, 4 &#956;L of extracted DNA is amplified with Forward/Reverse-index primers. Each reverse primer contains a 12 base barcode. Each sample is amplified in triplicate. A 96-well plate contains 32 different barcodes. Right, combine each barcode triplicate into a single volume tube. A 96-well plate contains 96 different barcodes. 4) Library quantification: Upper panel, screening for positive samples, amplicons were detected on Ethidium Bromide-stained 1% agarose gel. Lower panel, quantification of the positive amplicons to reach equimolar concentration of 500 ng amplicon from each sample into a single library pool. 5) Library purification: Upper panel, the pooled library is gel extracted for size selection and purification. Lower panel, the library exact size and concentration is measured. 6) Sequencing: high-throughput sequencing of the pooled library. 7) The sequencing data is analyzed by a bioinformatic pipeline for 16S rRNA-amplicon microbial ecology. <a href="https://cloudflare.jove.com/files/ftp_upload/56845/56845fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56845/56845fig2.jpg" /> 
Figure 2: Consistent relative abundance between samples that originated from the same stool sample but went through different library preparation. Taxonomic relative abundance at the phylum level is shown per sample as indicated. Relative abundance is shown for 16 fecal samples obtained from hospitalized patients with suspected infectious diarrhea that each went through different library preparation (Duplicate 1 and 2) with different reverse barcoded primers and of 3 healthy controls. <a href="https://cloudflare.jove.com/files/ftp_upload/56845/56845fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56845/56845fig3.jpg" /> 
Figure 3: Phylogenetic diversity show consistent results for samples that originated from the same stool sample but went through different library preparation. Principal coordinates analysis (PCoA) that reduces dimensionality of the input data was used on the UniFrac matrix to visually explore sample separation and similarity. The distance between two samples represents the difference in their microbiome composition. (A) Unweighted UniFrac PCoA plot. Each point represents a single sequenced sample. Samples originated from the same original stool sample are colored the same. Samples from hospitalized patients with positive stool culture reported by the clinical microbiology1 are marked by squares, hospitalized patients with culture negative in triangles1, and healthy adults from a separate sequencing run1 are marked with filled in circles. (B) Same PCoA as in A, but samples are now colored by their relative abundance of Proteobacteria, as indicated. <a href="https://cloudflare.jove.com/files/ftp_upload/56845/56845fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer name</td>
			<td>Primer sequence</td>
			<td>Primer description</td>
		</tr>
		<tr>
			<td>Forward primer</td>
			<td>AATGATACGGCGACCACCGAGATCTACAC - TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA</td>
			<td>5&#39; adapter sequence - Forward primer pad - Forward primer linker - Forward primer&#160;</td>
		</tr>
		<tr>
			<td>Reverse index primer</td>
			<td>CAAGCAGAAGACGGCATACGAGAT - XXXXXXXXXXXX - AGTCAGTCAG - CC - GACTACHVGGGTWTCTAAT</td>
			<td>Reverse complement of 3&#39; adapter sequence -&#160; Golay barcode - Reverse primer pad - Reverse primer linker -&#160; Reverse primer</td>
		</tr>
		<tr>
			<td>Read 1 sequencing primer</td>
			<td>TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA</td>
			<td>Forward primer pad -&#160; Forward primer linker -&#160; Forward primer</td>
		</tr>
		<tr>
			<td>Read 2 sequencing primer</td>
			<td>AGTCAGTCAG - CC - GGACTACHVGGGTWTCTAAT</td>
			<td>Reverse primer pad -&#160; Reverse primer linker -&#160; Reverse primer</td>
		</tr>
		<tr>
			<td>Index sequence primer</td>
			<td>ATTAGAWACCCBDGTAGTCC - GG - CTGACTGACT</td>
			<td>Reverse complement of reverse primer -&#160; Reverse complement of reverse primer linker -&#160; Reverse complement of reverse primer pad</td>
		</tr>
	</tbody>
</table>
Table 1: Primer list.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Sample</td>
			<td>Number of reads post 
			initial quality control in 
			QIIME</td>
		</tr>
		<tr>
			<td>PCR on clean swabs in extraction and dilution solution -1</td>
			<td>118</td>
		</tr>
		<tr>
			<td>PCR on clean swabs in extraction and dilution solution -2</td>
			<td>39</td>
		</tr>
		<tr>
			<td>PCR without template -1</td>
			<td>0</td>
		</tr>
		<tr>
			<td>PCR without template -2</td>
			<td>0</td>
		</tr>
		<tr>
			<td>PCR on extraction and dilution solutions mix - 1&#160;</td>
			<td>16</td>
		</tr>
		<tr>
			<td>PCR on extraction and dilution solutions mix - 2</td>
			<td>0</td>
		</tr>
		<tr>
			<td>Samples (mean &#177; standard error)</td>
			<td>10622.57 &#177; 1211.34</td>
		</tr>
	</tbody>
</table>
Table 2: Number of reads for negative controls and for fecal samples.
Supplementary Material 1: Data processing script. <a href="http://cloudflare.jove.com/files/ftp_upload/56845/56845_Suppl1_script.txt">Please click here to download this file.</a>
Supplementary Material 2: Mapping file. <a href="http://cloudflare.jove.com/files/ftp_upload/56845/56845_Suppl2_map.txt">Please click here to download this file.</a>
Supplementary Material 3: Primer scheme. <a href="http://cloudflare.jove.com/files/ftp_upload/56845/56845_Suppl3_schematic_primers_representation.pptx">Please click here to download this file.</a>

Watch this Scientific Journal Video about Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing at JoVE.com

Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

This manuscript describes a detailed standardized protocol of high-throughput 16S rRNA-amplicon sequencing. The protocol introduces an integrated, uniformed, feasible, and inexpensive protocol starting from fecal sample collection through data analyses. This protocol enables analysis of large numbers of samples with rigorous standards and several controls.

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. ...

guided-protocol-for-fecal-microbial-characterization-16s-rrna

Nanyang Technological University

Research

JoVE Journal

Biology

19.4K Views.  Sheba Medical Center. This manuscript describes a detailed standardized protocol of high-throughput 16S rRNA-amplicon sequencing. The protocol introduces an integrated, uniformed, feasible, and inexpensive protocol starting from fecal sample collection through data analyses. This protocol enables analysis of large numbers of samples with rigorous standards and several controls.

Video: Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

Pyrosequencing for Microbial Identification and Characterization

Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate bacterial strains and detect genetic mutations that confer resistance to anti-microbial agents. The advantages of pyrosequencing for microbiology applications include rapid and reliable high-throughput screening and accurate identification of microbes and microbial genome mutations. Pyrosequencing involves sequencing of DNA by synthesizing the complementary strand a single base at a time, while determining the specific nucleotide being incorporated during the synthesis reaction. The reaction occurs on immobilized single stranded template DNA where the four deoxyribonucleotides (dNTP) are added sequentially and the unincorporated dNTPs are enzymatically degraded before addition of the next dNTP to the synthesis reaction. Detection of the specific base incorporated into the template is monitored by generation of chemiluminescent signals. The order of dNTPs that produce the chemiluminescent signals determines the DNA sequence of the template. The real-time sequencing capability of pyrosequencing technology enables rapid microbial identification in a single assay. In addition, the pyrosequencing instrument, can analyze the full genetic diversity of anti-microbial drug resistance, including typing of SNPs, point mutations, insertions, and deletions, as well as quantification of multiple gene copies that may occur in some anti-microbial resistance patterns.

Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate bacterial strains, and detect genetic mutations that confer resistance to anti-microbial agents. In this video, the procedure for microbial amplicon generation, amplicon pyrosequencing, and DNA sequence analysis will be demonstrated.

Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate ...

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) maintain the turnover of all mature blood cell lineages. The coordination of the complex signals leading to specific HSC fates relies upon the interaction between HSCs and the intricate bone marrow microenvironment, which is still poorly understood[1-2].
We describe how by combining a newly developed specimen holder for stable animal positioning with multi-step confocal and two-photon in vivo imaging techniques, it is possible to obtain high-resolution 3D stacks containing HSPCs and their surrounding niches and to monitor them over time through multi-point time-lapse imaging. High definition imaging allows detecting ex vivo labeled hematopoietic stem and progenitor cells (HSPCs) residing within the bone marrow. Moreover, multi-point time-lapse 3D imaging, obtained with faster acquisition settings, provides accurate information about HSPC movement and the reciprocal interactions between HSPCs and stroma cells.
Tracking of HSPCs in relation to GFP positive osteoblastic cells is shown as an exemplary application of this method. This technique can be utilized to track any appropriately labeled hematopoietic or stromal cell of interest within the mouse calvarium bone marrow space.

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

The nature of the interactions between hematopoietic stem and progenitor cells (HSPCs) and bone marrow niches is poorly understood. Custom hardware modifications and a multi-step acquisition protocol allow the use of two-photon and confocal microscopy to image ex vivo labeled HSPCs homed within bone marrow areas, tracking interactions and movement.

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) ...

Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the long-lasting gold standards is to sequence 16S ribosomal RNA (rRNA) gene amplicons generated by domain-level PCR reactions amplifying from genomic DNA. Traditionally, this was performed by cloning and Sanger (capillary electrophoresis) sequencing of PCR amplicons. The advent of next-generation sequencing has tremendously simplified and increased the sequencing depth for 16S rRNA gene sequencing. The introduction of benchtop sequencers now allows small labs to perform their 16S rRNA sequencing in-house in a matter of days. Here, an approach for 16S rRNA gene amplicon sequencing using a benchtop next-generation sequencer is detailed. The environmental DNA is first amplified by PCR using primers that contain sequencing adapters and barcodes. They are then coupled to spherical particles via emulsion PCR. The particles are loaded on a disposable chip and the chip is inserted in the sequencing machine after which the sequencing is performed. The sequences are retrieved in fastq format, filtered and the barcodes are used to establish the sample membership of the reads. The filtered and binned reads are then further analyzed using publically available tools. An example analysis where the reads were classified with a taxonomy-finding algorithm within the software package Mothur is given. The method outlined here is simple, inexpensive and straightforward and should help smaller labs to take advantage from the ongoing genomic revolution.

Characterizing microbial community has been a longstanding goal in environmental microbiology. Next-generation sequencing methods now allow for the characterization of microbial communities at an unprecedented depth with minimal cost and labor. We detail here our approach to sequence bacterial 16S ribosomal RNA genes using a benchtop sequencer.

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the ...

Highly Efficient Ligation of Small RNA Molecules for MicroRNA Quantitation by High-Throughput Sequencing

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide resolution. This technique captures miRNAs by attaching 3&#8217; and 5&#8217; oligonucleotide adapters to miRNA molecules and allows de novo miRNA discovery. Coupling with powerful next-generation sequencing platforms, miR-Seq has been instrumental in the study of miRNA biology. However, significant biases introduced by oligonucleotide ligation steps have prevented miR-Seq from being employed as an accurate quantitation tool. Previous studies demonstrate that biases in current miR-Seq methods often lead to inaccurate miRNA quantification with errors up to 1,000-fold for some miRNAs1,2. To resolve these biases imparted by RNA ligation, we have developed a small RNA ligation method that results in ligation efficiencies of over 95% for both 3&#8217; and 5&#8242; ligation steps. Benchmarking this improved library construction method using equimolar or differentially mixed synthetic miRNAs, consistently yields reads numbers with less than two-fold deviation from the expected value. Furthermore, this high-efficiency miR-Seq method permits accurate genome-wide miRNA profiling from in vivo total RNA samples2.

MicroRNAs (miRNAs) are a widely conserved class of regulatory molecules. Here we describe a miRNA cloning method that relies upon two potent ligation steps followed by high-throughput sequencing. Our method permits accurate genome-wide quantitation of miRNAs.

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide ...

Targeted DNA Methylation Analysis by Next-generation Sequencing

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of particular interest for epigenetic studies as it has been demonstrated to be both a long lasting and a dynamic regulator of gene expression. Efforts to examine epigenetic changes in health and disease have been hindered by the lack of high-throughput, quantitatively accurate methods. With the advent and popularization of next-generation sequencing (NGS) technologies, these tools are now being applied to epigenomics in addition to existing genomic and transcriptomic methodologies. For epigenetic investigations of cytosine methylation where regions of interest, such as specific gene promoters or CpG islands, have been identified and there is a need to examine significant numbers of samples with high quantitative accuracy, we have developed a method called Bisulfite Amplicon Sequencing (BSAS). This method combines bisulfite conversion with targeted amplification of regions of interest, transposome-mediated library construction and benchtop NGS. BSAS offers a rapid and efficient method for analysis of up to 10 kb of targeted regions in up to 96 samples at a time that can be performed by most research groups with basic molecular biology skills. The results provide absolute quantitation of cytosine methylation with base specificity. BSAS can be applied to any genomic region from any DNA source. This method is useful for hypothesis testing studies of target regions of interest as well as confirmation of regions identified in genome-wide methylation analyses such as whole genome bisulfite sequencing, reduced representation bisulfite sequencing, and methylated DNA immunoprecipitation sequencing.

Bisulfite amplicon sequencing (BSAS) is a method for quantifying cytosine methylation in targeted genomic regions of interest. This method uses bisulfite conversion paired with PCR amplification of target regions prior to next-generation sequencing to produce absolute quantitation of DNA methylation at a base-specific level.

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of ...

Isolation of Specific Genomic Regions and Identification of Associated Molecules by enChIP

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the functions of these regions. To enable the non-biased identification of molecules interacting with a specific genomic region of interest, we recently developed the engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) technique. Here, we describe how to use enChIP to isolate specific genomic regions and identify the associated proteins and RNAs. First, a genomic region of interest is tagged with a transcription activator-like (TAL) protein or a clustered regularly interspaced short palindromic repeats (CRISPR) complex consisting of a catalytically inactive form of Cas9 and a guide RNA. Subsequently, the chromatin is crosslinked and fragmented by sonication. The tagged locus is then immunoprecipitated and the crosslinking is reversed. Finally, the proteins or RNAs that are associated with the isolated chromatin are subjected to mass spectrometric or RNA sequencing analyses, respectively. This approach allows the successful identification of proteins and RNAs associated with a genomic region of interest.

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the functions of these regions. This protocol describes procedures to perform engineered DNA-binding molecule-mediated chromatin imunoprecipitation (enChIP) for identification of proteins and RNAs associated with a specific genomic region.

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information.

We describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs for characterization of bacterial communities using 16S rRNA gene amplicon sequencing. The method allows for a common processing approach for multiple sample types and accommodates a number of downstream analytic processes.

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing ...

A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel sequencing technology have opened up the possibility of assessing the functional or fitness effects of large numbers of mutations simultaneously. Here, we present a protocol for experimentally determining the effects of all possible single amino acid mutations in a protein of interest utilizing high-throughput sequencing technology, using the 263 amino acid antibiotic resistance enzyme TEM-1 &#946;-lactamase as an example. In this approach, a whole-protein saturation mutagenesis library is constructed by site-directed mutagenic PCR, randomizing each position individually to all possible amino acids. The library is then transformed into bacteria, and selected for the ability to confer resistance to &#946;-lactam antibiotics. The fitness effect of each mutation is then determined by deep sequencing of the library before and after selection. Importantly, this protocol introduces methods which maximize sequencing read depth and permit the simultaneous selection of the entire mutation library, by mixing adjacent positions into groups of length accommodated by high-throughput sequencing read length and utilizing orthogonal primers to barcode each group. Representative results using this protocol are provided by assessing the fitness effects of all single amino acid mutations in TEM-1 at a clinically relevant dosage of ampicillin. The method should be easily extendable to other proteins for which a high-throughput selection assay is in place.

We present a protocol for the functional assessment of comprehensive single-site saturation mutagenesis libraries of proteins utilizing high-throughput sequencing. Importantly, this approach uses orthogonal primer pairs to multiplex library construction and sequencing. Representative results using TEM-1 &#946;-lactamase selected at a clinically relevant dosage of ampicillin are provided.

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel ...

Interactome-Seq: A Protocol for Domainome Library Construction, Validation and Selection by Phage Display and Next Generation Sequencing

Folding reporters are proteins with easily identifiable phenotypes, such as antibiotic resistance, whose folding and function is compromised when fused to poorly folding proteins or random open reading frames. We have developed a strategy where, by using TEM-1 &#946;-lactamase (the enzyme conferring ampicillin resistance) on a genomic scale, we can select collections of correctly folded protein domains from the coding portion of the DNA of any intronless genome. The protein fragments obtained by this approach, the so called &#34;domainome&#34;, will be well expressed and soluble, making them suitable for structural/functional studies.
By cloning and displaying the &#34;domainome&#34; directly in a phage display system, we have showed that it is possible to select specific protein domains with the desired binding properties (e.g., to other proteins or to antibodies), thus providing essential experimental information for gene annotation or antigen identification.
The identification of the most enriched clones in a selected polyclonal population can be achieved by using novel next-generation sequencing technologies (NGS). For these reasons, we introduce deep sequencing analysis of the library itself and the selection outputs to provide complete information on diversity, abundance and precise mapping of each of the selected fragment. The protocols presented here show the key steps for library construction, characterization, and validation.

The protocols described allow the construction, characterization and selection (against the target of choice) of a &#34;domainome&#34; library made from any DNA source. This is achieved by a research pipeline that combines different technologies: phage display, a folding reporter and next generation sequencing with a web tool for data analysis.

Folding reporters are proteins with easily identifiable phenotypes, such as antibiotic resistance, whose folding and function is compromised when fused to ...