Bu eser hibe Shanghai komite bilim ve Teknoloji (15411951800, 15410723200) tarafından desteklenmiştir. Yazarlar Prof. YuMei Wen ve Prof. Chao Zhao patojen mikroorganizma bölümü Bund'a Üniversitesi Teknik yardım için teşekkür etmek istiyorum.

Bu yöntem onaylı yönergeleri ve araştırma Etik Komitesi, Huashan Hastanesi, Bund'a Üniversitesi düzenlemelere uygun şekilde gerçekleştirildi. Karşılık gelen standart güvenlik önlemleri her adımda takip edildi. Şematik bir sunu için şekil 1' e bakınız.
1. hücre kültür ve plazmid yapı
<ol><li>Rutin olarak Dulbecco içinde insan göbek damar endotel hücre (HUVEC) kartal orta (DMEM) ile % 10 fetal sığır serum (FBS), 100 birim/mL penisilin ve streptomisin oksijen %5 100 µg/mL takıma değiştiren'ın korumak CO2 kuluçka 37 ° C'de</li>
	<li>ShRNA parçası sentezi için Özet PLKO.1 plazmid ile APAI ve EcoRI. Oligonükleotid serisini VHL shRNA vektör CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14olduğundan emin olun.</li>
	<li>Sonra 20 µΜ sistem oligo, ters oligo 5 µL, 10 NF'leri arabellek x 5 µL ve (Toplam 50 µL birimdir) GKD2O birlikte 35 µL ileri 5 µL ile karıştırın. 4 dk ve yavaş yavaş aşağı oda sıcaklığına serin için 98 ° C'de karışımı bir kaç saat içinde ısı.</li>
	<li>Tavlanmış oligos ve PLKO.1 plazmid T4 ligaz 4 ° C'de birlikte gece için ligate. 16 h sonra 5 µL 25 µL yetkili DH5α hücrelere ligasyonu karışımı ekleyin. Sonra başarıyla ve birleştirilmiş plazmid ekran ve sıralama tarafından eklenen parça doğrulayın.</li>
</ol>2. lentivirus paket ve enfeksiyon
<ol><li>Toplamda, PLKO.1-shVHL veya PLKO.1-shScramble vektör 10 µg, plazmid psPAX2 ambalaj 7.5 µg ve zarf plazmid pMD2.G 500 µL fetal sığır serum (FBS) 25 min için olmadan DMEM medyanın içinde 2,5 µg karıştırın.</li>
	<li>7 mLDMEM FBS olmadan yukarıda hazırlanan çözüm ekleyin.</li>
	<li>Kültür 293FT 10 cm çapında doku kültürü yemekleri FBS olmadan DMEM hücrelerde. 293 FT hücreleri hücre sayaç 1 x 107 olduğundan emin olun.</li>
	<li>Yukarıda transfection için 293 FT hücreleri Orta olarak hazırlanan çözeltinin 1 mL ekleyin. Not: 293FT hücre kültürünü 293F hücre satırından türetilir ve stabil SV40 büyük T antijen ifade eder. Bu nedenle, lentiviral üretim için uygun bir ev sahipliği yapmaktadır.</li>
	<li>% 10 içeren DMEM ile Kültür orta yerine FBS 6 h sonra.</li>
	<li>Bir pipet 48 h transfection sonra medya toplamak. Not: % 10 içeren DMEM virüs var FBS. Ortamdaki ölü hücreleri float. Steril 0,45 µm membran ölü hücreleri ve kirleri filtre uygulamak için kullanın. Genel olarak, enfeksiyon (MOI) çokluğu denetlemek için gerek yoktur. Bu bir istikrarlı hücreleri çizgi oluşturmaktır. Son adımda, başarılı enfeksiyonu olmadan tüm canlı hücreler tarafından puromisindir ölecek. ShScramble grup ve HUVEC hücreleri kontrol grubu vardır. Tüm HUVEC hücreleri 72 h tarafından kullanılan puromisindir konsantrasyon ile ölmek emin olun. Her şey aynı sayıda hücre vardır.</li>
	<li>Lentiviral medya için 72 h HUVEC hücrelerde kültür. Daha sonra puromisindir HUVEC hücre 2 µg/mL 24 h kullanım HUVEC hücreleri kontrol grubu olarak herhangi bir tedavi için bir konsantrasyon, medya ekleyin. Tüm bu zamana kadar hücreleri die kontrol emin olun. Not: Canlı hücreler VHL devirme hücreleri ve shSramble hücreleri istikrarlı hücre kültürünü temsil eder. Kaplama 5.000/96-şey levha iyi yoğunluğudur.</li>
</ol>3. nesil endotel hücre pulcuklarının
<ol><li>HUVECs hücre trypsinize ve % 10 DMEM orta resuspend FBS. Hücre 10 cm kültür tabak içinde ılımlı sayısı ile 1 mL typsin-EDTA ekleyin.</li>
	<li>1 × 103 hücreleri/iyi bir hücre yoğunluğuna, 3D bir yuvarlak alt 96-şey plaka hücrelerde tohum. Küresel askıya almak için 0.50 µL küresel ağırlayacak iyi kullanın. Üreticinin yönergelerini izleyerek bir hücre sayaç sistemi kullanarak hücreleri saymak.</li>
	<li>37 ° C ve 72 h için sürekli olarak % 5 CO2 hücreleri kuluçkaya. Bu koşullar altında askıya alınan hücrelerin hücre pulcuklarının otomatik olarak oluşturmak emin olun. Kültür orta yarısı 36 h sonra değiştirin.</li>
</ol>4. vitro angiogenez tahlil
<ol><li>Jel çözüm 4 ° C'de erimek ve ile indirimli serum orta seyreltme oranı 1:5 oranında seyreltin.</li>
	<li>Bir micropipette ile DMEM kültür ortamdan pulcuklarının emmek. Yıkandıktan sonra düşük serum orta 5 mL ile pulcuklarının askıya pulcuklarının yavaşça ve dikkatli seyreltilmiş jel. Hava hava kabarcığı yok olduğundan emin olun.</li>
	<li>Karışık sıvı 300 µL bir 15-şey tabak içinde embed. 37 ° C ve 1 h için % 5 CO2 kuluçka sonra 400 µL düşük serum orta her şey için ekleyin. Buharlaşma engellemek için oksijen bir ortam oluşturmak için kuyu etrafında steril su doldurun.</li>
	<li>Bundan sonra kültür plaka 37 ° c için 1 h %100 nem oranı, % 5 CO2 .</li>
	<li>Dikkatle eski orta Aspire edin ve düşük serum orta % 1 endotel hücre büyüme takviyeleri her iyi ile 600 µL tarafından değiştirin.</li>
	<li>12 saat veya 24 saat sonra bir ters ışık mikroskobu altında görüntü almak (40 *).</li>
</ol>5. veri analizi
<ol><li>Filiz uzunluğu veri (Tablo reçetesi) elde etmek için çevrimiçi görüntü analiz platformu için resim yüklemek.</li>
	<li>Web sayfasında, e-posta ile bir hesap oluşturun.</li>
	<li>O zaman Resim Yükle düğmesini tıklatarak yüklemek.</li>
	<li>Sonuç karşıdan yükle düğmesini tıklatarak karşıdan yükleyin. Not: Yazılım işlenmiş görüntü ve veri oluşturur. Beş bölümden verileri içeren: toplu Filiz uzunluğu, ortalama Filiz uzunluğu, Filiz uzunluğu, Filiz alanı ve küresel alan standart sapması. İşlenmiş görüntüde her parametre tanımlama işlenen görüntünün içinde kolaylaştırmak için farklı bir renkte ana hatlarıyla: kırmızı temsil lahanası iskelet, lahanası sayısı sarı, Filiz yapısı, beyaz Filiz end ve turuncu küresel mavi.</li>
</ol>

<ol>
	<li>Lonser, R. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=von+Hippel-Lindau+disease.">von Hippel-Lindau disease.</a> Lancet. 361 (9374), 2059-2067 (2003).</li><li>Hussein, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+nervous+system+capillary+haemangioblastoma:+the+pathologist's+viewpoint.">Central nervous system capillary haemangioblastoma: the pathologist's viewpoint.</a> Int J Exp Pathol. 88 (5), 311-324 (2007).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemangioblastomas+might+derive+from+neoplastic+transformation+of+neural+stem+cells/progenitors+in+the+specific+niche.">Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche.</a> Carcinogenesis. 32 (1), 102-109 (2011).</li><li>Zhuang, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+derived+vasculogenesis+in+von+Hippel-Lindau+disease-associated+tumors.">Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors.</a> Sci Rep. 4, 4102 (2014).</li><li>Glasker, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VHL-deficient+vasculogenesis+in+hemangioblastoma.">VHL-deficient vasculogenesis in hemangioblastoma.</a> Exp Mol Pathol. 96 (2), 162-167 (2014).</li><li>Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Up-regulation+of+vascular+endothelial+growth+factor+and+its+receptors+in+von+Hippel-Lindau+disease-associated+and+sporadic+hemangioblastomas.">Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas.</a> Cancer Res. 55 (6), 1358-1364 (1995).</li><li>Cancilla, P. A., Zimmerman, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+fine+structure+of+a+cerebellar+hemangioblastoma.">The fine structure of a cerebellar hemangioblastoma.</a> J Neuropathol Exp Neurol. 24 (4), 621-628 (1965).</li><li>Kawamura, J., Garcia, J. H., Kamijyo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cerebellar+hemangioblastoma:+histogenesis+of+stroma+cells.">Cerebellar hemangioblastoma: histogenesis of stroma cells.</a> Cancer. 31 (6), 1528-1540 (1973).</li><li>Jurco, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemangioblastomas:+histogenesis+of+the+stromal+cell+studied+by+immunocytochemistry.">Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry.</a> Hum Pathol. 13 (1), 13-18 (1982).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+tumorigenic+cells+and+implication+of+their+aberrant+differentiation+in+human+hemangioblastomas.">Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas.</a> Cancer Biol Ther. 12 (8), 727-736 (2011).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD41+and+CD45+expression+marks+the+angioformative+initiation+of+neovascularisation+in+human+haemangioblastoma.">CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma.</a> Tumour Biol. 37 (3), 3765-3774 (2016).</li><li>Sharifpanah, F., Sauer, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+Cell+Spheroid-Based+Sprout+Assay+in+Three-Dimensional+Fibrin+Scaffold:+A+Novel+In+Vitro+Model+for+the+Study+of+Angiogenesis.">Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis.</a> Methods Mol Biol. 1430, 179-189 (2016).</li><li>Cai, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+taurine+upregulated+1+enhances+tumor-induced+angiogenesis+through+inhibiting+microRNA-299+in+human+glioblastoma.">Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma.</a> Oncogene. 36 (3), 318-331 (2017).</li><li>Xu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Conveniently+Screening+pLKO.1-TRC+Vector+Tagged+with+TurboGFP.">Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP.</a> Appl Biochem Biotechnol. 181 (2), 699-709 (2017).</li><li>Laib, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spheroid-based+human+endothelial+cell+microvessel+formation+in+vivo.">Spheroid-based human endothelial cell microvessel formation in vivo.</a> Nat Protoc. 4 (8), 1202-1215 (2009).</li><li>D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Angiogenesis+and+Vasculogenesis+in+Health+and+Disease.">Angiogenesis and Vasculogenesis in Health and Disease.</a> Biomed Res Int. 2015, 126582 (2015).</li><li>Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impaired+in+vivo+vasculogenic+potential+of+endothelial+progenitor+cells+in+comparison+to+human+umbilical+vein+endothelial+cells+in+a+spheroid-based+implantation+model.">Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model.</a> Cell Prolif. 42 (4), 498-505 (2009).</li><li>Morin, K. T., Tranquillo, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+models+of+angiogenesis+and+vasculogenesis+in+fibrin+gel.">In vitro models of angiogenesis and vasculogenesis in fibrin gel.</a> Exp Cell Res. 319 (16), 2409-2417 (2013).</li><li>Blacher, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+invasion+in+the+spheroid+sprouting+assay:+a+spatial+organisation+analysis+adaptable+to+cell+behaviour.">Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour.</a> PLoS One. 9 (5), 97019 (2014).</li><li>Straume, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+heat+shock+protein+27+induces+long-term+dormancy+in+human+breast+cancer.">Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer.</a> Proc Natl Acad Sci U S A. 109 (22), 8699-8704 (2012).</li><li>Naumov, G. N., Akslen, L. A., Folkman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+angiogenesis+in+human+tumor+dormancy:+animal+models+of+the+angiogenic+switch.">Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch.</a> Cell Cycle. 5 (16), 1779-1787 (2006).</li><li>Naumov, G. N., Folkman, J., Straume, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+dormancy+due+to+failure+of+angiogenesis:+role+of+the+microenvironment.">Tumor dormancy due to failure of angiogenesis: role of the microenvironment.</a> Clin Exp Metastasis. 26 (1), 51-60 (2009).</li><li>Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroprotective+effects+respond+to+cerebral+ischemia+without+susceptibility+to+HB-tumorigenesis+in+VHL+heterozygous+knockout+mice.">Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice.</a> Mol Carcinog. 56 (10), 2342-2351 (2017).</li><li>Stratmann, R., Krieg, M., Haas, R., Plate, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Putative+control+of+angiogenesis+in+hemangioblastomas+by+the+von+Hippel-Lindau+tumor+suppressor+gene.">Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene.</a> J Neuropathol Exp Neurol. 56 (11), 1242-1252 (1997).</li><li>Correa de Sampaio, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+heterogeneous+in+vitro+three+dimensional+model+of+tumour-stroma+interactions+regulating+sprouting+angiogenesis.">A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis.</a> PLoS One. 7 (2), 30753 (2012).</li></ol>

Yazarlar ifşa gerek yok.

Son zamanlarda, birden çok alanı vasküler Biyoloji Araştırma anjiogenik endotel15çalışma tarafından teşvik. Bu makalede, geliştirdiğimiz bir endotel küresel roman aday molekülleri tanımlamak için işlenmiş endotel hücrelerindeki fonksiyon kaybı VHL Gene'in kaynaklandığı damar oluşumu çalışmaya deneysel bir model olarak teknik çimlenme anjiogenik cascade. Bizim bilgi en iyi şekilde endogenic değiştirilmiş endotel hücreleri anjiogenik etkilerini incelemek için ilk ra...

Hemangioblastomas (HBs) sadece insan sinir sistemi içinde (CNS) bulunan iyi huylu damar tümör vardır. Onlar von Hippel-Lindau (VHL) hastalığı veya sporadik lezyonlar olan hastalarda geliştirmek. VHL-HBs sık nüks nedeniyle cerrahi tedavi ile tedavi etmek zordur ve bu genetik neden çoklu lezyonlar1bozukluk. Ne kadar VHL Tümör baskılayıcı gen inactivation VHL-HBs tumorigenesis kök neden olarak, saytolojik kökeni (neovaskülarizasyon dahil olmak üzere) ve HBs evrimsel süreci büyük ölçüde tartışmalı2kalır. Bu nedenle, HB-neovasküler biyolojik mekanizmaları daha iyi anlaşılmasını VHL-HBs için en umut verici Anti-vasküler stratejileri içine yararlı anlayışlar sağlayabilir.
Son araştırmalar HB-neovaskülarizasyon embryologic vasculogenesis3,4,5' e benzer olduğunu ileri sürdü. Klasik vasküler endotelyal büyüme faktörü (VEGF)-vasküler endotel kökenli ve fonksiyon kaybı VHL tarafından tahrik aracılı angiogenez sonuçlandı içinde yayılması ve olmuştur neovasküler oluşumu meydan6. 1965 yılında, Cancilla ve bulundu, Zimmerman elektron mikroskobu, HBs7endotel kökenli kullanarak. Daha sonra stromal hücreler vasoformative öğesi8' den türetilen bulundu. 1982 yılında, Jurco ve ark. stromal hücreler endotel kökenli9olduğunu buldum. Bu nedenle, biz insan vasküler endotel hücreleri HB-neovaskülarizasyon10orijinal hücrelerdir onaylanmadığına karar. VHL hasta ameliyat elde edilen HB hücrelerden birincil kültürler kullanmak daha iyi olsa da, önceki araştırma birincil kültürler HB kararlı değil ve hücre hatları kurulan3olamazdı göstermiştir. Ayrıca, HB-vasküler malzemeler10,11ataları içerdiğinden 3D çevre birincil kültürlerde HB-neovaskülarizasyon saytolojik kökeni teşhis değil. Bu nedenle, endotel hücrelerinin ilkel ve klasik model olarak insan vasküler endotel hücreleri (HUVEC) HBs için alternatif bir hücresel model hizmet verebilir.
Küresel çimlenme tahlil doku Mühendisliği12,13' te yeni bir modeldir. Bu yazıda, tahlil çimlenme küresel kullanarak 3D coculture kollajen tabanlı sistem vitro ile klasik tümör angiogenez HBs yanı sıra HBs rolü var olup olmadığını değerlendirmek için genel bir amacı da geliştirilmiştir.

<table border="0" cellpadding="0" cellspacing="0" style="width:1516px;" width="1516">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:265px;">human umbilical vein endothelial cell</td>
			<td style="width:147px;">Fudan IBS Cell Center</td>
			<td style="width:343px;">FDCC-HXN180</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">dulbecco&#8217;s modified eagle&#8217;s medium&#160;</td>
			<td>Gibco</td>
			<td>11995040</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">fetal bovine serum</td>
			<td>Gibco</td>
			<td>&#160;26400044</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">PLKO.1-puro vector</td>
			<td>Addgene</td>
			<td>#8453</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">packing plasmid psPAX2&#160;</td>
			<td>Addgene</td>
			<td>#12260</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">envelope plasmid pMD2.G</td>
			<td>Addgene</td>
			<td>#12259</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">3D round-bottom 96-well plates</td>
			<td>S-Bio</td>
			<td>MS-9096M</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">matrigel</td>
			<td>BD Biosciences</td>
			<td>354234</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Opti-MEM medium</td>
			<td>Gibco</td>
			<td>31985-070</td>
			<td style="width:761px;">reduced serum medium&#160;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">15-well plate</td>
			<td>Ibidi</td>
			<td>81501</td>
			<td>Air bubbles in the gel can be reduced by equilibrating the &#956;&#8211;Slide angiogenesis before usage inside the incubator overnight</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">endothelial cell growth supplements</td>
			<td>Sciencell</td>
			<td>#1052</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">10-cm culture dish</td>
			<td>Corning</td>
			<td>Scipu000813</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Puromycin</td>
			<td>Gibco</td>
			<td>A1113802</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">typsin-EDTA</td>
			<td>Gibco</td>
			<td>25200056</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Automated Cell Counter System &#160;</td>
			<td>BioTech</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Image Analysis software&#160;</td>
			<td>Winmasis</td>
			<td style="width:343px;"></td>
			<td>http://mywim.wimasis.com&#160;</td>
		</tr>
	</tbody>
</table>

a comprehensive procedure to evaluate the in vitro performance of the putative hemangioblastoma neovascularization using the spheroid sprouting assay

Von Hippel-Lindau (VHL) Tümör baskılayıcı gen inactivation insan merkezi sinir sistemi (MSS) içinde hemangioblastomas (HBs) gelişiminde önemli bir rol oynar. Ancak, saytolojik kökeni ve (neovaskülarizasyon dahil) HBs evrimsel süreci tartışmalı kalır ve anti-angiogenez VHL-HBs, klasik HB angiogenez üzerinde dayalı için klinik çalışmalarda hayal kırıklığı yaratan sonuçlar doğurmuştur. Anti-damar tedavi başarılı klinik çevrilmesi için bir diğer önemli engel vasküler Bu tümör neovaskülarizasyon kapsamlı bir anlayış eksikliğidir. Bu makalede, biz vitro HBs yanı sıra HBs rolü klasik tümör angiogenez bulunmaktadır olup olmadığını değerlendirmek için kapsamlı bir yordam mevcut. Bu yordamla, araştırmacılar doğru HB neovaskülarizasyon karmaşıklığı anlamak ve bu sık görülen HBs angiogenez işlevini tanımlamak. Bu protokoller tümörleri tedavi anti-anjiogenik tedavi HBs için optimizasyon gelecekte çevirileri yardım için veya yüksek çevirim potansiyele sahip en umut verici Anti-damar tedavi tümör, değerlendirmek için kullanılabilir. Sonuçlar HB neovaskülarizasyon karmaşıklığı vurgulamak ve bu ortak form angiogenez HB neovaskülarizasyon sadece tamamlayıcı bir mekanizma olduğunu göstermektedir.

Orijinal görüntüleri ters ışık mikroskobu tarafından alınır. Kontrol grubu ve VHL grup tipik görüntüleri Şekil 2' deki-A1 ve Şekil 2-A2. Kontrol grubu çimlenme uzunluğu VHL grup kısadır.
Görüntüleri yükledikten sonra online platformu doğrudan çözümleme sonuçlarını sağlar. Çıktı iki bölümden oluşur: i?...

Watch this Scientific Journal Video about A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay at JoVE.

A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

Sözde Hemangioblastoma tahlil çimlenme küresel kullanarak neovaskülarizasyon Vitro performansını değerlendirmek için kapsamlı bir yordam

Bu kağıt vitro hemangioblastomas (HBs) ve HBs rolü klasik tümör angiogenez bulunmaktadır olup olmadığını değerlendirmek için kapsamlı bir yordam sunar. Sonuçları HB-neovaskülarizasyon karmaşıklığı vurgulamak ve bu sık görülen angiogenez HB neovaskülarizasyon sadece tamamlayıcı bir mekanizma olduğunu göstermektedir.

The inactivation of the von Hippel-Lindau (VHL) tumor suppressor gene plays a crucial role in the development of hemangioblastomas (HBs) within the human ...

a-comprehensive-procedure-to-evaluate-vitro-performance-putative

Research

JoVE Journal

Cancer Research

A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

7.9K Görüntüleme.  Fudan University. Bu kağıt vitro hemangioblastomas (HBs) ve HBs rolü klasik tümör angiogenez bulunmaktadır olup olmadığını değerlendirmek için kapsamlı bir yordam sunar. Sonuçları HB-neovaskülarizasyon karmaşıklığı vurgulamak ve bu sık görülen angiogenez HB neovaskülarizasyon sadece tamamlayıcı bir mekanizma olduğunu göstermektedir.

Video: A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

Utilizing Functional Genomics Screening to Identify Potentially Novel Drug Targets in Cancer Cell Spheroid Cultures

The identification of functional driver events in cancer is central to furthering our understanding of cancer biology and indispensable for the discovery of the next generation of novel drug targets. It is becoming apparent that more complex models of cancer are required to fully appreciate the contributing factors that drive tumorigenesis in vivo and increase the efficacy of novel therapies that make the transition from pre-clinical models to clinical trials.
Here we present a methodology for generating uniform and reproducible tumor spheroids that can be subjected to siRNA functional screening. These spheroids display many characteristics that are found in solid tumors that are not present in traditional two-dimension culture. We show that several commonly used breast cancer cell lines are amenable to this protocol. Furthermore, we provide proof-of-principle data utilizing the breast cancer cell line BT474, confirming their dependency on amplification of the epidermal growth factor receptor HER2 and mutation of phosphatidylinositol-4,5-biphosphate 3-kinase (PIK3CA) when grown as tumor spheroids. Finally, we are able to further investigate and confirm the spatial impact of these dependencies using immunohistochemistry.

Identifying novel drug targets that transition from pre-clinical testing to human trials is a scientific priority. To that end, here we describe a functional genomics approach for examining the impact of gene depletion on cancer cell line spheroids, which more appropriately model human cancers in vivo.

İşlevsel Genomik Tarama kullanılması Kanser Hücre Sfero Kültürleri Potansiyel Yeni İlaç Hedefleri Belirlemek İçin

The identification of functional driver events in cancer is central to furthering our understanding of cancer biology and indispensable for the discovery ...

Kanser Araştırmaları

A Comprehensive Procedure to Evaluate the In Vivo Performance of Cancer Nanomedicines

Inspired by the success of previous cancer nanomedicines in the clinic, researchers have generated a large number of novel formulations in the past decade. However, only a small number of nanomedicines have been approved for clinical use, whereas the majority of nanomedicines under clinical development have produced disappointing results. One major obstacle to the successful clinical translation of new cancer nanomedicines is the lack of an accurate understanding of their in vivo performance. This article features a rigorous procedure to characterize the in vivo behavior of nanomedicines in tumor-bearing mice at systemic, tissue, single-cell, and subcellular levels via the integration of positron emission tomography-computed tomography (PET-CT), radioactivity quantification methods, flow cytometry, and fluorescence microscopy. Using this approach, researchers can accurately evaluate novel nanoscale formulations in relevant mouse models of cancer. These protocols may have the ability to identify the most promising cancer nanomedicines with high translational potential or to aid in the optimization of cancer nanomedicines for future translation.

A Comprehensive Procedure to Evaluate the In Vivo Performance of Cancer Nanomedicines

The poor understanding of the in vivo performance of nanomedicines stymies their clinical translation. Procedures to evaluate the in vivo behavior of cancer nanomedicines at systemic, tissue, single-cell, and subcellular levels in tumor-bearing immunocompetent mice are described here. This approach may help researchers to identify promising cancer nanomedicines for clinical translation.

Kapsamlı Usulü değerlendirin<em&gt; İn Vivo</em&gt; Kanser Nanomedicines performans

Inspired by the success of previous cancer nanomedicines in the clinic, researchers have generated a large number of novel formulations in the past ...

Evaporation-reducing Culture Condition Increases the Reproducibility of Multicellular Spheroid Formation in Microtiter Plates

Tumor models that closely imitate in vivo conditions are becoming increasingly popular in drug discovery and development for the screening of potential anti-cancer drugs. Multicellular tumor spheroids (MCTSes) effectively mimic the physiological conditions of solid tumors, making them excellent in vitro models for lead optimization and target validation. Out of the various techniques available for MCTS culture, the liquid-overlay method on agarose is one of the most inexpensive methods for MCTS generation. However, the reliable transfer of MCTS cultures using liquid-overlay for high-throughput screening may be compromised by a number of limitations, including the coating of microtiter plates (MPs) with agarose and the irreproducibility of uniform MCTS formation across wells. MPs are significantly prone to edge effects that result from excessive evaporation of medium from the exterior of the plate, preventing the use of the entire plate for drug tests. This manuscript provides detailed technical improvements to the liquid-overlay technique to increase the scalability and reproducibility of uniform MCTS formation. Additionally, details on a simple, semi-automatic, and universally applicable software tool for the evaluation of MCTS features after drug treatment is presented.

The uneven loss of medium from microtiter plates affects the reproducibility of uniform multicellular tumor spheroid formation. Improving culture conditions to reduce significant medium loss will improve the reproducibility of spheroid formation and the results of spheroid-based assays using the liquid-overlay technique.

Buharlaşma azaltıcı Kültür Durumu Mikrotiter Tabaklar Multisellüler Sfero Oluşumunun Tekrarlanabilirlik artırır

Tumor models that closely imitate in vivo conditions are becoming increasingly popular in drug discovery and development for the screening of potential ...

Using the Dot Assay to Analyze Migration of Cell Sheets

Although complex organisms appear static, their tissues are under a continuous turnover. As cells age, die, and are replaced by new cells, cells move within tissues in a tightly orchestrated manner. During tumor development, this equilibrium is disturbed, and tumor cells leave the epithelium of origin to invade the local microenvironment, to travel to distant sites, and to ultimately form metastatic tumors at distant sites. The dot assay is a simple, two-dimensional unconstrained migration assay, to assess the net movement of cell sheets into a cell-free area, and to analyze parameters of cell migration using time-lapse imaging. Here, the dot assay is demonstrated using a human invasive, lung colony forming breast cancer cell line, MCF10CA1a, to analyze the cells' migratory response to epidermal growth factor (EGF), which is known to increase malignant potential of breast cancer cells and to alter the migratory phenotype of cells.

Cell migration is essential for development, tissue maintenance and repair, and tumorigenesis, and is regulated by growth factors, chemokines, and cytokines. This protocol describes the dot assay, a two-dimensional, unconstrained migration assay to assess the migratory phenotype of attached, cohesive cell sheets in response to microenvironmental cues.

Geçiş hücre yaprak analiz etmek için nokta tahlil kullanarak

Although complex organisms appear static, their tissues are under a continuous turnover. As cells age, die, and are replaced by new cells, cells move ...

Modeling Osteosarcoma Using Li-Fraumeni Syndrome Patient-derived Induced Pluripotent Stem Cells

Li-Fraumeni syndrome (LFS) is an autosomal dominant hereditary cancer disorder. Patients with LFS are predisposed to a various type of tumors, including osteosarcoma--one of the most frequent primary non-hematologic malignancies in the childhood and adolescence. Therefore, LFS provides an ideal model to study this malignancy. Taking advantage of iPSC methodologies, LFS-associated osteosarcoma can be successfully modeled by differentiating LFS patient iPSCs to mesenchymal stem cells (MSCs), and then to osteoblasts--the cells of origin for osteosarcomas. These LFS osteoblasts recapitulate oncogenic properties of osteosarcoma, providing an attractive model system for delineating the pathogenesis of osteosarcoma. This manuscript demonstrates a protocol for the generation of iPSCs from LFS patient fibroblasts, differentiation of iPSCs to MSCs, differentiation of MSCs to osteoblasts, and in vivo tumorigenesis using LFS osteoblasts. This iPSC disease model can be extended to identify potential biomarkers or therapeutic targets for LFS-associated osteosarcoma.

Here, we present a protocol for the generation of induced pluripotent Stem Cells (iPSCs) from Li-Fraumeni Syndrome (LFS) patient derived fibroblasts, differentiation of iPSCs via mesenchymal stem cells (MSCs) to osteoblasts, and modeling in vivo tumorigenesis using LFS patient-derived osteoblasts.

Li-Fraumeni sendromu hasta kaynaklı indüklenmiş Pluripotent kök hücreler kullanılarak osteosarkom modelleme

Li-Fraumeni syndrome (LFS) is an autosomal dominant hereditary cancer disorder. Patients with LFS are predisposed to a various type of tumors, including ...

In Vitro Assay to Study Tumor-macrophage Interaction

Tumor associated macrophages (TAMs) account for a large percentage of cells in the tumor mass for different types of cancers. Glioblastoma (GBM), a malignant brain tumor with no cure, has up to a half the tumor mass TAMs. TAMs can be pro-tumoral or anti-tumoral, depending on the activation of specific genes in the cells. Genetic mutations in the tumors, through regulating cytokine expression, can affect recruitment of TAMs to the tumor microenvironment. Here, we describe a quantitative cell-based assay to assess macrophage recruitment by the conditioned medium from the tumor cells. This assay uses the human macrophage cell line MV-4-11 to study macrophage attraction by the conditioned medium from glioblastoma, allowing for high reproducibility and low variability. Data generated with this assay can contribute to a better understanding of the interaction between the tumor and the tumor microenvironment. Similar assay can be used to assess interaction between the tumor cells and other immune cells, including T cells and natural killer (NK) cells.

This article represents a useful in vitro assay to evaluate the capability of conditioned medium from tumor cells to attract macrophages.

In vitro assay tümör çalışma-macrophage etkileşim

Tumor associated macrophages (TAMs) account for a large percentage of cells in the tumor mass for different types of cancers. Glioblastoma (GBM), a ...

In Vitro Establishment of a Genetically Engineered Murine Head and Neck Cancer Cell Line using an Adeno-Associated Virus-Cas9 System

The use of primary normal epithelial cells makes it possible to reproducibly induce genomic alterations required for cellular transformation by introducing specific mutations in oncogenes and tumor suppressor genes, using clustered regulatory interspaced short palindromic repeat (CRISPR)-based genome editing technology in mice. This technology allows us to accurately mimic the genetic changes that occur in human cancers using mice. By genetically transforming murine primary cells, we can better study cancer development, progression, treatment, and diagnosis. In this study, we used Cre-inducible Cas9 mouse tongue epithelial cells to enable genome editing using adeno-associated virus (AAV) in vitro. Specifically, by altering KRAS, p53, and APC in normal tongue epithelial cells, we generated a murine head and neck cancer (HNC) cell line in vitro,which is tumorigenic in syngeneic mice. The method presented here describes in detail how to generate HNC cell lines with specific genomic alterations and explains their suitability for predicting tumor progression in syngeneic mice. We envision that this promising method will be informative and useful to study tumor biology and therapy of HNC.

Development of murine models with specific genes mutated in head and neck cancer patients is required for understanding of neoplasia. Here, we present a protocol for in vitro transformation of primary murine tongue cells using an adeno-associated virus-Cas9 system to generate murine HNC cell lines with specific genomic alterations.

Adeno-Associated Virus-Cas9 Sistemi Kullanılarak Genetiği Değiştirilmiş Bir Murine Baş ve Boyun Kanseri Hücre Hattı In Vitro Kurulması

The use of primary normal epithelial cells makes it possible to reproducibly induce genomic alterations required for cellular transformation by ...

Pathological Analysis of Lung Metastasis Following Lateral Tail-Vein Injection of Tumor Cells

Metastasis, the primary cause of morbidity and mortality for most cancer patients, can be challenging to model preclinically in mice. Few spontaneous metastasis models are available. Thus, the experimental metastasis model involving tail-vein injection of suitable cell lines is a mainstay of metastasis research. When cancer cells are injected into the lateral tail-vein, the lung is their preferred site of colonization. A potential limitation of this technique is the accurate quantification of the metastatic lung tumor burden. While some investigators count macrometastases of a pre-defined size and/or include micrometastases following sectioning of tissue, others determine the area of metastatic lesions relative to normal tissue area. Both of these quantification methods can be exceedingly difficult when the metastatic burden is high. Herein, we demonstrate an intravenous injection model of lung metastasis followed by an advanced method for quantifying metastatic tumor burden using image analysis software. This process allows for investigation of multiple end-point parameters, including average metastasis size, total number of metastases, and total metastasis area, to provide a comprehensive analysis. Furthermore, this method has been reviewed by a veterinary pathologist board-certified by the American College of Veterinary Pathologists (SEK) to ensure accuracy.

Intravenous injection of cancer cells is often used in metastasis research, but the metastatic tumor burden can be difficult to analyze. Herein, we demonstrate a tail-vein injection model of metastasis and include a novel approach to analyze the resulting metastatic lung tumor burden.

Tümör Hücrelerinin Lateral Kuyruk-Damar Enjeksiyonu Sonrasında Akciğer Metastazının Patolojik Analizi

Metastasis, the primary cause of morbidity and mortality for most cancer patients, can be challenging to model preclinically in mice. Few spontaneous ...

Modeling Brain Metastases Through Intracranial Injection and Magnetic Resonance Imaging

Metastatic spread of cancer is an unfortunate consequence of disease progression, aggressive cancer subtypes, and/or late diagnosis. Brain metastases are particularly devastating, difficult to treat, and confer a poor prognosis. While the precise incidence of brain metastases in the United States remains hard to estimate, it is likely to increase as extracranial therapies continue to become more efficacious in treating cancer. Thus, it is necessary to identify and develop novel therapeutic approaches to treat metastasis at this site. To this end, intracranial injection of cancer cells has become a well-established method in which to model brain metastasis. Previously, the inability to directly measure tumor growth has been a technical hindrance to this model; however, increasing availability and quality of small animal imaging modalities, such as magnetic resonance imaging (MRI), are vastly improving the ability to monitor tumor growth over time and infer changes within the brain during the experimental period. Herein, intracranial injection of murine mammary tumor cells into immunocompetent mice followed by MRI is demonstrated. The presented injection approach utilizes isoflurane anesthesia and a stereotactic setup with a digitally controlled, automated drill and needle injection to enhance precision, and reduce technical error. MRI is measured over time using a 9.4 Tesla instrument in The Ohio State University James Comprehensive Cancer Center Small Animal Imaging Shared Resource. Tumor volume measurements are demonstrated at each time point through use of ImageJ. Overall, this intracranial injection approach allows for precise injection, day-to-day monitoring, and accurate tumor volume measurements, which combined greatly enhance the utility of this model system to test novel hypotheses on the drivers of brain metastases.

Intracranial brain metastasis modeling is complicated by an inability to monitor tumor size and response to treatment with precise and timely methods. The presented methodology couples intracranial tumor injection with magnetic resonance imaging analysis, which when combined, cultivates precise and consistent injections, enhanced animal monitoring, and accurate tumor volume measurements.

İntrakraniyal Enjeksiyon ve Manyetik Rezonans Görüntüleme Ile Beyin Metastazlarının Modellenmesi

Metastatic spread of cancer is an unfortunate consequence of disease progression, aggressive cancer subtypes, and/or late diagnosis. Brain metastases are ...

A Three-Dimensional Spheroid Model to Investigate the Tumor-Stromal Interaction in Hepatocellular Carcinoma

The aggressiveness and lack of well-tolerated and widely effective treatments for advanced hepatocellular carcinoma (HCC), the predominant form of liver cancer, rationalize its rank as the second most common cause of cancer-related death. Preclinical models need to be adapted to recapitulate the human conditions to select the best therapeutic candidates for clinical development and aid the delivery of personalized medicine. Three-dimensional (3D) cellular spheroid models show promise as an emerging in vitro alternative to two-dimensional (2D) monolayer cultures. Here, we describe a 3D tumor spheroid&#160;model which exploits the ability of individual cells to aggregate when maintained in hanging droplets, and is more representative of an in vivo environment than standard monolayers. Furthermore, 3D spheroids can be produced by combining homotypic or heterotypic cells, more reflective of the cellular heterogeneity in vivo, potentially enabling the study of environmental interactions that can influence progression and treatment responses. The current research optimized the cell density to form 3D homotypic and heterotypic tumor spheroids by immobilizing cell suspensions on the lids of standard 10 cm3 Petri dishes. Longitudinal analysis was performed to generate growth curves for homotypic versus heterotypic tumor/fibroblasts spheroids. Finally, the proliferative impact of fibroblasts (COS7 cells) and liver myofibroblasts (LX2) on homotypic tumor (Hep3B) spheroids was investigated. A seeding density of 3,000 cells (in 20 &#181;L media) successfully yielded Huh7/COS7 heterotypic spheroids, which displayed a steady increase in size up to culture day 8, followed by growth retardation. This finding was corroborated using Hep3B homotypic spheroids cultured in LX2 (human hepatic stellate cell line) conditioned medium (CM). LX2 CM triggered the proliferation of Hep3B spheroids compared to control tumor spheroids. In conclusion, this protocol has shown that 3D tumor spheroids can be used as a simple, economical, and prescreen in vitro tool to study tumor-stromal interactions more comprehensively.

Comprehensive in vitro models that faithfully recapitulate the relevant human disease are lacking. The current study presents three-dimensional (3D) tumor spheroid creation and culture, a reliable in vitro tool to study the tumor-stromal interaction in human hepatocellular carcinoma.

Hepatosellüler Karsinomdaki Tümör-Stromal Etkileşimi Araştırmak İçin Üç Boyutlu Sferoid Modeli

The aggressiveness and lack of well-tolerated and widely effective treatments for advanced hepatocellular carcinoma (HCC), the predominant form of liver ...