Bu eser hibe Shanghai komite bilim ve Teknoloji (15411951800, 15410723200) tarafından desteklenmiştir. Yazarlar Prof. YuMei Wen ve Prof. Chao Zhao patojen mikroorganizma bölümü Bund'a Üniversitesi Teknik yardım için teşekkür etmek istiyorum.

Bu yöntem onaylı yönergeleri ve araştırma Etik Komitesi, Huashan Hastanesi, Bund'a Üniversitesi düzenlemelere uygun şekilde gerçekleştirildi. Karşılık gelen standart güvenlik önlemleri her adımda takip edildi. Şematik bir sunu için şekil 1' e bakınız.
1. hücre kültür ve plazmid yapı
<ol><li>Rutin olarak Dulbecco içinde insan göbek damar endotel hücre (HUVEC) kartal orta (DMEM) ile % 10 fetal sığır serum (FBS), 100 birim/mL penisilin ve streptomisin oksijen %5 100 µg/mL takıma değiştiren'ın korumak CO2 kuluçka 37 ° C'de</li>
	<li>ShRNA parçası sentezi için Özet PLKO.1 plazmid ile APAI ve EcoRI. Oligonükleotid serisini VHL shRNA vektör CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14olduğundan emin olun.</li>
	<li>Sonra 20 µΜ sistem oligo, ters oligo 5 µL, 10 NF'leri arabellek x 5 µL ve (Toplam 50 µL birimdir) GKD2O birlikte 35 µL ileri 5 µL ile karıştırın. 4 dk ve yavaş yavaş aşağı oda sıcaklığına serin için 98 ° C'de karışımı bir kaç saat içinde ısı.</li>
	<li>Tavlanmış oligos ve PLKO.1 plazmid T4 ligaz 4 ° C'de birlikte gece için ligate. 16 h sonra 5 µL 25 µL yetkili DH5α hücrelere ligasyonu karışımı ekleyin. Sonra başarıyla ve birleştirilmiş plazmid ekran ve sıralama tarafından eklenen parça doğrulayın.</li>
</ol>2. lentivirus paket ve enfeksiyon
<ol><li>Toplamda, PLKO.1-shVHL veya PLKO.1-shScramble vektör 10 µg, plazmid psPAX2 ambalaj 7.5 µg ve zarf plazmid pMD2.G 500 µL fetal sığır serum (FBS) 25 min için olmadan DMEM medyanın içinde 2,5 µg karıştırın.</li>
	<li>7 mLDMEM FBS olmadan yukarıda hazırlanan çözüm ekleyin.</li>
	<li>Kültür 293FT 10 cm çapında doku kültürü yemekleri FBS olmadan DMEM hücrelerde. 293 FT hücreleri hücre sayaç 1 x 107 olduğundan emin olun.</li>
	<li>Yukarıda transfection için 293 FT hücreleri Orta olarak hazırlanan çözeltinin 1 mL ekleyin. Not: 293FT hücre kültürünü 293F hücre satırından türetilir ve stabil SV40 büyük T antijen ifade eder. Bu nedenle, lentiviral üretim için uygun bir ev sahipliği yapmaktadır.</li>
	<li>% 10 içeren DMEM ile Kültür orta yerine FBS 6 h sonra.</li>
	<li>Bir pipet 48 h transfection sonra medya toplamak. Not: % 10 içeren DMEM virüs var FBS. Ortamdaki ölü hücreleri float. Steril 0,45 µm membran ölü hücreleri ve kirleri filtre uygulamak için kullanın. Genel olarak, enfeksiyon (MOI) çokluğu denetlemek için gerek yoktur. Bu bir istikrarlı hücreleri çizgi oluşturmaktır. Son adımda, başarılı enfeksiyonu olmadan tüm canlı hücreler tarafından puromisindir ölecek. ShScramble grup ve HUVEC hücreleri kontrol grubu vardır. Tüm HUVEC hücreleri 72 h tarafından kullanılan puromisindir konsantrasyon ile ölmek emin olun. Her şey aynı sayıda hücre vardır.</li>
	<li>Lentiviral medya için 72 h HUVEC hücrelerde kültür. Daha sonra puromisindir HUVEC hücre 2 µg/mL 24 h kullanım HUVEC hücreleri kontrol grubu olarak herhangi bir tedavi için bir konsantrasyon, medya ekleyin. Tüm bu zamana kadar hücreleri die kontrol emin olun. Not: Canlı hücreler VHL devirme hücreleri ve shSramble hücreleri istikrarlı hücre kültürünü temsil eder. Kaplama 5.000/96-şey levha iyi yoğunluğudur.</li>
</ol>3. nesil endotel hücre pulcuklarının
<ol><li>HUVECs hücre trypsinize ve % 10 DMEM orta resuspend FBS. Hücre 10 cm kültür tabak içinde ılımlı sayısı ile 1 mL typsin-EDTA ekleyin.</li>
	<li>1 × 103 hücreleri/iyi bir hücre yoğunluğuna, 3D bir yuvarlak alt 96-şey plaka hücrelerde tohum. Küresel askıya almak için 0.50 µL küresel ağırlayacak iyi kullanın. Üreticinin yönergelerini izleyerek bir hücre sayaç sistemi kullanarak hücreleri saymak.</li>
	<li>37 ° C ve 72 h için sürekli olarak % 5 CO2 hücreleri kuluçkaya. Bu koşullar altında askıya alınan hücrelerin hücre pulcuklarının otomatik olarak oluşturmak emin olun. Kültür orta yarısı 36 h sonra değiştirin.</li>
</ol>4. vitro angiogenez tahlil
<ol><li>Jel çözüm 4 ° C'de erimek ve ile indirimli serum orta seyreltme oranı 1:5 oranında seyreltin.</li>
	<li>Bir micropipette ile DMEM kültür ortamdan pulcuklarının emmek. Yıkandıktan sonra düşük serum orta 5 mL ile pulcuklarının askıya pulcuklarının yavaşça ve dikkatli seyreltilmiş jel. Hava hava kabarcığı yok olduğundan emin olun.</li>
	<li>Karışık sıvı 300 µL bir 15-şey tabak içinde embed. 37 ° C ve 1 h için % 5 CO2 kuluçka sonra 400 µL düşük serum orta her şey için ekleyin. Buharlaşma engellemek için oksijen bir ortam oluşturmak için kuyu etrafında steril su doldurun.</li>
	<li>Bundan sonra kültür plaka 37 ° c için 1 h %100 nem oranı, % 5 CO2 .</li>
	<li>Dikkatle eski orta Aspire edin ve düşük serum orta % 1 endotel hücre büyüme takviyeleri her iyi ile 600 µL tarafından değiştirin.</li>
	<li>12 saat veya 24 saat sonra bir ters ışık mikroskobu altında görüntü almak (40 *).</li>
</ol>5. veri analizi
<ol><li>Filiz uzunluğu veri (Tablo reçetesi) elde etmek için çevrimiçi görüntü analiz platformu için resim yüklemek.</li>
	<li>Web sayfasında, e-posta ile bir hesap oluşturun.</li>
	<li>O zaman Resim Yükle düğmesini tıklatarak yüklemek.</li>
	<li>Sonuç karşıdan yükle düğmesini tıklatarak karşıdan yükleyin. Not: Yazılım işlenmiş görüntü ve veri oluşturur. Beş bölümden verileri içeren: toplu Filiz uzunluğu, ortalama Filiz uzunluğu, Filiz uzunluğu, Filiz alanı ve küresel alan standart sapması. İşlenmiş görüntüde her parametre tanımlama işlenen görüntünün içinde kolaylaştırmak için farklı bir renkte ana hatlarıyla: kırmızı temsil lahanası iskelet, lahanası sayısı sarı, Filiz yapısı, beyaz Filiz end ve turuncu küresel mavi.</li>
</ol>

<ol><li>Lonser, R. R., et al. <a target="_blank" href="http://www.sciencedirect.com/science/article/pii/S0140673603136434">von Hippel-Lindau disease.</a> Lancet. 361 (9374), 2059-2067 (2003).</li>
<li>Hussein, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Central+nervous+system+capillary+haemangioblastoma%3A+the+pathologist%27s+viewpoint%5BTitle%5D)+AND+%22Int+J+Exp+Pathol%22%5BJournal%5D)">Central nervous system capillary haemangioblastoma: the pathologist's viewpoint.</a> Int J Exp Pathol. 88 (5), 311-324 (2007).</li>
<li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Hemangioblastomas+might+derive+from+neoplastic+transformation+of+neural+stem+cells%2Fprogenitors+in+the+specific+niche%5BTitle%5D)+AND+%22Carcinogenesis%22%5BJournal%5D)">Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche.</a> Carcinogenesis. 32 (1), 102-109 (2011).</li>
<li>Zhuang, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Tumor+derived+vasculogenesis+in+von+Hippel-Lindau+disease-associated+tumors%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors.</a> Sci Rep. 4, 4102(2014).</li>
<li>Glasker, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((VHL-deficient+vasculogenesis+in+hemangioblastoma%5BTitle%5D)+AND+%22Exp+Mol+Pathol%22%5BJournal%5D)">VHL-deficient vasculogenesis in hemangioblastoma.</a> Exp Mol Pathol. 96 (2), 162-167 (2014).</li>
<li>Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Up-regulation+of+vascular+endothelial+growth+factor+and+its+receptors+in+von+Hippel-Lindau+disease-associated+and+sporadic+hemangioblastomas%5BTitle%5D)+AND+%22Cancer+Res%22%5BJournal%5D)">Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas.</a> Cancer Res. 55 (6), 1358-1364 (1995).</li>
<li>Cancilla, P. A., Zimmerman, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+fine+structure+of+a+cerebellar+hemangioblastoma%5BTitle%5D)+AND+%22J+Neuropathol+Exp+Neurol%22%5BJournal%5D)">The fine structure of a cerebellar hemangioblastoma.</a> J Neuropathol Exp Neurol. 24 (4), 621-628 (1965).</li>
<li>Kawamura, J., Garcia, J. H., Kamijyo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cerebellar+hemangioblastoma%3A+histogenesis+of+stroma+cells%5BTitle%5D)+AND+%22Cancer%22%5BJournal%5D)">Cerebellar hemangioblastoma: histogenesis of stroma cells.</a> Cancer. 31 (6), 1528-1540 (1973).</li>
<li>Jurco, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Hemangioblastomas%3A+histogenesis+of+the+stromal+cell+studied+by+immunocytochemistry%5BTitle%5D)+AND+%22Hum+Pathol%22%5BJournal%5D)">Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry.</a> Hum Pathol. 13 (1), 13-18 (1982).</li>
<li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+of+tumorigenic+cells+and+implication+of+their+aberrant+differentiation+in+human+hemangioblastomas%5BTitle%5D)+AND+%22Cancer+Biol+Ther%22%5BJournal%5D)">Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas.</a> Cancer Biol Ther. 12 (8), 727-736 (2011).</li>
<li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CD41+and+CD45+expression+marks+the+angioformative+initiation+of+neovascularisation+in+human+haemangioblastoma%5BTitle%5D)+AND+%22Tumour+Biol%22%5BJournal%5D)">CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma.</a> Tumour Biol. 37 (3), 3765-3774 (2016).</li>
<li>Sharifpanah, F., Sauer, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Stem+Cell+Spheroid-Based+Sprout+Assay+in+Three-Dimensional+Fibrin+Scaffold%3A+A+Novel+In+Vitro+Model+for+the+Study+of+Angiogenesis%5BTitle%5D)+AND+%22Methods+Mol+Biol%22%5BJournal%5D)">Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis.</a> Methods Mol Biol. 1430, 179-189 (2016).</li>
<li>Cai, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Long+non-coding+RNA+taurine+upregulated+1+enhances+tumor-induced+angiogenesis+through+inhibiting+microRNA-299+in+human+glioblastoma%5BTitle%5D)+AND+%22Oncogene%22%5BJournal%5D)">Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma.</a> Oncogene. 36 (3), 318-331 (2017).</li>
<li>Xu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Construction+of+Conveniently+Screening+pLKO.1-TRC+Vector+Tagged+with+TurboGFP%5BTitle%5D)+AND+%22Appl+Biochem+Biotechnol%22%5BJournal%5D)">Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP.</a> Appl Biochem Biotechnol. 181 (2), 699-709 (2017).</li>
<li>Laib, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Spheroid-based+human+endothelial+cell+microvessel+formation+in+vivo%5BTitle%5D)+AND+%22Nat+Protoc%22%5BJournal%5D)">Spheroid-based human endothelial cell microvessel formation in vivo.</a> Nat Protoc. 4 (8), 1202-1215 (2009).</li>
<li>D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Angiogenesis+and+Vasculogenesis+in+Health+and+Disease%5BTitle%5D)+AND+%22Biomed+Res+Int%22%5BJournal%5D)">Angiogenesis and Vasculogenesis in Health and Disease.</a> Biomed Res Int. 2015, 126582(2015).</li>
<li>Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Impaired+in+vivo+vasculogenic+potential+of+endothelial+progenitor+cells+in+comparison+to+human+umbilical+vein+endothelial+cells+in+a+spheroid-based+implantation+model%5BTitle%5D)+AND+%22Cell+Prolif%22%5BJournal%5D)">Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model.</a> Cell Prolif. 42 (4), 498-505 (2009).</li>
<li>Morin, K. T., Tranquillo, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((In+vitro+models+of+angiogenesis+and+vasculogenesis+in+fibrin+gel%5BTitle%5D)+AND+%22Exp+Cell+Res%22%5BJournal%5D)">In vitro models of angiogenesis and vasculogenesis in fibrin gel.</a> Exp Cell Res. 319 (16), 2409-2417 (2013).</li>
<li>Blacher, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cell+invasion+in+the+spheroid+sprouting+assay%3A+a+spatial+organisation+analysis+adaptable+to+cell+behaviour%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour.</a> PLoS One. 9 (5), 97019(2014).</li>
<li>Straume, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Suppression+of+heat+shock+protein+27+induces+long-term+dormancy+in+human+breast+cancer%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer.</a> Proc Natl Acad Sci U S A. 109 (22), 8699-8704 (2012).</li>
<li>Naumov, G. N., Akslen, L. A., Folkman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Role+of+angiogenesis+in+human+tumor+dormancy%3A+animal+models+of+the+angiogenic+switch%5BTitle%5D)+AND+%22Cell+Cycle%22%5BJournal%5D)">Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch.</a> Cell Cycle. 5 (16), 1779-1787 (2006).</li>
<li>Naumov, G. N., Folkman, J., Straume, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Tumor+dormancy+due+to+failure+of+angiogenesis%3A+role+of+the+microenvironment%5BTitle%5D)+AND+%22Clin+Exp+Metastasis%22%5BJournal%5D)">Tumor dormancy due to failure of angiogenesis: role of the microenvironment.</a> Clin Exp Metastasis. 26 (1), 51-60 (2009).</li>
<li>Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Neuroprotective+effects+respond+to+cerebral+ischemia+without+susceptibility+to+HB-tumorigenesis+in+VHL+heterozygous+knockout+mice%5BTitle%5D)+AND+%22Mol+Carcinog%22%5BJournal%5D)">Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice.</a> Mol Carcinog. 56 (10), 2342-2351 (2017).</li>
<li>Stratmann, R., Krieg, M., Haas, R., Plate, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Putative+control+of+angiogenesis+in+hemangioblastomas+by+the+von+Hippel-Lindau+tumor+suppressor+gene%5BTitle%5D)+AND+%22J+Neuropathol+Exp+Neurol%22%5BJournal%5D)">Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene.</a> J Neuropathol Exp Neurol. 56 (11), 1242-1252 (1997).</li>
<li>Correa de Sampaio, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+heterogeneous+in+vitro+three+dimensional+model+of+tumour-stroma+interactions+regulating+sprouting+angiogenesis%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis.</a> PLoS One. 7 (2), 30753(2012).</li>
</ol>

Yazarlar ifşa gerek yok.

Son zamanlarda, birden çok alanı vasküler Biyoloji Araştırma anjiogenik endotel15çalışma tarafından teşvik. Bu makalede, geliştirdiğimiz bir endotel küresel roman aday molekülleri tanımlamak için işlenmiş endotel hücrelerindeki fonksiyon kaybı VHL Gene'in kaynaklandığı damar oluşumu çalışmaya deneysel bir model olarak teknik çimlenme anjiogenik cascade. Bizim bilgi en iyi şekilde endogenic değiştirilmiş endotel hücreleri anjiogenik etkilerini incelemek için ilk rapor bu.
(Tümör doku dahil) doku neovaskülarizasyon anjiogenik ve vasculogenic mekanizmaları yoluyla geliştirme sırasında hem de her iki fizyolojik ve patolojik koşulları12,15 dakika sonra oluşan karmaşık bir süreçtir , 16. tahlil çimlenme küresel olaylar17,18çimlenme içinde sonuçları bir matris 3D hücre kültür sistemi içinde gömülü endotel hücre kendini toplama dahil, karmaşık bir çağlayan ile karakterizedir ve kılcal193D ağ çoğaltılması. Bu jel gömülü 3D küresel model damar oluşumu ve onun mekanizmaları uygun bir matris daha iyi taklit eden bir ortamda sağlamak yeteneği nedeniyle çalışmak için doku mühendisliğinde yaygın olarak kullanılan bir sistem haline gelmiştir. Bu biyolojik sürecin en önemli adım deneniyor endotel hücreleri17,20,21,22aktivasyonu be. Bu yordam, endotel hücreleri VHL gen bir düzenleyici büyüme gen neovessels23,24endogenic susturmak tarafından etkinleştirildi. Farklı klasik endotel inisiyasyon yoluyla eksojen indüksiyon matrix ve ilgili ekstraselüler çevre (dahil eksojen vasküler büyüme faktörü), değiştirilen bu yöntem için çok sayıda uzatılabilir endogenic genetik mekanizmaları çözülmeye uygulamaları. Daha sonra eksojen matris etkilerini azaltmak için protokol deneyinde basit bir adımdı jel sulandrarak optimize edildi. Buna ek olarak, yalnızca platforma resim yüklemek için ve analiz sonuçları elde etmek için dakika sürdü. Platform bir amaç, tahlil görüntüleri online çimlenme karşılaştırılabilir ve otomatik görüntü analizi yapmak deneyci bir görüntü analiz hizmeti sağlar. Bu nedenle, protokol insan yapımı faktörlerden kaynaklanan ölçüm ve hesaplama hataları üstesinden gelir.
Neovaskülarizasyon cascade bireysel adımlardan mekanik anlayışı Onkoloji klinik uygulamada için şu anda onaylandıktan Anti-damar tedavisi geliştirilmesi için rasyonel bir temel oluşturdu. Bu kağıt roman aday molekülleri neovaskülarizasyon için tanımlamak için VHL gen fonksiyon kaybı ile işlenmiş endotel hücreleri kaynaklandığı damar oluşumu çalışmaya basit ve sağlam küresel tabanlı tahlil manken kurulan cascade, hangi-ebilmek var kullanmak için çeşitli anjiogenez ve vasculogenesis ile ilgili uygulamalar. Yazarlar bu vitro modeli rolü angiogenez bazı solid tümör (örneğin, tümör vasculogenic taklit) içinde değerlendirmek ve diğer olası progenitör hücre potansiyel rolleri araştırmak yardımcı olacak ek bilgiler sağlayabilir spekülasyon Özellikle, bir grup olarak yalnızca anti-anjiogenik aracıları ile tedaviye yanıt vermeyen tümörler olan hastalarda tümör neovessels vivo içindeoluşturmak için.
Küresel çimlenme tahlil anjiogenez ve ilgili mekanizmaları incelemek için yaygın olarak kullanılan bir yöntem haline gelmiştir. Tahlil Klasik 2D kültürleri daha daha iyi bir taklit ortam sağlayarak önemli bir avantaja sahiptir. Son zamanlarda, 3D ortak kültür modelleri karmaşıklığını anjiogenez tümör microenvironment25içinde ve heterojenlik taklit eden tümör angiogenez incelemek için geliştirilmiştir. Bu modelde, endotel hücreleri kanser hücrelerinin yanı sıra 3D ortamda stromal bir bileşeni ile doğrudan kültürlü. Buna ek olarak, 3D vitro kültür sistemleri vivo içinde yanıt-e doğru geleneksel hücre kültür sistemleri daha terapötik ajanlar daha doğru yansıtacak biçimde gösterilmiştir. Buna ek olarak, bu yöntem embriyonik kök hücre, doku büyüme, yara iyileşmesi, iskemi ve inflamasyon farklılaşma için kullanılır. Klasik yöntem ile karşılaştırıldığında, bizim etkili ve uygulanması kolay bir yaklaşımdır. İnanıyoruz angiogenez vitroçalışma için yararlı bir araçtır ve bu süreci daha iyi anlamak için yeni bir yol açar.

Hemangioblastomas (HBs) sadece insan sinir sistemi içinde (CNS) bulunan iyi huylu damar tümör vardır. Onlar von Hippel-Lindau (VHL) hastalığı veya sporadik lezyonlar olan hastalarda geliştirmek. VHL-HBs sık nüks nedeniyle cerrahi tedavi ile tedavi etmek zordur ve bu genetik neden çoklu lezyonlar1bozukluk. Ne kadar VHL Tümör baskılayıcı gen inactivation VHL-HBs tumorigenesis kök neden olarak, saytolojik kökeni (neovaskülarizasyon dahil olmak üzere) ve HBs evrimsel süreci büyük ölçüde tartışmalı2kalır. Bu nedenle, HB-neovasküler biyolojik mekanizmaları daha iyi anlaşılmasını VHL-HBs için en umut verici Anti-vasküler stratejileri içine yararlı anlayışlar sağlayabilir.
Son araştırmalar HB-neovaskülarizasyon embryologic vasculogenesis3,4,5' e benzer olduğunu ileri sürdü. Klasik vasküler endotelyal büyüme faktörü (VEGF)-vasküler endotel kökenli ve fonksiyon kaybı VHL tarafından tahrik aracılı angiogenez sonuçlandı içinde yayılması ve olmuştur neovasküler oluşumu meydan6. 1965 yılında, Cancilla ve bulundu, Zimmerman elektron mikroskobu, HBs7endotel kökenli kullanarak. Daha sonra stromal hücreler vasoformative öğesi8' den türetilen bulundu. 1982 yılında, Jurco ve ark. stromal hücreler endotel kökenli9olduğunu buldum. Bu nedenle, biz insan vasküler endotel hücreleri HB-neovaskülarizasyon10orijinal hücrelerdir onaylanmadığına karar. VHL hasta ameliyat elde edilen HB hücrelerden birincil kültürler kullanmak daha iyi olsa da, önceki araştırma birincil kültürler HB kararlı değil ve hücre hatları kurulan3olamazdı göstermiştir. Ayrıca, HB-vasküler malzemeler10,11ataları içerdiğinden 3D çevre birincil kültürlerde HB-neovaskülarizasyon saytolojik kökeni teşhis değil. Bu nedenle, endotel hücrelerinin ilkel ve klasik model olarak insan vasküler endotel hücreleri (HUVEC) HBs için alternatif bir hücresel model hizmet verebilir.
Küresel çimlenme tahlil doku Mühendisliği12,13' te yeni bir modeldir. Bu yazıda, tahlil çimlenme küresel kullanarak 3D coculture kollajen tabanlı sistem vitro ile klasik tümör angiogenez HBs yanı sıra HBs rolü var olup olmadığını değerlendirmek için genel bir amacı da geliştirilmiştir.

<table><tbody><tr><td>human umbilical vein endothelial cell</td><td>Fudan IBS Cell Center</td><td>FDCC-HXN180</td><td></td></tr><tr><td>dulbecco&amp;rsquo;s modified eagle&amp;rsquo;s medium&amp;nbsp;</td><td>Gibco</td><td>11995040</td><td></td></tr><tr><td>fetal bovine serum</td><td>Gibco</td><td>&amp;nbsp;26400044</td><td></td></tr><tr><td>PLKO.1-puro vector</td><td>Addgene</td><td>#8453</td><td></td></tr><tr><td>packing plasmid psPAX2&amp;nbsp;</td><td>Addgene</td><td>#12260</td><td></td></tr><tr><td>envelope plasmid pMD2.G</td><td>Addgene</td><td>#12259</td><td></td></tr><tr><td>3D round-bottom 96-well plates</td><td>S-Bio</td><td>MS-9096M</td><td></td></tr><tr><td>matrigel</td><td>BD Biosciences</td><td>354234</td><td></td></tr><tr><td>Opti-MEM medium</td><td>Gibco</td><td>31985-070</td><td>reduced serum medium&amp;nbsp;</td></tr><tr><td>15-well plate</td><td>Ibidi</td><td>81501</td><td>Air bubbles in the gel can be reduced by equilibrating the &amp;mu;&amp;ndash;Slide angiogenesis before usage inside the incubator overnight</td></tr><tr><td>endothelial cell growth supplements</td><td>Sciencell</td><td>#1052</td><td></td></tr><tr><td>10-cm culture dish</td><td>Corning</td><td>Scipu000813</td><td></td></tr><tr><td>Puromycin</td><td>Gibco</td><td>A1113802</td><td></td></tr><tr><td>typsin-EDTA</td><td>Gibco</td><td>25200056</td><td></td></tr><tr><td>Automated Cell Counter System &amp;nbsp;</td><td>BioTech</td><td></td><td></td></tr><tr><td>Image Analysis software&amp;nbsp;</td><td>Winmasis</td><td></td><td>http://mywim.wimasis.com&amp;nbsp;</td></tr></tbody></table>

a comprehensive procedure to evaluate the in vitro performance of the putative hemangioblastoma neovascularization using the spheroid sprouting assay

Von Hippel-Lindau (VHL) Tümör baskılayıcı gen inactivation insan merkezi sinir sistemi (MSS) içinde hemangioblastomas (HBs) gelişiminde önemli bir rol oynar. Ancak, saytolojik kökeni ve (neovaskülarizasyon dahil) HBs evrimsel süreci tartışmalı kalır ve anti-angiogenez VHL-HBs, klasik HB angiogenez üzerinde dayalı için klinik çalışmalarda hayal kırıklığı yaratan sonuçlar doğurmuştur. Anti-damar tedavi başarılı klinik çevrilmesi için bir diğer önemli engel vasküler Bu tümör neovaskülarizasyon kapsamlı bir anlayış eksikliğidir. Bu makalede, biz vitro HBs yanı sıra HBs rolü klasik tümör angiogenez bulunmaktadır olup olmadığını değerlendirmek için kapsamlı bir yordam mevcut. Bu yordamla, araştırmacılar doğru HB neovaskülarizasyon karmaşıklığı anlamak ve bu sık görülen HBs angiogenez işlevini tanımlamak. Bu protokoller tümörleri tedavi anti-anjiogenik tedavi HBs için optimizasyon gelecekte çevirileri yardım için veya yüksek çevirim potansiyele sahip en umut verici Anti-damar tedavi tümör, değerlendirmek için kullanılabilir. Sonuçlar HB neovaskülarizasyon karmaşıklığı vurgulamak ve bu ortak form angiogenez HB neovaskülarizasyon sadece tamamlayıcı bir mekanizma olduğunu göstermektedir.

Orijinal görüntüleri ters ışık mikroskobu tarafından alınır. Kontrol grubu ve VHL grup tipik görüntüleri Şekil 2' deki-A1 ve Şekil 2-A2. Kontrol grubu çimlenme uzunluğu VHL grup kısadır.
Görüntüleri yükledikten sonra online platformu doğrudan çözümleme sonuçlarını sağlar. Çıktı iki bölümden oluşur: işlenmiş görüntü ve karşılık gelen analiz sonuçları. Kontrol grubu ve VHL gene sessizlik grup işlenmiş görüntüleri farklı renklerle işaretlenir (Şekil 2-A3 ve Şekil 2-A4). Ortalama Filiz uzunluğu 65 µm ve kontrol grubu ve VHL sessizlik grup 125 µm sırasıyla ise ortalama toplu Filiz uzunluğu 680 µm ve 1250 µm kontrol grubu ve VHL sessizlik grubunda, sırasıyla, uzunluğu artar Filiz gösteren VHL sessizlik grubunda (Şekil 2B) kontrol grubu ile karşılaştırıldığında yaklaşık iki pas geçiyor. Bu sonuçları, VHL eksikliği insan endotel hücrelerinin damar şekillendirme yeteneği teşvik gösterir.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57183/57183fig1.jpg"> Resim 1 . Tahlil çimlenme küresel şemasını. Adımları 1 gösterir bir tabak HUVEC hücreler kültürlü. Adım 2'de, HUVEC hücreleri 3D tur-alt 96-şey plakalar için 72 h. ile 3 arasındaki adımları HUVEC hücreleri form endotel hücre pulcuklarının gösterir otomatik olarak 3D tabak içinde taşınır. Adım 4'te, hücre küresel seyreltilmiş jöleye ekleyin. Adım 5'te yukarıda 15-şey plaka için hazırlanan karışımı ekleyin. Adımları 6 15-şey plaka küresel çimlenme gösterir. Adımlar 7 ters bir ışık mikroskobunda alınan çimlenme görüntü gösterir. Adımları 8 gösterir karşıya yüklenen görüntü ve adım 9 çıkış görüntü platformu (çubuk = 100 µm). <a href="https://cloudflare.jove.com/files/ftp_upload/57183/57183fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57183/57183fig2.jpg"> Resim 2 . Tahlil çimlenme küresel HUVEC hücrelerinin anjiogenik yeteneği üzerinde gen VHL damping etkisi. (A) kontrolü (A1) ve VHL susturdu HUVEC pulcuklarının (A2) 12 h sonra emzik akıbet temsilcisi görüntüleri (çubuk = 100 µm). Rakamlar A3 ve A4 platformu tarafından rakamlar A1 ve A2, sırasıyla analiz resimleri göster. Kırmızı temsil lahanası iskelet, lahanası sayısı sarı, Filiz yapısı, beyaz Filiz end ve turuncu küresel mavi. (B) lahanası uzunluğu. İstatistiksel analiz unpaired bir öğrenci t-testi kullanılarak gerçekleştirildi. * temsil P < 0,05. CON, Denetim; HUVEC, insan göbek damar endotel hücre. <a href="https://cloudflare.jove.com/files/ftp_upload/57183/57183fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>

Watch this Scientific Journal Video about A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay at JoVE.

A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

Sözde Hemangioblastoma tahlil çimlenme küresel kullanarak neovaskülarizasyon Vitro performansını değerlendirmek için kapsamlı bir yordam

Bu kağıt vitro hemangioblastomas (HBs) ve HBs rolü klasik tümör angiogenez bulunmaktadır olup olmadığını değerlendirmek için kapsamlı bir yordam sunar. Sonuçları HB-neovaskülarizasyon karmaşıklığı vurgulamak ve bu sık görülen angiogenez HB neovaskülarizasyon sadece tamamlayıcı bir mekanizma olduğunu göstermektedir.

The inactivation of the von Hippel-Lindau (VHL) tumor suppressor gene plays a crucial role in the development of hemangioblastomas (HBs) within the human ...

a-comprehensive-procedure-to-evaluate-vitro-performance-putative

Nanyang Technological University

Research

JoVE Journal

Cancer Research

A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

8.0K Görüntüleme.  Fudan University. Bu kağıt vitro hemangioblastomas (HBs) ve HBs rolü klasik tümör angiogenez bulunmaktadır olup olmadığını değerlendirmek için kapsamlı bir yordam sunar. Sonuçları HB-neovaskülarizasyon karmaşıklığı vurgulamak ve bu sık görülen angiogenez HB neovaskülarizasyon sadece tamamlayıcı bir mekanizma olduğunu göstermektedir.

Video: A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

A 3D Spheroid Model for Glioblastoma

Two-dimensional (2D) cell cultures do not mimic in vivo tumor growth satisfactorily. Therefore, three-dimensional (3D) culture spheroid models were developed. These models may be particularly important in the field of neuro-oncology. Indeed, brain tumors have the tendency to invade the healthy brain environment. We describe herein an ideal 3D glioblastoma spheroid-based assay that we developed to study tumor invasion. We provide all technical details and analytical tools to successfully perform this assay.

Here, we describe an easy-to-use invasion assay for glioblastoma. This assay is suitable for glioblastoma stem-like cells. A Fiji macro for easy quantification of invasion, migration, and proliferation is also described.

Glioblastoma için 3D Spheroid Model

Two-dimensional (2D) cell cultures do not mimic in vivo tumor growth satisfactorily. Therefore, three-dimensional (3D) culture spheroid models were ...

Kanser Araştırmaları

Incorporating Pericytes into an Endothelial Cell Bead Sprouting Assay

Angiogenesis is the growth of new vessels from pre-existing vasculature and is an important component of many biological processes, including embryogenesis and development, wound healing, tumor growth and metastasis, and ocular and cardiovascular diseases. Effective in vitro models that recapitulate the biology of angiogenesis are needed to appropriately study this process and identify mechanisms of regulation that can be ultimately targeted for novel therapeutic strategies. The bead angiogenesis assay has been previously demonstrated to recapitulate the multiple stages of endothelial sprouting in vitro. However, a limitation of this assay is a lack of endothelial &#8211; mural cell interactions, which are key to the molecular and phenotypic regulation of endothelial cell function in vivo. The protocol given here presents a methodology for the incorporation of mural cells into the bead angiogenesis assay and demonstrates a tight association of endothelial cells and pericytes during sprouting in vitro. The protocol also details a methodology for effective silencing of target genes using siRNA in endothelial cells for mechanistic studies. Altogether, this protocol provides an in vitro assay that more appropriately models the diverse cell types involved in sprouting angiogenesis, and provides a more physiologically-relevant platform for therapeutic assessment and novel discovery of mechanisms of angiogenesis regulation.

This protocol presents a novel in vitro bead assay that more appropriately models the process of in vivo sprouting angiogenesis by incorporating pericytes. This modification enables the bead assay to more faithfully recapitulate the heterotypic cellular interactions between endothelial cells and mural cells that are critical for angiogenesis.

Perisitlerden tahlil filizlenen bir endotel hücre boncuk birleşmeyle

Angiogenesis is the growth of new vessels from pre-existing vasculature and is an important component of many biological processes, including ...

Gelişim Biyolojisi

Three-dimensional Angiogenesis Assay System using Co-culture Spheroids Formed by Endothelial Colony Forming Cells and Mesenchymal Stem Cells

Studies in the field of angiogenesis have been aggressively growing in the last few decades with the recognition that angiogenesis is a hallmark of more than 50 different pathological conditions, such as rheumatoid arthritis, oculopathy, cardiovascular diseases, and tumor metastasis. During angiogenesis drug development, it is crucial to use in vitro assay systems with appropriate cell types and proper conditions to reflect the physiologic angiogenesis process. To overcome limitations of current in vitro angiogenesis assay systems using mainly endothelial cells, we developed a 3-dimensional (3D) co-culture spheroid sprouting assay system. Co-culture spheroids were produced by two human vascular cell precursors, endothelial colony forming cells (ECFCs) and mesenchymal stem cells (MSCs) with a ratio of 5 to 1. ECFCs+MSCs spheroids were embedded into type I collagen matrix to mimic the in vivo extracellular environment. A real-time cell recorder was utilized to continuously observe the progression of angiogenic sprouting from spheroids for 24 h. Live cell fluorescent labeling technique was also applied to tract the localization of each cell type during sprout formation. Angiogenic potential was quantified by counting the number of sprouts and measuring the cumulative length of sprouts generated from the individual spheroids. Five randomly-selected spheroids were analyzed per experimental group. Comparison experiments demonstrated that ECFCs+MSCs spheroids showed greater sprout number and cumulative sprout length compared with ECFCs-only spheroids. Bevacizumab, an FDA-approved angiogenesis inhibitor, was tested with the newly-developed co-culture spheroid assay system to verify its potential to screen anti-angiogenic drugs. The IC50 value for ECFCs+MSCs spheroids compared to the ECFCs-only spheroids was closer to the effective plasma concentration of bevacizumab obtained from the xenograft tumor mouse model. The present study suggests that the 3D ECFCs+MSCs spheroid angiogenesis assay system is relevant to physiologic angiogenesis, and can predict an effective plasma concentration in advance of animal experiments.

Three-dimensional co-culture spheroid angiogenesis assay system is designed to mimic the physiologic angiogenesis. Co-culture spheroids are formed by two human vascular cell precursors, ECFCs and MSCs, and embedded in collagen gel. The new system is effective for evaluating angiogenic modulators, and provides more relevant information to the in vivo study.

Endotel Kolonisi Oluşturan Hücreler ve Mezenkimal Kök Hücreler tarafından Oluşturulan Eş Kültür Sfaoidler Kullanılarak Üç Boyutlu Anjiyogenez Tsay Sistemi

Studies in the field of angiogenesis have been aggressively growing in the last few decades with the recognition that angiogenesis is a hallmark of more ...

Spheroid Drug Sensitivity Screening in Glioma Stem Cell Lines

In vitro drug sensitivity screens are important tools in the discovery of anti-cancer drug combination therapies. Typically, these in vitro drug screens are performed on cells grown in a monolayer. However, these two-dimensional (2D) models are considered less accurate compared to three-dimensional (3D) spheroid cell models; this is especially true for glioma stem cell lines. Cells grown in spheres activate different signaling pathways and are considered more representative of in vivo models than monolayer cell lines. This protocol describes a method for in vitro drug screening of spheroid lines; mouse and human glioma stem cell lines are used as an example. This protocol describes a 3D spheroid drug sensitivity and synergy assay that can be used to determine if a drug or drug combination induces cell death and if two drugs synergize. Glioma stem cell lines are&#160;modified to express RFP. Cells are plated in low attachment round well bottom 96 plates, and spheres are allowed to form overnight. Drugs are added, and the growth is monitored by measuring the RFP signal over time using the Incucyte live imaging system,&#160;a fluorescence microscope embedded in the tissue culture incubator. Half maximal inhibitory concentration (IC50), median lethal dose (LD50), and synergy score are subsequently calculated to evaluate sensitivities to drugs alone or in combination. The three-dimensional nature of this assay&#160;provides a more accurate reflection of tumor growth, behavior, and drug sensitivities in vivo, thus forming the basis for further preclinical investigation.

<meta charset="utf8"></head><body>Glioma Kök Hücre Hatlarında Sferoid İlaç Duyarlılık Taraması

In vitro drug sensitivity screens are important tools for discovering anti-cancer drug combinations. Cells grown in spheres activate different signaling pathways and are considered more representative of in vivo models than monolayer cell lines. This protocol describes a method for in vitro drug screening for spheroid lines.

Glioma Kök Hücre Hatlarında Sferoid İlaç Duyarlılık Taraması

In vitro drug sensitivity screens are important tools in the discovery of anti-cancer drug combination therapies. Typically, these in vitro drug screens ...

Three-Dimensional (3D) Tumor Spheroid Invasion Assay

Invasion of surrounding normal tissues is generally considered to be a key hallmark of malignant (as opposed to benign) tumors. For some cancers in particular (e.g., brain tumors such as glioblastoma multiforme and squamous cell carcinoma of the head and neck &#8211; SCCHN) it is a cause of severe morbidity and can be life-threatening even in the absence of distant metastases. In addition, cancers which have relapsed following treatment unfortunately often present with a more aggressive phenotype. Therefore, there is an opportunity to target the process of invasion to provide novel therapies that could be complementary to standard anti-proliferative agents. Until now, this strategy has been hampered by the lack of robust, reproducible assays suitable for a detailed analysis of invasion and for drug screening. Here we provide a simple micro-plate method (based on uniform, self-assembling 3D tumor spheroids) which has great potential for such studies. We exemplify the assay platform using a human glioblastoma cell line and also an SCCHN model where the development of resistance against targeted epidermal growth factor receptor (EGFR) inhibitors is associated with enhanced matrix-invasive potential. We also provide two alternative methods of semi-automated quantification: one using an imaging cytometer and a second which simply requires standard microscopy and image capture with digital image analysis.

Three-Dimensional 3D Tumor Spheroid Invasion Assay

Invasion of surrounding normal tissues is a defining characteristic of malignant tumors. We provide here a simple, semi-automated micro-plate assay of invasion into a natural 3D biomatrix that has been exemplified with a number of models of advanced human cancers.

Üç boyutlu (3D) Tümör Sfero Yayılması deneyindeki

Invasion of surrounding normal tissues is generally considered to be a key hallmark of malignant (as opposed to benign) tumors. For some cancers in ...

Tıp

Perfusable Vascular Network with a Tissue Model in a Microfluidic Device

A spheroid (a multicellular aggregate) is regarded as a good model of living tissues in the human body. Despite the significant advancement in the spheroid cultures, a perfusable vascular network in the spheroids remains a critical challenge for long-term culture required to maintain and develop their functions, such as protein expressions and morphogenesis. The protocol presents a novel method to integrate a perfusable vascular network within the spheroid in a microfluidic device. To induce a perfusable vascular network in the spheroid, angiogenic sprouts connected to microchannels were guided to the spheroid by utilizing angiogenic factors from human lung fibroblasts cultured in the spheroid. The angiogenic sprouts reached the spheroid, merged with the endothelial cells co-cultured in the spheroid, and formed a continuous vascular network. The vascular network could perfuse the interior of the spheroid without any leakage. The constructed vascular network may be further used as a route for supply of nutrients and removal of waste products, mimicking blood circulation in vivo. The method provides a new platform in spheroid culture toward better recapitulation of living tissues.

The protocol describes how to engineer a perfusable vascular network in a spheroid. The spheroid's surrounding microenvironment is devised to induce angiogenesis and connect the spheroid to the microchannels in a microfluidic device. The method allows the perfusion of the spheroid, which is a long-awaited technique in three-dimensional cultures.

Perfusable vasküler ağ özellikli bir doku içinde bir mikrosıvısal aygıt

A spheroid (a multicellular aggregate) is regarded as a good model of living tissues in the human body. Despite the significant advancement in the ...

Biyomühendislik

Standardized and Scalable Assay to Study Perfused 3D Angiogenic Sprouting of iPSC-derived Endothelial Cells In Vitro

Pre-clinical drug research of vascular diseases requires in vitro models of vasculature that are amendable to high-throughput screening. However, current in vitro screening models that have sufficient throughput only have limited physiological relevance, which hinders the translation of findings from in vitro to in vivo. On the other hand, microfluidic cell culture platforms have shown unparalleled physiological relevancy in vitro, but often lack the required throughput, scalability and standardization. We demonstrate a robust platform to study angiogenesis of endothelial cells derived from human induced pluripotent stem cells (iPSC-ECs) in a physiological relevant cellular microenvironment, including perfusion and gradients. The iPSC-ECs are cultured as 40 perfused 3D microvessels against a patterned collagen-1 scaffold. Upon the application of a gradient of angiogenic factors, important hallmarks of angiogenesis can be studied, including the differentiation into tip- and stalk cell and the formation of perfusable lumen. Perfusion with fluorescent tracer dyes enables the study of permeability during and after anastomosis of the angiogenic sprouts. In conclusion, this method shows the feasibility of iPSC-derived ECs in a standardized and scalable 3D angiogenic assay that combines physiological relevant culture conditions in a platform that has the required robustness and scalability to be integrated within the drug screening infrastructure.

This method describes the culture of iPSC-derived endothelial cells as 40 perfused 3D microvessels in a standardized microfluidic platform. This platform enables the study of gradient-driven angiogenic sprouting in 3D, including anastomosis and stabilization of the angiogenic sprouts in a scalable and high-throughput manner.

IPSC türetilmiş Endotel Hücrelerinin Perfüzyonlu 3D Anjiyojenik Filizlenmesini İn Vitro Olarak İncelemek Için Standart ve Ölçeklenebilir Tsay

Pre-clinical drug research of vascular diseases requires in vitro models of vasculature that are amendable to high-throughput screening. However, current ...

An Ex Vivo Choroid Sprouting Assay of Ocular Microvascular Angiogenesis

Pathological choroidal angiogenesis, a salient feature of age-related macular degeneration, leads to vision impairment and blindness. Endothelial cell (EC) proliferation assays using human retinal microvascular endothelial cells (HRMECs) or isolated primary retinal ECs are widely used in vitro models to study retinal angiogenesis. However, isolating pure murine retinal endothelial cells is technically challenging and retinal ECs may have different proliferation responses than choroidal endothelial cells and different cell/cell interactions. A highly reproducible ex vivo choroidal sprouting assay as a model of choroidal microvascular proliferation was developed. This model includes the interaction between choroid vasculature (EC, macrophages, pericytes) and retinal pigment epithelium (RPE). Mouse RPE/choroid/scleral explants are isolated and incubated in growth-factor-reduced basal membrane extract (BME) (day 0). Medium is changed every other day and choroid sprouting is quantified at day 6. The images of individual choroid explant are taken with an inverted phase microscope and the sprouting area is quantified using a semi-automated macro plug-in to the ImageJ software developed in this lab. This reproducible ex vivo choroidal sprouting assay can be used to assess compounds for potential treatment and for microvascular disease research to assess pathways involved in choroidal micro vessel proliferation using wild type and genetically modified mouse tissue.

This protocol presents choroid sprouting assay, an ex vivo model of microvascular proliferation. This assay can be used to assess pathways involved in proliferating choroidal micro vessels and assess drug treatments using wild type and genetically modified mouse tissue.

Oküler Mikrovasküler Anjiyogenezin Ex Vivo Koroid Filizlenme Satomu

Pathological choroidal angiogenesis, a salient feature of age-related macular degeneration, leads to vision impairment and blindness. Endothelial cell ...

Biyoloji

Çizik Yara Migrasyonu ve Sferoid Filizlenme Deneyleri Kullanılarak Anjiyogenez Çalışması

Investigating Angiogenesis on a Functional and Molecular Level by Leveraging the Scratch Wound Migration Assay and the Spheroid Sprouting Assay

Angiogenesis plays a crucial role in both physiological and pathological processes within the body including tumor growth or neovascular eye disease. A detailed understanding of the underlying molecular mechanisms and reliable screening models are essential for targeting diseases effectively and developing new therapeutic options. Several in vitro assays have been developed to model angiogenesis, capitalizing on the opportunities a controlled environment provides to elucidate angiogenic drivers at a molecular level and screen for therapeutic targets.
This study presents workflows for investigating angiogenesis in vitro using human umbilical vein endothelial cells (HUVECs). We detail a scratch wound migration assay utilizing a live cell imaging system measuring endothelial cell migration in a 2D setting and the spheroid sprouting assay assessing endothelial cell sprouting in a 3D setting provided by a collagen matrix. Additionally, we outline strategies for sample preparation to enable further molecular analyses such as transcriptomics, particularly in the 3D setting, including RNA extraction as well as immunocytochemistry. Altogether, this framework offers scientists a reliable and versatile toolset to pursue their scientific inquiries in in vitro angiogenesis assays.

Yazar Spotlight: Test Geliştirmedeki Zorluklar ve Yenilikler Yoluyla Anjiyogenezin İncelenmesi

This study presents the two-dimensional (2D) scratch wound migration assay and the three-dimensional (3D) spheroid sprouting assay, along with their respective downstream analysis methods, including RNA extraction and immunocytochemistry, as suitable assays to study angiogenesis in vitro.

Çizik Yara Migrasyon Testi ve Sferoid Filizlenme Testinden Yararlanarak Anjiyogenezin Fonksiyonel ve Moleküler Düzeyde İncelenmesi

Angiogenesis plays a crucial role in both physiological and pathological processes within the body including tumor growth or neovascular eye disease. A ...

Sözde Hemangioblastoma tahlil çimlenme küresel kullanarak neovaskülarizasyon Vitro performansını değerlendirmek için kapsamlı bir yordam

Özet

Daha Fazla Video Keşfet

Glioblastoma için 3D Spheroid Model

Perisitlerden tahlil filizlenen bir endotel hücre boncuk birleşmeyle

Endotel Kolonisi Oluşturan Hücreler ve Mezenkimal Kök Hücreler tarafından Oluşturulan Eş Kültür Sfaoidler Kullanılarak Üç Boyutlu Anjiyogenez Tsay Sistemi

Glioma Kök Hücre Hatlarında Sferoid İlaç Duyarlılık Taraması

Glioma Kök Hücre Hatlarında Sferoid İlaç Duyarlılık Taraması

Üç boyutlu (3D) Tümör Sfero Yayılması deneyindeki

Perfusable vasküler ağ özellikli bir doku içinde bir mikrosıvısal aygıt

IPSC türetilmiş Endotel Hücrelerinin Perfüzyonlu 3D Anjiyojenik Filizlenmesini İn Vitro Olarak İncelemek Için Standart ve Ölçeklenebilir Tsay

Oküler Mikrovasküler Anjiyogenezin Ex Vivo Koroid Filizlenme Satomu

Çizik Yara Migrasyon Testi ve Sferoid Filizlenme Testinden Yararlanarak Anjiyogenezin Fonksiyonel ve Moleküler Düzeyde İncelenmesi