This work was supported by grants from the Shanghai Committee of Science and Technology (15411951800, 15410723200). The authors wish to thank Prof. YuMei Wen and Prof. Chao Zhao of the Pathogenic Microorganism Department of Fudan University for their technical assistance.

This method was performed in accordance with the approved guidelines and regulations of the Research Ethics Committee of Huashan Hospital, Fudan University. Corresponding standard safety measures were followed in each step. For a schematic presentation, please refer to Figure 1.
1. Cell Culture and Plasmid Construct
<ol>
	<li>Routinely maintain the human umbilical vein endothelial cell (HUVEC) in Dulbecco&#39;s modified Eagle&#39;s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 unit/mL of penicillin, and 100 &#181;g/mL of streptomycin in a humidified 5% CO2 incubator at 37 &#176;C.</li>
	<li>Digest PLKO.1 plasmid with ApaI and EcoRI for the synthesis of shRNA fragment. Ensure that the oligonucleotide sequence of VHL shRNA vector is CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14.</li>
	<li>Then, mix 20 &#181;&#924; system with forward 5 &#181;L of oligo, 5 &#181;L of reverse oligo, 5 &#181;L of 10x NEB buffer and 35 &#181;L of ddH2O together (The total volume is 50 &#181;L). Heat the mixture at 98 &#176;C for 4 min, and slowly cool down to room temperature in a few hours.</li>
	<li>Ligate the annealed oligos and PLKO.1 plasmid together with T4 ligase at 4 &#176;C for overnight. 16 h later, add 5 &#181;L of ligation mix into 25 &#181;L competent DH5&#945; cells. Then, screen the successfully ligated plasmids, and verify the inserted fragment by sequencing.</li>
</ol>
2. Lentivirus Package and Infection
<ol>
	<li>In total, mix 10 &#181;g of the PLKO.1-shVHL or PLKO.1-shScramble vector, 7.5 &#181;g of packing plasmid psPAX2, and 2.5 &#181;g of envelope plasmid pMD2.G in 500 &#181;L of the DMEM media without fetal bovine serum (FBS) for 25 min.</li>
	<li>Add 7 mLDMEM without FBS to the solution prepared above.</li>
	<li>Culture 293FT cells in the DMEM without FBS in a 10-cm diameter tissue culture dishes. Ensure that the number of 293FT cells is 1 x 107 using a cell counter.</li>
	<li>Add 1 mL of the solution prepared above to the medium of 293FT cells for transfection. 
	Note: The 293FT cell line is derived from the 293F cell line and stably express the SV40 large T antigen. Therefore, it is a suitable host for lentiviral production.</li>
	<li>Replace the culture medium with the DMEM containing 10% FBS after 6 h.</li>
	<li>Collect the media using a pipette at 48 h after transfection. 
	Note: The virus exists in the DMEM containing 10% FBS. The dead cells float on the medium. Use 0.45 &#181;m sterile membrane to filter the dead cells and impurities. Generally, there is no need to check multiplicity of infection (MOI). This is to establish a stable cells line. At the last step, all living cells without successful infection will die by puromycin. The shScramble group and HUVEC cells are the control group. Ensure that all the HUVEC cells die with the used puromycin concentration by 72 h. Every well has the same number of cells.</li>
	<li>Culture the HUVEC cells in the lentiviral media for 72 h. Then, add puromycin to the media of the HUVEC cells at a concentration of 2 &#181;g/mL for 24 h. Use HUVEC cells without any treatment as the control group. Ensure that all control cells die by this time. 
	Note: The living cells represent a stable cell line of VHL knockdown cells and shSramble cells. The plating density is 5,000/well in 96-well plates.</li>
</ol>
3. Generation of Endothelial Cell Spheroids
<ol>
	<li>Trypsinize the HUVECs cells and resuspend in the DMEM medium with 10% FBS. With a moderate number of cells in a 10-cm culture dish, add 1 mL of typsin-EDTA.</li>
	<li>Seed the cells in a 3D round-bottom 96-well plate, at a cell density of 1 &#215; 103 cells/well. Use a well that can accommodate a spheroid of 0.50 &#181;L to suspend the spheroid. Count cells using a&#160;cell counter system following the manufacturer&#39;s instructions.</li>
	<li>Incubate the cells at 37 &#176;C and 5% CO2 continuously for 72 h. Under these conditions, ensure that the suspended cells form the cell spheroids automatically. Replace half of the culture medium after 36 h.</li>
</ol>
4. In vitro Angiogenesis Assay
<ol>
	<li>Thaw the gel solution at 4 &#176;C and dilute it with the reduced serum medium at a dilution ratio of 1:5.</li>
	<li>Suck the spheroids from the DMEM culture medium with a micropipette. After washing the spheroids with 5 mL of the reduced serum medium, suspend the spheroids gently and cautiously in the diluted gel. Ensure that there are no air bubbles.</li>
	<li>Embed 300 &#181;L of mixed liquid in a 15-well plate. After incubation at 37 &#176;C and 5% CO2 for 1 h, add 400 &#181;L the reduced serum medium to each well. Fill sterile water around the wells to generate a humidified environment to hinder evaporation.</li>
	<li>Thereafter, culture the plate at 37 &#176;C in 5% CO2 at 100% humidity for 1 h.</li>
	<li>Carefully aspirate the old medium and replace it by 600 &#181;L of reduced serum medium with 1% endothelial cell growth supplements in each well.</li>
	<li>After 12 h or 24 h, take images under an inverted light microscope (40*).</li>
</ol>
5. Data Analysis
<ol>
	<li>Upload the images to an online image analysis platform to obtain sprout length data (Table of Materials).</li>
	<li>On the webpage, create an account by email.</li>
	<li>Then upload the images by clicking the upload button.</li>
	<li>Download the result by clicking the download button. 
	Note: The software will generate the processed image and the data. The data contain five parts: cumulative sprout length, mean sprout length, the standard deviation of sprout length, sprout area and spheroid area. In the processed image, each parameter is outlined in a different color to ease identification in the processed image: Red represents sprouts skeleton, yellow the number of sprouts, blue the sprout structure, white sprout end, and orange spheroid.</li>
</ol>

<ol>
	<li>Lonser, R. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=von+Hippel-Lindau+disease.">von Hippel-Lindau disease.</a> Lancet. 361 (9374), 2059-2067 (2003).</li><li>Hussein, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+nervous+system+capillary+haemangioblastoma:+the+pathologist's+viewpoint.">Central nervous system capillary haemangioblastoma: the pathologist's viewpoint.</a> Int J Exp Pathol. 88 (5), 311-324 (2007).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemangioblastomas+might+derive+from+neoplastic+transformation+of+neural+stem+cells/progenitors+in+the+specific+niche.">Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche.</a> Carcinogenesis. 32 (1), 102-109 (2011).</li><li>Zhuang, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+derived+vasculogenesis+in+von+Hippel-Lindau+disease-associated+tumors.">Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors.</a> Sci Rep. 4, 4102 (2014).</li><li>Glasker, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VHL-deficient+vasculogenesis+in+hemangioblastoma.">VHL-deficient vasculogenesis in hemangioblastoma.</a> Exp Mol Pathol. 96 (2), 162-167 (2014).</li><li>Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Up-regulation+of+vascular+endothelial+growth+factor+and+its+receptors+in+von+Hippel-Lindau+disease-associated+and+sporadic+hemangioblastomas.">Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas.</a> Cancer Res. 55 (6), 1358-1364 (1995).</li><li>Cancilla, P. A., Zimmerman, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+fine+structure+of+a+cerebellar+hemangioblastoma.">The fine structure of a cerebellar hemangioblastoma.</a> J Neuropathol Exp Neurol. 24 (4), 621-628 (1965).</li><li>Kawamura, J., Garcia, J. H., Kamijyo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cerebellar+hemangioblastoma:+histogenesis+of+stroma+cells.">Cerebellar hemangioblastoma: histogenesis of stroma cells.</a> Cancer. 31 (6), 1528-1540 (1973).</li><li>Jurco, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemangioblastomas:+histogenesis+of+the+stromal+cell+studied+by+immunocytochemistry.">Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry.</a> Hum Pathol. 13 (1), 13-18 (1982).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+tumorigenic+cells+and+implication+of+their+aberrant+differentiation+in+human+hemangioblastomas.">Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas.</a> Cancer Biol Ther. 12 (8), 727-736 (2011).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD41+and+CD45+expression+marks+the+angioformative+initiation+of+neovascularisation+in+human+haemangioblastoma.">CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma.</a> Tumour Biol. 37 (3), 3765-3774 (2016).</li><li>Sharifpanah, F., Sauer, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+Cell+Spheroid-Based+Sprout+Assay+in+Three-Dimensional+Fibrin+Scaffold:+A+Novel+In+Vitro+Model+for+the+Study+of+Angiogenesis.">Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis.</a> Methods Mol Biol. 1430, 179-189 (2016).</li><li>Cai, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+taurine+upregulated+1+enhances+tumor-induced+angiogenesis+through+inhibiting+microRNA-299+in+human+glioblastoma.">Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma.</a> Oncogene. 36 (3), 318-331 (2017).</li><li>Xu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Conveniently+Screening+pLKO.1-TRC+Vector+Tagged+with+TurboGFP.">Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP.</a> Appl Biochem Biotechnol. 181 (2), 699-709 (2017).</li><li>Laib, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spheroid-based+human+endothelial+cell+microvessel+formation+in+vivo.">Spheroid-based human endothelial cell microvessel formation in vivo.</a> Nat Protoc. 4 (8), 1202-1215 (2009).</li><li>D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Angiogenesis+and+Vasculogenesis+in+Health+and+Disease.">Angiogenesis and Vasculogenesis in Health and Disease.</a> Biomed Res Int. 2015, 126582 (2015).</li><li>Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impaired+in+vivo+vasculogenic+potential+of+endothelial+progenitor+cells+in+comparison+to+human+umbilical+vein+endothelial+cells+in+a+spheroid-based+implantation+model.">Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model.</a> Cell Prolif. 42 (4), 498-505 (2009).</li><li>Morin, K. T., Tranquillo, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+models+of+angiogenesis+and+vasculogenesis+in+fibrin+gel.">In vitro models of angiogenesis and vasculogenesis in fibrin gel.</a> Exp Cell Res. 319 (16), 2409-2417 (2013).</li><li>Blacher, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+invasion+in+the+spheroid+sprouting+assay:+a+spatial+organisation+analysis+adaptable+to+cell+behaviour.">Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour.</a> PLoS One. 9 (5), 97019 (2014).</li><li>Straume, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+heat+shock+protein+27+induces+long-term+dormancy+in+human+breast+cancer.">Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer.</a> Proc Natl Acad Sci U S A. 109 (22), 8699-8704 (2012).</li><li>Naumov, G. N., Akslen, L. A., Folkman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+angiogenesis+in+human+tumor+dormancy:+animal+models+of+the+angiogenic+switch.">Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch.</a> Cell Cycle. 5 (16), 1779-1787 (2006).</li><li>Naumov, G. N., Folkman, J., Straume, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+dormancy+due+to+failure+of+angiogenesis:+role+of+the+microenvironment.">Tumor dormancy due to failure of angiogenesis: role of the microenvironment.</a> Clin Exp Metastasis. 26 (1), 51-60 (2009).</li><li>Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroprotective+effects+respond+to+cerebral+ischemia+without+susceptibility+to+HB-tumorigenesis+in+VHL+heterozygous+knockout+mice.">Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice.</a> Mol Carcinog. 56 (10), 2342-2351 (2017).</li><li>Stratmann, R., Krieg, M., Haas, R., Plate, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Putative+control+of+angiogenesis+in+hemangioblastomas+by+the+von+Hippel-Lindau+tumor+suppressor+gene.">Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene.</a> J Neuropathol Exp Neurol. 56 (11), 1242-1252 (1997).</li><li>Correa de Sampaio, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+heterogeneous+in+vitro+three+dimensional+model+of+tumour-stroma+interactions+regulating+sprouting+angiogenesis.">A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis.</a> PLoS One. 7 (2), 30753 (2012).</li></ol>

The authors have nothing to disclose.

Recently, multiple fields of vascular biology research were stimulated by the study of the angiogenic endothelium15. In this article, we developed an endothelial spheroid sprouting technique as an experimental model to study the vessel formation that originates from the VHL gene&#39;s loss of function in manipulated endothelial cells to identify novel candidate molecules of the angiogenic cascade. To the best of our knowledge, this is the first report to examine the angiogenic effects of the endog...

Hemangioblastomas (HBs) are benign vascular tumors that are found exclusively within the human central nervous system (CNS). They develop in patients with either von Hippel-Lindau (VHL) disease or sporadic lesions. VHL-HBs are difficult to cure through surgical treatment due to the frequent recurrence and multiple lesions that result from this genetic disorder1. Although the inactivation of the VHL tumor suppressor gene has been considered the root cause of the tumorigenesis of VHL-HBs, the cytological origin (including neovascularization) and evolutionary process of HBs remain largely controversial2. Therefore, a better understanding of HB-neovascular biological mechanisms may provide useful insights into the most promising anti-vascular strategies for VHL-HBs.
Recent research has suggested that HB-neovascularization is similar to the embryologic vasculogenesis3,4,5. Classic vascular endothelial growth factor (VEGF)-mediated angiogenesis that originated from the vascular endothelium and that is driven by VHL loss of function resulted in proliferation and neovascular formation, which has been challenged6. In 1965, Cancilla and Zimmerman found, using electron microscopy, that HBs originated from the endothelium7. Later it was found that stromal cells are derived from vasoformative element8. In 1982, Jurco et al. found that stromal cells are of endothelial origin9. Therefore, we hypothesized that human vascular endothelial cells are the original cells of HB-neovascularization10. Although it is better to use the primary cultures from HB cells derived from VHL patient surgeries, our previous research indicated that primary cultures from HB are not stable, and cell lines could not be established3. Moreover, the primary cultures in the 3D environment could not identify the cytological origin of HB-neovascularization because they include the progenitors of HB-vascular ingredients10,11. Therefore, as a primitive and classic model of endothelial cells, human vascular endothelial cells (HUVEC) could serve as an alternative cellular model for HBs.
The spheroid sprouting assay is a new model in tissue engineering12,13. In this paper, a 3D collagen-based coculture system in vitro using the spheroid sprouting assay was developed, with an overall goal to evaluate whether classic tumor angiogenesis exists in HBs, as well as its role in HBs.

<table><tbody><tr><td>human umbilical vein endothelial cell</td><td>Fudan IBS Cell Center</td><td>FDCC-HXN180</td><td></td></tr><tr><td>dulbecco&amp;rsquo;s modified eagle&amp;rsquo;s medium&amp;nbsp;</td><td>Gibco</td><td>11995040</td><td></td></tr><tr><td>fetal bovine serum</td><td>Gibco</td><td>&amp;nbsp;26400044</td><td></td></tr><tr><td>PLKO.1-puro vector</td><td>Addgene</td><td>#8453</td><td></td></tr><tr><td>packing plasmid psPAX2&amp;nbsp;</td><td>Addgene</td><td>#12260</td><td></td></tr><tr><td>envelope plasmid pMD2.G</td><td>Addgene</td><td>#12259</td><td></td></tr><tr><td>3D round-bottom 96-well plates</td><td>S-Bio</td><td>MS-9096M</td><td></td></tr><tr><td>matrigel</td><td>BD Biosciences</td><td>354234</td><td></td></tr><tr><td>Opti-MEM medium</td><td>Gibco</td><td>31985-070</td><td>reduced serum medium&amp;nbsp;</td></tr><tr><td>15-well plate</td><td>Ibidi</td><td>81501</td><td>Air bubbles in the gel can be reduced by equilibrating the &amp;mu;&amp;ndash;Slide angiogenesis before usage inside the incubator overnight</td></tr><tr><td>endothelial cell growth supplements</td><td>Sciencell</td><td>#1052</td><td></td></tr><tr><td>10-cm culture dish</td><td>Corning</td><td>Scipu000813</td><td></td></tr><tr><td>Puromycin</td><td>Gibco</td><td>A1113802</td><td></td></tr><tr><td>typsin-EDTA</td><td>Gibco</td><td>25200056</td><td></td></tr><tr><td>Automated Cell Counter System &amp;nbsp;</td><td>BioTech</td><td></td><td></td></tr><tr><td>Image Analysis software&amp;nbsp;</td><td>Winmasis</td><td></td><td>http://mywim.wimasis.com&amp;nbsp;</td></tr></tbody></table>

a comprehensive procedure to evaluate the in vitro performance of the putative hemangioblastoma neovascularization using the spheroid sprouting assay

The inactivation of the von Hippel-Lindau (VHL) tumor suppressor gene plays a crucial role in the development of hemangioblastomas (HBs) within the human central nervous system (CNS). However, both the cytological origin and the evolutionary process of HBs (including neovascularization) remain controversial, and anti-angiogenesis for VHL-HBs, based on classic HB angiogenesis, have produced disappointing results in clinical trials. One major obstacle to the successful clinical translation of anti-vascular treatment is the lack of a thorough understanding of neovascularization in this vascular tumor. In this article, we present a comprehensive procedure to evaluate in vitro whether classic tumor angiogenesis exists in HBs, as well as its role in HBs. With this procedure, researchers can accurately understand the complexity of HB neovascularization and identify the function of this common form of angiogenesis in HBs. These protocols can be used to evaluate the most promising anti-vascular therapy for tumors, which has high translational potential either for tumors treatment or for aiding in the optimization of the anti-angiogenic treatment for HBs in future translations. The results highlight the complexity of HB neovascularization and suggest that this common form angiogenesis is only a complementary mechanism in HB neovascularization.

Original images are taken by inverted light microscope. The typical images of the control group and the VHL group are shown in Figure 2-A1 and Figure 2-A2. The sprouting length of the control group is shorter than that of the VHL group.
After uploading the Images, the online platform provides analysis results directly. The output consis...

Watch this Scientific Journal Video about A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay at JoVE.

A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

This paper presents a comprehensive procedure to evaluate in vitro whether classic tumor angiogenesis exists in hemangioblastomas (HBs) and its role in HBs. The results highlight the complexity of HB-neovascularization and suggest that this common form of angiogenesis is only a complementary mechanism in the HB-neovascularization.

A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

The inactivation of the von Hippel-Lindau (VHL) tumor suppressor gene plays a crucial role in the development of hemangioblastomas (HBs) within the human ...

a-comprehensive-procedure-to-evaluate-vitro-performance-putative

Research

JoVE Journal

Cancer Research

8.0K Views.  Fudan University. Dit artikel presenteert een uitgebreide procedure om te evalueren in vitro of klassieke tumor angiogenese in hemangioblastomas (HBs) en haar rol in de HBs bestaat. De resultaten wijzen op de complexiteit van de HB-neovascularization en suggereren dat deze gemeenschappelijke vorm van angiogenese slechts een aanvullende mechanisme in de HB-neovascularization is.

Video: A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

A 3D Spheroid Model for Glioblastoma

Two-dimensional (2D) cell cultures do not mimic in vivo tumor growth satisfactorily. Therefore, three-dimensional (3D) culture spheroid models were developed. These models may be particularly important in the field of neuro-oncology. Indeed, brain tumors have the tendency to invade the healthy brain environment. We describe herein an ideal 3D glioblastoma spheroid-based assay that we developed to study tumor invasion. We provide all technical details and analytical tools to successfully perform this assay.

Here, we describe an easy-to-use invasion assay for glioblastoma. This assay is suitable for glioblastoma stem-like cells. A Fiji macro for easy quantification of invasion, migration, and proliferation is also described.

Two-dimensional (2D) cell cultures do not mimic in vivo tumor growth satisfactorily. Therefore, three-dimensional (3D) culture spheroid models were ...

Incorporating Pericytes into an Endothelial Cell Bead Sprouting Assay

Angiogenesis is the growth of new vessels from pre-existing vasculature and is an important component of many biological processes, including embryogenesis and development, wound healing, tumor growth and metastasis, and ocular and cardiovascular diseases. Effective in vitro models that recapitulate the biology of angiogenesis are needed to appropriately study this process and identify mechanisms of regulation that can be ultimately targeted for novel therapeutic strategies. The bead angiogenesis assay has been previously demonstrated to recapitulate the multiple stages of endothelial sprouting in vitro. However, a limitation of this assay is a lack of endothelial &#8211; mural cell interactions, which are key to the molecular and phenotypic regulation of endothelial cell function in vivo. The protocol given here presents a methodology for the incorporation of mural cells into the bead angiogenesis assay and demonstrates a tight association of endothelial cells and pericytes during sprouting in vitro. The protocol also details a methodology for effective silencing of target genes using siRNA in endothelial cells for mechanistic studies. Altogether, this protocol provides an in vitro assay that more appropriately models the diverse cell types involved in sprouting angiogenesis, and provides a more physiologically-relevant platform for therapeutic assessment and novel discovery of mechanisms of angiogenesis regulation.

This protocol presents a novel in vitro bead assay that more appropriately models the process of in vivo sprouting angiogenesis by incorporating pericytes. This modification enables the bead assay to more faithfully recapitulate the heterotypic cellular interactions between endothelial cells and mural cells that are critical for angiogenesis.

Angiogenesis is the growth of new vessels from pre-existing vasculature and is an important component of many biological processes, including ...

Developmental Biology

Three-dimensional Angiogenesis Assay System using Co-culture Spheroids Formed by Endothelial Colony Forming Cells and Mesenchymal Stem Cells

Studies in the field of angiogenesis have been aggressively growing in the last few decades with the recognition that angiogenesis is a hallmark of more than 50 different pathological conditions, such as rheumatoid arthritis, oculopathy, cardiovascular diseases, and tumor metastasis. During angiogenesis drug development, it is crucial to use in vitro assay systems with appropriate cell types and proper conditions to reflect the physiologic angiogenesis process. To overcome limitations of current in vitro angiogenesis assay systems using mainly endothelial cells, we developed a 3-dimensional (3D) co-culture spheroid sprouting assay system. Co-culture spheroids were produced by two human vascular cell precursors, endothelial colony forming cells (ECFCs) and mesenchymal stem cells (MSCs) with a ratio of 5 to 1. ECFCs+MSCs spheroids were embedded into type I collagen matrix to mimic the in vivo extracellular environment. A real-time cell recorder was utilized to continuously observe the progression of angiogenic sprouting from spheroids for 24 h. Live cell fluorescent labeling technique was also applied to tract the localization of each cell type during sprout formation. Angiogenic potential was quantified by counting the number of sprouts and measuring the cumulative length of sprouts generated from the individual spheroids. Five randomly-selected spheroids were analyzed per experimental group. Comparison experiments demonstrated that ECFCs+MSCs spheroids showed greater sprout number and cumulative sprout length compared with ECFCs-only spheroids. Bevacizumab, an FDA-approved angiogenesis inhibitor, was tested with the newly-developed co-culture spheroid assay system to verify its potential to screen anti-angiogenic drugs. The IC50 value for ECFCs+MSCs spheroids compared to the ECFCs-only spheroids was closer to the effective plasma concentration of bevacizumab obtained from the xenograft tumor mouse model. The present study suggests that the 3D ECFCs+MSCs spheroid angiogenesis assay system is relevant to physiologic angiogenesis, and can predict an effective plasma concentration in advance of animal experiments.

Three-dimensional co-culture spheroid angiogenesis assay system is designed to mimic the physiologic angiogenesis. Co-culture spheroids are formed by two human vascular cell precursors, ECFCs and MSCs, and embedded in collagen gel. The new system is effective for evaluating angiogenic modulators, and provides more relevant information to the in vivo study.

Studies in the field of angiogenesis have been aggressively growing in the last few decades with the recognition that angiogenesis is a hallmark of more ...

Spheroid Drug Sensitivity Screening in Glioma Stem Cell Lines

In vitro drug sensitivity screens are important tools in the discovery of anti-cancer drug combination therapies. Typically, these in vitro drug screens are performed on cells grown in a monolayer. However, these two-dimensional (2D) models are considered less accurate compared to three-dimensional (3D) spheroid cell models; this is especially true for glioma stem cell lines. Cells grown in spheres activate different signaling pathways and are considered more representative of in vivo models than monolayer cell lines. This protocol describes a method for in vitro drug screening of spheroid lines; mouse and human glioma stem cell lines are used as an example. This protocol describes a 3D spheroid drug sensitivity and synergy assay that can be used to determine if a drug or drug combination induces cell death and if two drugs synergize. Glioma stem cell lines are&#160;modified to express RFP. Cells are plated in low attachment round well bottom 96 plates, and spheres are allowed to form overnight. Drugs are added, and the growth is monitored by measuring the RFP signal over time using the Incucyte live imaging system,&#160;a fluorescence microscope embedded in the tissue culture incubator. Half maximal inhibitory concentration (IC50), median lethal dose (LD50), and synergy score are subsequently calculated to evaluate sensitivities to drugs alone or in combination. The three-dimensional nature of this assay&#160;provides a more accurate reflection of tumor growth, behavior, and drug sensitivities in vivo, thus forming the basis for further preclinical investigation.

In vitro drug sensitivity screens are important tools for discovering anti-cancer drug combinations. Cells grown in spheres activate different signaling pathways and are considered more representative of in vivo models than monolayer cell lines. This protocol describes a method for in vitro drug screening for spheroid lines.

In vitro drug sensitivity screens are important tools in the discovery of anti-cancer drug combination therapies. Typically, these in vitro drug screens ...

Three-Dimensional (3D) Tumor Spheroid Invasion Assay

Invasion of surrounding normal tissues is generally considered to be a key hallmark of malignant (as opposed to benign) tumors. For some cancers in particular (e.g., brain tumors such as glioblastoma multiforme and squamous cell carcinoma of the head and neck &#8211; SCCHN) it is a cause of severe morbidity and can be life-threatening even in the absence of distant metastases. In addition, cancers which have relapsed following treatment unfortunately often present with a more aggressive phenotype. Therefore, there is an opportunity to target the process of invasion to provide novel therapies that could be complementary to standard anti-proliferative agents. Until now, this strategy has been hampered by the lack of robust, reproducible assays suitable for a detailed analysis of invasion and for drug screening. Here we provide a simple micro-plate method (based on uniform, self-assembling 3D tumor spheroids) which has great potential for such studies. We exemplify the assay platform using a human glioblastoma cell line and also an SCCHN model where the development of resistance against targeted epidermal growth factor receptor (EGFR) inhibitors is associated with enhanced matrix-invasive potential. We also provide two alternative methods of semi-automated quantification: one using an imaging cytometer and a second which simply requires standard microscopy and image capture with digital image analysis.

Three-Dimensional 3D Tumor Spheroid Invasion Assay

Invasion of surrounding normal tissues is a defining characteristic of malignant tumors. We provide here a simple, semi-automated micro-plate assay of invasion into a natural 3D biomatrix that has been exemplified with a number of models of advanced human cancers.

Invasion of surrounding normal tissues is generally considered to be a key hallmark of malignant (as opposed to benign) tumors. For some cancers in ...

Medicine

Perfusable Vascular Network with a Tissue Model in a Microfluidic Device

A spheroid (a multicellular aggregate) is regarded as a good model of living tissues in the human body. Despite the significant advancement in the spheroid cultures, a perfusable vascular network in the spheroids remains a critical challenge for long-term culture required to maintain and develop their functions, such as protein expressions and morphogenesis. The protocol presents a novel method to integrate a perfusable vascular network within the spheroid in a microfluidic device. To induce a perfusable vascular network in the spheroid, angiogenic sprouts connected to microchannels were guided to the spheroid by utilizing angiogenic factors from human lung fibroblasts cultured in the spheroid. The angiogenic sprouts reached the spheroid, merged with the endothelial cells co-cultured in the spheroid, and formed a continuous vascular network. The vascular network could perfuse the interior of the spheroid without any leakage. The constructed vascular network may be further used as a route for supply of nutrients and removal of waste products, mimicking blood circulation in vivo. The method provides a new platform in spheroid culture toward better recapitulation of living tissues.

The protocol describes how to engineer a perfusable vascular network in a spheroid. The spheroid's surrounding microenvironment is devised to induce angiogenesis and connect the spheroid to the microchannels in a microfluidic device. The method allows the perfusion of the spheroid, which is a long-awaited technique in three-dimensional cultures.

A spheroid (a multicellular aggregate) is regarded as a good model of living tissues in the human body. Despite the significant advancement in the ...

Bioengineering

Standardized and Scalable Assay to Study Perfused 3D Angiogenic Sprouting of iPSC-derived Endothelial Cells In Vitro

Pre-clinical drug research of vascular diseases requires in vitro models of vasculature that are amendable to high-throughput screening. However, current in vitro screening models that have sufficient throughput only have limited physiological relevance, which hinders the translation of findings from in vitro to in vivo. On the other hand, microfluidic cell culture platforms have shown unparalleled physiological relevancy in vitro, but often lack the required throughput, scalability and standardization. We demonstrate a robust platform to study angiogenesis of endothelial cells derived from human induced pluripotent stem cells (iPSC-ECs) in a physiological relevant cellular microenvironment, including perfusion and gradients. The iPSC-ECs are cultured as 40 perfused 3D microvessels against a patterned collagen-1 scaffold. Upon the application of a gradient of angiogenic factors, important hallmarks of angiogenesis can be studied, including the differentiation into tip- and stalk cell and the formation of perfusable lumen. Perfusion with fluorescent tracer dyes enables the study of permeability during and after anastomosis of the angiogenic sprouts. In conclusion, this method shows the feasibility of iPSC-derived ECs in a standardized and scalable 3D angiogenic assay that combines physiological relevant culture conditions in a platform that has the required robustness and scalability to be integrated within the drug screening infrastructure.

This method describes the culture of iPSC-derived endothelial cells as 40 perfused 3D microvessels in a standardized microfluidic platform. This platform enables the study of gradient-driven angiogenic sprouting in 3D, including anastomosis and stabilization of the angiogenic sprouts in a scalable and high-throughput manner.

Pre-clinical drug research of vascular diseases requires in vitro models of vasculature that are amendable to high-throughput screening. However, current ...

An Ex Vivo Choroid Sprouting Assay of Ocular Microvascular Angiogenesis

Pathological choroidal angiogenesis, a salient feature of age-related macular degeneration, leads to vision impairment and blindness. Endothelial cell (EC) proliferation assays using human retinal microvascular endothelial cells (HRMECs) or isolated primary retinal ECs are widely used in vitro models to study retinal angiogenesis. However, isolating pure murine retinal endothelial cells is technically challenging and retinal ECs may have different proliferation responses than choroidal endothelial cells and different cell/cell interactions. A highly reproducible ex vivo choroidal sprouting assay as a model of choroidal microvascular proliferation was developed. This model includes the interaction between choroid vasculature (EC, macrophages, pericytes) and retinal pigment epithelium (RPE). Mouse RPE/choroid/scleral explants are isolated and incubated in growth-factor-reduced basal membrane extract (BME) (day 0). Medium is changed every other day and choroid sprouting is quantified at day 6. The images of individual choroid explant are taken with an inverted phase microscope and the sprouting area is quantified using a semi-automated macro plug-in to the ImageJ software developed in this lab. This reproducible ex vivo choroidal sprouting assay can be used to assess compounds for potential treatment and for microvascular disease research to assess pathways involved in choroidal micro vessel proliferation using wild type and genetically modified mouse tissue.

This protocol presents choroid sprouting assay, an ex vivo model of microvascular proliferation. This assay can be used to assess pathways involved in proliferating choroidal micro vessels and assess drug treatments using wild type and genetically modified mouse tissue.

Pathological choroidal angiogenesis, a salient feature of age-related macular degeneration, leads to vision impairment and blindness. Endothelial cell ...

Biology

Study of Angiogenesis Using Scratch Wound Migration and Spheroid Sprouting Assays

Investigating Angiogenesis on a Functional and Molecular Level by Leveraging the Scratch Wound Migration Assay and the Spheroid Sprouting Assay

Angiogenesis plays a crucial role in both physiological and pathological processes within the body including tumor growth or neovascular eye disease. A detailed understanding of the underlying molecular mechanisms and reliable screening models are essential for targeting diseases effectively and developing new therapeutic options. Several in vitro assays have been developed to model angiogenesis, capitalizing on the opportunities a controlled environment provides to elucidate angiogenic drivers at a molecular level and screen for therapeutic targets.
This study presents workflows for investigating angiogenesis in vitro using human umbilical vein endothelial cells (HUVECs). We detail a scratch wound migration assay utilizing a live cell imaging system measuring endothelial cell migration in a 2D setting and the spheroid sprouting assay assessing endothelial cell sprouting in a 3D setting provided by a collagen matrix. Additionally, we outline strategies for sample preparation to enable further molecular analyses such as transcriptomics, particularly in the 3D setting, including RNA extraction as well as immunocytochemistry. Altogether, this framework offers scientists a reliable and versatile toolset to pursue their scientific inquiries in in vitro angiogenesis assays.

Author Spotlight: Investigating Angiogenesis Through Challenges and Innovations in Assay Development

This study presents the two-dimensional (2D) scratch wound migration assay and the three-dimensional (3D) spheroid sprouting assay, along with their respective downstream analysis methods, including RNA extraction and immunocytochemistry, as suitable assays to study angiogenesis in vitro.

Angiogenesis plays a crucial role in both physiological and pathological processes within the body including tumor growth or neovascular eye disease. A ...

In Vitro Three-Dimensional Sprouting Assay of Angiogenesis Using Mouse Embryonic Stem Cells for Vascular Disease Modeling and Drug Testing

Recent advances in induced pluripotent stem cells (iPSC) and gene editing technologies enable the development of novel human cell-based disease models for phenotypic drug discovery (PDD) programs. Although these novel devices could predict the safety and efficacy of investigational drugs in humans more accurately, their development to the clinic still strongly rely on mammalian data, notably the use of mouse disease models. In parallel to human organoid or organ-on-chip disease models, the development of relevant in vitro mouse models is therefore an unmet need for evaluating direct drug efficacy and safety comparisons between species and in vivo and in vitro conditions. Here, a vascular sprouting assay that utilizes mouse embryonic stem cells differentiated into embryoid bodies (EBs) is described. Vascularized EBs cultured onto 3D-collagen gel develop new blood vessels that expand, a process called sprouting angiogenesis. This model recapitulates key features of in vivo sprouting angiogenesis-formation of blood vessels from a pre-existing vascular network-including endothelial tip cell selection, endothelial cell migration and proliferation, cell guidance, tube formation, and mural cell recruitment. It is amenable to screening for drugs and genes modulating angiogenesis and shows similarities with recently described three-dimensional (3D) vascular assays based on human iPSC technologies.

In Vitro Three-Dimensional Sprouting Assay of Angiogenesis Using Mouse Embryonic Stem Cells for Vascular Disease Modeling and Drug Testing

This assay utilizes mouse embryonic stem cells differentiated into embryoid bodies cultured in 3D-collagen gel to analyze the biological processes that control sprouting angiogenesis in vitro. The technique can be applied for testing drugs, modeling diseases, and for studying specific genes in the context of deletions that are embryonically lethal.

Recent advances in induced pluripotent stem cells (iPSC) and gene editing technologies enable the development of novel human cell-based disease models for ...

A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

Samenvatting

Meer video's verkennen