This work was funded by the Guangdong Natural Science Foundation of China (2015A030313500), the Provincial Key International Cooperative Research Platform and the Major Scientific Research Project of Guangdong Higher Education (2015KGJHZ015), the Science and Technology Plan of Guangdong Tobacco Monopoly Administration (201403, 201705), the Science and Technology Plan of Guangdong of China (2016B020201001), the National Innovation Training Project for Undergraduate Students (201711078001). Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the US Department of Agriculture. USDA is an equal opportunity provider and employer.

1. Preparation of PCR Products of SSR Markers
<ol>
	<li>Prepare all chemicals and reagents for PCR reactions including template DNA (30 ng/&#181;L), 2&#215; PCR master mix (containing 2&#215; PCR buffer, 0.4 mM of each dNTP, 3 mM of MgCl2, 0.1 U/&#181;L of Taq DNA polymerase and dyes), 10 &#181;M of each forward and reverse primers, and distilled or deionized water (dH2O). 
	NOTE: The SSR markers used in the present study were PT51333 (forward primer sequence: 5 &#39;-GCACCTTTGGTTATCCGACA-3 &#39; and reverse primer sequence: 5 &#39;-TGCTTTAAGTCATGTACCAAATTGA-3 &#39;) and PT50903 (forward primer sequence: 5 &#39;-AAATTTCTTTCGGTGTGATAACTG-3&#39; and reverse primer sequence: 5&#39;- AGAGACTGCCGTTTGATTTGA -3&#39;) for tobacco, and CX-43 (forward primer sequence: 5&#39;-TGGGGATGTGAGCTTCTTCT-3&#39; and reverse primer sequence:5&#39;- AGGGTTCCTTTGGGGTGATA-3&#39;) and CX-157 (forward primer sequence: 5 &#39;-TCGACGCTGACTTCACTGAC-3 &#39; and reverse primer sequence: 5 &#39;-GGACAGCTTCACACATTTGC-3 &#39;) for flowering Chinese cabbage.</li>
	<li>Prepare 10 &#181;L of PCR mix for amplification by adding 2 &#181;L of template DNA, 5 &#181;L of 2&#215; PCR master mix, 0.2 &#181;L of each forward primer and reverse primer and 2.6 &#181;L of dH2O.</li>
	<li>Perform PCR amplification reaction in a thermocycler with an initial step of 94 &#176;C for 5 min, follow by 38 cycles of 45 s at 94 &#176;C for denaturation, 45 s at 55 &#176;C for primer annealing and 1 min at 72 &#176;C for extension, and a final extension step of 10 min at 72 &#176;C; then store PCR products at 4 &#176;C for later use.</li>
</ol>
2. Preparation of Solutions for Polyacrylamide Gels Casting
<ol>
	<li>Prepare 1 L of 5&#215; TBE buffer by dissolving 54 g of Tris base and 27.5 g boric acid in dH2O, adding 20 mL of 0.5 M EDTA (pH 8.0) and adjusting the solution to a final volume of 1, 000 mL with dH2O. 
	NOTE: TBE buffer can be stored at room temperature for months.</li>
	<li>Prepare 2 L of 0.5&#215; TBE buffer by adding 200 mL of 5&#215; TBE buffer to dH2O to a final volume of 2 L, and store at room temperature.</li>
	<li>Prepare a 6% non-denaturing polyacrylamide gel solution by dissolving 29 g of molecular biology grade acrylamide and 1 g of molecular biology grade N, N&#39;-methylenebisacrylamide in 0.5&#215; TBE buffer to a final volume of 500 mL. Cover the solution bottle with aluminum foil and store at 4 &#176;C for later use. 
	Caution: Acrylamide is considered a potent neurotoxin and should be handled with care. Always wear gloves when weighing powder and handling solutions that contain it.</li>
	<li>Prepare a 20% ammonium persulfate (APS) solution by dissolving 2 g of APS with dH2O to a final volume of 10 mL. It can be stored at -20 &#176;C for months. 
	NOTE: For convenience, 10 mL of 20% APS solution can be aliquoted into 1.5 mL or 2 mL of centrifuge tubes for storage at -20 &#176;C. Thaw and mix well before use.</li>
	<li>Prepare a diluted bind-silane solution by dissolving 3 &#181;L of bind-silane in 0.997 mL of 95% ethanol containing 0.5% of acetic acid. It can be stored at 4 &#176;C for weeks. 
	Caution: Bind-silane is toxic, wear gloves when handling the solution and keep room ventilated.</li>
</ol>
3. Preparation of Polyacrylamide Gels for Electrophoresis
<ol>
	<li>Wash one set of glass plates and spacers with detergent in tap water, followed by a complete rinsing with dH2O. Air dry the plates by setting them in a plate drying rack.</li>
	<li>Disperse 1 mL of bind-silane solution onto the inner surface of a rectangular glass plate, and dry for 5 min. 
	NOTE: If the bind-silane solution is not spread uniformly on the surface of the plate, the gel may be detached during staining and result in an unsatisfactory staining effect.</li>
	<li>Disperse 1 mL of repel-silane onto the inner surface of a notched glass plate with a swab, wipe off excess repel-silane with tissue paper, and air dry for 5 min. 
	NOTE: If the repel-silane does not coat the surface of the glass plate uniformly, it may damage the gel by partially stripping.</li>
	<li>Assemble the glass plates with spacers with the notched plate on top, and clamp both sides of the assembly with casting clamps.</li>
	<li>Pour appropriate amount (40 mL) of 6% non-denaturing polyacrylamide gel solution to a beaker for the plate set of 33 cm width &#215; 10 cm height and spacer thickness of 1.5 mm, add 20 &#181;L of tetramethylethylenediamine (TEMED) and 200 &#181;Lfresh 20% APS and mix gently. 
	NOTE: The appropriate amount (40 mL) of gel solution was calculated from the inner volume of the two plates with a thickness of spacers (30 cm &#215; 8.5 cm &#215; 0.15 cm). As for the amount of TEMED and APS for gel polymerization, there is a standard ratio of gel solution to TEMED and APS based on the reference17. The gel solution described above is stored at 4&#176;C. If gel solution is stored at room temperature, 20 &#181;L of TEMED and 100 &#181;L of 20% APS should be used. Gently stir the mixture of gel solution with a glass stick to avoid air bubbles in the solution.</li>
	<li>Pour the solution immediately and carefully into the assembled glass plates along the edge of the notched plate, fill the space almost to the top, and insert the comb. Add a small volume of gel solution over the comb. 
	NOTE: Keep the glass plates horizontal to prevent the gel from leaking. Remove any bubbles with a bubble hook, if necessary.</li>
	<li>Allow the gel to set for 30 min at room temperature. 
	NOTE: The time for polymerization may change with temperatures of gel solution and environment.</li>
	<li>After the gel is fully polymerization, remove the casting clamps and position the plate set in the electrophoresis tank unit with the notched plate facing toward the upper buffer reservoir, and use large clamps to attach the plate set to the tank unit.</li>
	<li>Pour 1 L of 0.5&#215; TBE buffer into each of the upper and the lower chambers. Remove the comb and flush all the wells thoroughly with buffer using a pipette or syringe. 
	NOTE: Ensure that the gel sandwich at the bottom of the plate is completely soaked in buffer without any bubbles.</li>
</ol>
4. Running Gels
<ol>
	<li>Load about 1 &#181;L of PCR product into each well of the polyacrylamide gel. Load a DNA size ladder to both sides of the gel along with samples of PCR products. Fix the safety cover to the upper buffer chamber.</li>
	<li>Connect the leads to the power supply, matching the color-coded red to red and black to black. Run the gel at a constant voltage of 110 V until the dye reaches a defined position, normally for ~70 min. 
	NOTE: The voltage and running time can be adjusted according to the size of the PCR products.</li>
</ol>
5. Silver Staining for Detecting SSR Markers in a Non-Polyacrylamide Gel
<ol>
	<li>After electrophoresis, drain the buffer from the upper chamber into a large beaker via the valve. Detach the side clamps, remove the plates from the apparatus, carefully separate the notched glass plate along one side with a spatula, and make sure that the gel remains attached to the other glass plate coated with bind silane.</li>
	<li>Make 1 L of fresh impregnation solution by dissolving 1.5 g of AgNO3 in 1 L of dH2O. Prepare 1 L of fresh development solution by dissolving 10 g of NaOH in 900 mL of dH2O, add 1 mL of 37% formaldehyde, and adjust to a final volume of 1 L using dH2O. 
	NOTE: Wear gloves and handle the above chemicals and solutions with care. It is not necessary to keep the solutions and corresponding steps with the solutions in the dark.</li>
	<li>Carefully rinse the gel and glass plate with ample dH2O to remove the electrophoresis buffer, then place the plate with the gel facing up onto a plastic tray and submerge the gel in 1 L of impregnation solution. Put the tray on a shaker.</li>
	<li>Shake the tray gently at 60 r/min for 3-4 min. 
	NOTE: Shaking time can be adjusted according to the gel thickness and concentration of silver nitrate in the impregnation solution.</li>
	<li>Move the plate out of impregnation solution and put it onto another tray. Rinse the residual impregnation solution off from the surface of the plate and the gel using ample dH2O twice for 3-5 s each.</li>
	<li>Place the plate with the gel facing up onto another tray, submerge the plate in 1 L of development solution, then shake the tray gently at 50 r/min for ~3 min. Monitor the appearance of DNA fragments and stop development when the highest ratio of the signal of DNA fragments to the noise of background is observed (this step takes ~3 min).</li>
	<li>Rinse the plate and the gel with ample dH2O twice, and dry the gel plate with a tissue paper.</li>
	<li>Scan the gel using an appropriate scanner. A resolution of 300 dpi gives a clear visualization of DNA fragments. The gel can also be photographed using a camera.</li>
	<li>The banding pattern of SSR markers can be scored based on the DNA fragments in the image.</li>
</ol>

<ol><li>Jiang, G. L. Molecular markers and marker-assisted breeding in plants. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aJiang%2C+GL+%22Plant+breeding+from+laboratories+to+fields%22">Plant breeding from laboratories to fields</a>. Anderson, S. B. , InTech Press. Croatia. 45-83 (2013).</li>
<li>Powell, W., Machray, G. C., Provan, J. <a target="_blank" href="http://www.sciencedirect.com/science/article/pii/1360138596868981">Polymorphism revealed by simple sequence repeats.</a> Trend Plant Sci. 1, 215-222 (1996).</li>
<li>Varshney, R. K., Graner, A., Sorrells, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genic+microsatellite+markers+in+plants%3A+features+and+applications%5BTitle%5D)+AND+%22Trend+Biotechnol%22%5BJournal%5D)">Genic microsatellite markers in plants: features and applications.</a> Trend Biotechnol. 23, 48-55 (2005).</li>
<li>Tuler, A. C., Carrijo, T. T., Nóia, L. R., Ferreira, A., Peixoto, A. L., da Silva Ferreira, M. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SSR+markers%3A+a+tool+for+species+identification+in+Psidium+%28Myrtaceae%29%5BTitle%5D)+AND+%22Mol.+Biol.+Rep%22%5BJournal%5D)">SSR markers: a tool for species identification in Psidium (Myrtaceae).</a> Mol. Biol. Rep. 42, 1501-1513 (2015).</li>
<li>Rabilloud, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mechanisms+of+protein+silver+staining+in+polyacrylamide+gels%3A+a+10-year+synthesis%5BTitle%5D)+AND+%22Electrophoresis%22%5BJournal%5D)">Mechanisms of protein silver staining in polyacrylamide gels: a 10-year synthesis.</a> Electrophoresis. 11, 785-794 (1990).</li>
<li>Bassam, B. J., Caetano-Anollés, G., Gresshoff, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fast+and+sensitive+silver+staining+of+DNA+in+polyacrylamide+gels%5BTitle%5D)+AND+%22Anal.+Biochem%22%5BJournal%5D)">Fast and sensitive silver staining of DNA in polyacrylamide gels.</a> Anal. Biochem. 196, 80-83 (1991).</li>
<li>Liang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+rapid+and+effective+method+for+silver+staining+of+PCR+products+separated+in+polyacrylamide+gels%5BTitle%5D)+AND+%22Electrophoresis%22%5BJournal%5D)">A rapid and effective method for silver staining of PCR products separated in polyacrylamide gels.</a> Electrophoresis. 35, 2520-2523 (2014).</li>
<li>Switzer, R. C., Merril, C. R., Shifrin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+highly+sensitive+silver+stain+for+detecting+proteins+and+peptides+in+polyacrylamide+gels%5BTitle%5D)+AND+%22Anal.+Biochem%22%5BJournal%5D)">A highly sensitive silver stain for detecting proteins and peptides in polyacrylamide gels.</a> Anal. Biochem. 98, 231-237 (1979).</li>
<li>Sanguinetti, C., Dias, N., Simpson, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rapid+silver+staining+and+recovery+of+PCR+products+separated+on+polyacrylamide+gels%5BTitle%5D)+AND+%22Biotechniques%22%5BJournal%5D)">Rapid silver staining and recovery of PCR products separated on polyacrylamide gels.</a> Biotechniques. 17, PMID:7840973 915-919 (1994).</li>
<li>Ji, Y., Qu, C., Cao, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+optimal+method+of+DNA+silver+staining+in+polyacrylamide+gels%5BTitle%5D)+AND+%22Electrophoresis%22%5BJournal%5D)">An optimal method of DNA silver staining in polyacrylamide gels.</a> Electrophoresis. 28, 1173-1175 (2007).</li>
<li>Qu, L., Li, X., Wu, G., Yang, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Efficient+and+sensitive+method+of+DNA+silver+staining+in+polyacrylamide+gels%5BTitle%5D)+AND+%22Electrophoresis%22%5BJournal%5D)">Efficient and sensitive method of DNA silver staining in polyacrylamide gels.</a> Electrophoresis. 26, 99-101 (2005).</li>
<li>An, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+silver+staining+procedure+for+nucleic+acids+in+polyacrylamide+gels+without+fixation+and+pretreatment%5BTitle%5D)+AND+%22Anal.+Biochem%22%5BJournal%5D)">A silver staining procedure for nucleic acids in polyacrylamide gels without fixation and pretreatment.</a> Anal. Biochem. 391, 77-79 (2009).</li>
<li>Byun, S. O., Fang, Q., Zhou, H., Hickford, J. G. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+effective+method+for+silver-staining+DNA+in+large+numbers+of+polyacrylamide+gels%5BTitle%5D)+AND+%22Anal.+Biochem%22%5BJournal%5D)">An effective method for silver-staining DNA in large numbers of polyacrylamide gels.</a> Anal. Biochem. 385, 174-175 (2009).</li>
<li>Kumar, M., Kim, S. R., Sharma, P. C., Pareek, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Simple+and+efficient+way+to+detect+small+polymorphic+bands+in+plants%5BTitle%5D)+AND+%22Genome+Data%22%5BJournal%5D)">Simple and efficient way to detect small polymorphic bands in plants.</a> Genome Data. 5, 218-222 (2015).</li>
<li>Liu, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Development+of+a+simple+and+effective+silver+staining+protocol+for+detection+of+DNA+fragments%5BTitle%5D)+AND+%22Electrophoresis%22%5BJournal%5D)">Development of a simple and effective silver staining protocol for detection of DNA fragments.</a> Electrophoresis. 38, 1175-1178 (2017).</li>
<li>Wang, D., Shi, J., Carlson, S. R., Cregan, P. B., Ward, R. W., Diers, B. W. <a target="_blank" href="https://scholars.opb.msu.edu/en/publications/a-low-cost-high-throughput-polyacrylamide-gel-electrophoresis-sys-3">A low-cost, high-throughput polyacrylamide gel electrophoresis system for genotyping with microsatellite DNA markers.</a> Crop Sci. 43, 1828-1832 (2003).</li>
<li>Echt, C. S., May-Marquardt, P., Hseih, M., Zahorchak, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Characterization+of+microsatellite+markers+in+eastern+white+pine%5BTitle%5D)+AND+%22Genome%22%5BJournal%5D)">Characterization of microsatellite markers in eastern white pine.</a> Genome. 39, PMID: 8983182 1102-1108 (1996).</li>
</ol>

The authors declare that they have no competing financial interests.

The washing of gel after impregnation is a critical step. Insufficient washing time and water volume may cause the incomplete removal of impregnation solution on the surface of the plate and the gel, and result in a dark background. The appropriate developing time is another key step, over-development can result in a dark-brown background with low contrast image of DNA fragments. In addition, the impregnation step significantly affects staining efficiency of DNA fragments. Although extending the impregnation time over 5 ...

The development of PCR-based markers has revolutionized the science of plant genetics and breeding1. Simple sequence repeat (SSR) markers are among the most commonly used and most versatile DNA markers. Their broad genome coverage, abundance, genome specificity, and repeatability are some of the merits of SSR markers in addition to their codominant inheritance for the detection of heterozygous genotypes2. Several studies have used SSR markers to investigate genetic diversity, track ancestry, construct genetic linkage maps, and map genes for economically important traits3,4.
PCR products of SSR markers are commonly separated using agarose or polyacrylamide gel electrophoresis and then visualized with silver staining or under UV light after staining with ethidium bromide. Silver staining of DNA fragments in polyacrylamide gels is more sensitive than the other staining methods5,6 and has been widely used to detect DNA fragments such as SSR markers7.
Like many biological laboratory techniques, silver staining of polyacrylamide gels has steadily improved since its first being reported as a fragment visualization technique in 19798. The technique was initially modified for detection of DNA fragments by Bassam et al.6 in 1991 and then improved by Sanguinetti and coworkers9 in 1994. The method has been further optimized in the last few decades6,7,9,10,11,12,13,14,15. However, most of these updated versions of the protocols still have some drawbacks such as high technical demand and long processing time for fixation and mounting6, that limit the application of these protocols7,11. An optimal protocol that combines low-cost with high efficiency of DNA fragment detection is urgently needed for routine application of silver staining in biological research.
In addition, polyacrylamide gel can be divided into denaturing and non-denaturing polyacrylamide gels, and both can be used for the detection of SSR markers using the silver staining method. The effect and resolution of which do not significantly differ, but non-denaturing polyacrylamide gels are easier to process and take less time16.
On the basis of the previous research15, the aim of the current study is to describe an optimized silver staining protocol in detail for quick, easy and low-cost detection of SSR markers in a non-denaturing polyacrylamide gel.

<table><tbody><tr><td>PCR master mix (Green Taq Mix)</td><td>Vazyme Biotech Co. Ltd, China</td><td>#P131-03</td><td></td></tr><tr><td>50-2000 bp DNA Ladder</td><td>Bio-Rad, USA</td><td>#170-8200</td><td></td></tr><tr><td>DL500 DNA marker</td><td>Takara Bio Inc., Japan</td><td>#3590A</td><td></td></tr><tr><td>Tris base</td><td>Sangon Biotech Shanghai, China</td><td>#77-86-1</td><td></td></tr><tr><td>Boric acid</td><td>Sangon Biotech Shanghai, China</td><td>#10043-35-3</td><td></td></tr><tr><td>EDTA-Na&lt;sub&gt;2&lt;/sub&gt;</td><td>Guangzhou Chemical Reagent Factory, China</td><td>#6381-92-6</td><td></td></tr><tr><td>Acrylamide</td><td>Sangon Biotech Shanghai, China</td><td>#79-06-1</td><td></td></tr><tr><td>N,N&#039;-methylene-bis-acrylamide</td><td>Sangon Biotech Shanghai, China</td><td>#110-26-9</td><td></td></tr><tr><td>N,N,N&#039;,N&#039;-Tetramethylethylenediamine</td><td>Sangon Biotech Shanghai, China</td><td>#110-18-9</td><td></td></tr><tr><td>Ammonium persulfate</td><td>Guangzhou Chemical Reagent Factory, China</td><td>#7727-54-0</td><td></td></tr><tr><td>Bind-silane</td><td>Solarbio Beijing, China</td><td>#B8150</td><td></td></tr><tr><td>AgNO&lt;sub&gt;3&lt;/sub&gt;</td><td>Sinopharm Chemical Reagent Beijing Co.,Ltd, China</td><td>#7761-88-8</td><td></td></tr><tr><td>Formaldehyde</td><td>Tianjin DaMao Chemical Reagent Factory, China</td><td>#50-00-0</td><td></td></tr><tr><td>NaOH</td><td>Guangzhou Chemical Reagent Factory, China</td><td>#1310-73-2</td><td></td></tr><tr><td>Acetic acid</td><td>Guangzhou Chemical Reagent Factory, China</td><td>#64-19-7</td><td></td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;CO&lt;sub&gt;3&lt;/sub&gt;</td><td>Tianjin DaMao Chemical Reagent Factory, China</td><td>#497-19-8</td><td></td></tr><tr><td>Ethanol</td><td>Guangzhou Chemical Reagent Factory, China</td><td>#64-17-5</td><td></td></tr><tr><td>HNO&lt;sub&gt;3&lt;/sub&gt;</td><td>Guangzhou Chemical Reagent Factory, China</td><td>#7697-37-2</td><td></td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;S&lt;sub&gt;2&lt;/sub&gt;O&lt;sub&gt;3&lt;/sub&gt;.5H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sinopharm Chemical Reagent Beijing Co.,Ltd, China</td><td>#10102-17-7</td><td></td></tr><tr><td>Eriochrome black T(EBT)</td><td>Tianjin DaMao Chemical Reagent Factory, China</td><td>#1787-61-7</td><td></td></tr><tr><td>Plastic tray</td><td>Shanghai Yi Chen Plastic Co., Ltd, China</td><td>-</td><td></td></tr><tr><td>TS-1 Shaker</td><td>Qilinbeter JiangSu, China</td><td>-</td><td></td></tr><tr><td>BenQ M800 Scanner</td><td>BenQ, China</td><td>-</td><td></td></tr><tr><td>DYY-6C Power supply</td><td>Beijing Liuyi Instrument Factory, China</td><td>-</td><td></td></tr><tr><td>High throughout vertical gel systems, JY-SCZF</td><td>Beijing Tunyi Electrophoresis Co., Ltd, China</td><td>-</td><td></td></tr></tbody></table>

a fast silver staining protocol enabling simple and efficient detection of ssr markers using a non-denaturing polyacrylamide gel

Simple Sequence Repeat (SSR) is one of the most effective markers used in plant and animal genetic research and molecular breeding programs. Silver staining is a widely used method for the detection of SSR markers in a polyacrylamide gel. However, conventional protocols for silver staining are technically demanding and time-consuming. Like many other biological laboratory techniques, silver staining protocols have been steadily optimized to improve detection efficiency. Here, we report a simplified silver staining method that significantly reduces reagent costs and enhances the detection resolution and picture clarity. The new method requires two major steps (impregnation and development) and three reagents (silver nitrate, sodium hydroxide, and formaldehyde), and only 7 min of processing for a non-denaturing polyacrylamide gel. Compared to previously reported protocols, this new method is easier, quicker and uses fewer chemical reagents for SSR detection. Therefore, this simple, low-cost, and effective silver staining protocol will benefit genetic mapping and marker-assisted breeding by a quick generation of SSR marker data.

The PCR amplicons were produced using the corresponding SSR primer pairs in flowering Chinese cabbage and tobacco. After electrophoresis, the polyacrylamide gels were stained using the above silver staining protocol, which unambiguously detected the banding patterns of SSR markers (Figure 1).
To compare the detection efficiency of different silver staining protocols, PCR products of SSR markers in t...

Watch this Scientific Journal Video about A Fast Silver Staining Protocol Enabling Simple and Efficient Detection of SSR Markers using a Non-denaturing Polyacrylamide Gel at JoVE.com

A Fast Silver Staining Protocol Enabling Simple and Efficient Detection of SSR Markers using a Non-denaturing Polyacrylamide Gel

Here, we report a simple and low-cost silver staining protocol which requires only three reagents and 7 min of processing, and is suitable for fast generation of high-quality SSR data in the genetic analysis.

Simple Sequence Repeat (SSR) is one of the most effective markers used in plant and animal genetic research and molecular breeding programs. Silver ...

a-fast-silver-staining-protocol-enabling-simple-efficient-detection

Research

JoVE Journal

Genetics

10.7K Views.  Guangzhou University. Wij rapporteren hier een eenvoudige en goedkope silver kleuring protocol dat vereist slechts drie reagentia en 7 min van verwerking, en is geschikt voor snelle generatie voor kwalitatief hoogwaardige SSR data in de genetische analyse.

Video: A Fast Silver Staining Protocol Enabling Simple and Efficient Detection of SSR Markers using a Non-denaturing Polyacrylamide Gel

An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides

Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. Radioactivity has been the predominant method of DNA labeling in EMSAs. However, recent advances in fluorescent dyes and scanning methods have prompted the use of fluorescent tagging of DNA as an alternative to radioactivity for the advantages of easy handling, saving time, reducing cost, and improving safety. We have recently used fluorescent EMSA (fEMSA) to successfully address an important biological question. Our fEMSA analysis provides mechanistic insight into the effect of a missense mutation, G73E, in the highly conserved HMG transcription factor SOX-2 on olfactory neuron type diversification. We found that mutant SOX-2G73E protein alters specific DNA binding activity, thereby causing olfactory neuron identity transformation. Here, we present an optimized and cost-effective step-by-step protocol for fEMSA using infrared fluorescent dye-labeled oligonucleotides containing the LIM-4/SOX-2 adjacent target sites and purified SOX-2 proteins (WT and mutant SOX-2G73E proteins) as a biological example.

We describe here an optimized protocol of fluorescent Electrophoretic Mobility Shift Assays (fEMSA) using purified SOX-2 proteins together with infrared fluorescent dye-labeled DNA probes as a case study to tackle an important biological question.

Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. ...

Biochemistry

DNA Staining Method Based on Formazan Precipitation Induced by Blue Light Exposure

DNA staining methods are very important for biomedical research. We designed a simple method that allows DNA visualization to the naked eye by the formation of a colored precipitate. It works by soaking the acrylamide or agarose DNA gel in a solution of 1x (equivalent to 2.0 &#181;M) SYBR Green I (SG I) and 0.20 mM nitro blue tetrazolium that produces a purple precipitate of formazan when exposed to sunlight or specifically blue light. Also, DNA recovery tests were performed using an ampicillin resistant plasmid in an agarose gel stained with our method. A larger number of colonies was obtained with our method than with traditional staining using SG I with ultraviolet illumination. The described method is fast, specific, and non-toxic for DNA detection, allowing visualization of biomolecules to the "naked eye" without a transilluminator, and is inexpensive and appropriate for field use. For these reasons, our new DNA staining method has potential benefits to both research and industry.

This method allows selective staining and quantification of DNA in gels by soaking the gel in a SYBR Green I/Nitro Blue Tetrazolium solution and then exposing it to sunlight or a blue light source. This produces a visible precipitate and requires almost no equipment, making it ideal for field use.

DNA staining methods are very important for biomedical research. We designed a simple method that allows DNA visualization to the naked eye by the ...

Staining Proteins in Gels

Following separation by electrophoretic methods, proteins in a gel can be detected by several staining methods. This unit describes protocols for detecting proteins by four popular methods. Coomassie blue staining is an easy and rapid method. Silver staining, while more time consuming, is considerably more sensitive and can thus be used to detect smaller amounts of protein. Fluorescent staining is a popular alternative to traditional staining procedures, mainly because it is more sensitive than Coomassie staining, and is often as sensitive as silver staining. Staining of proteins with SYPRO Orange and SYPRO Ruby are also demonstrated here.

Following separation by electrophoretic methods, proteins in a gel can be detected by several staining methods. Staining of proteins with Coomassie Blue, Silver Staining, SYPRO Orange, SYPRO Ruby are demonstrated in this video.

Following separation by electrophoretic methods, proteins in a gel can be detected by several staining methods. This unit describes protocols for ...

Biology

Fluorescent Silver Staining of Proteins in Polyacrylamide Gels

Silver staining is a colorimetric technique widely used to visualize protein bands in polyacrylamide gels following sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The classic silver stains have certain drawbacks, such as high background staining, poor protein recovery, low reproducibility, a narrow linear dynamic range for quantification, and limited compatibility with mass spectrometry (MS). Now, with the use of a fluorogenic Ag+ probe, TPE-4TA, we developed a fluorescent silver staining method for the total protein visualization in polyacrylamide gels. This new stain avoids the troublesome silver reduction step in traditional silver stains. Moreover, the fluorescent silver stain demonstrates good reproducibility, sensitivity, and linear quantification in protein detection, making it a useful and practical protein gel stain.

Here, we describe a detailed protocol outlining a new fluorescent staining technique for total protein detection in polyacrylamide gels. The protocol utilizes a silver ion-specific fluorescence turn-on probe, which detects Ag+-protein complexes, and eliminates certain limitations of traditional chromogenic silver stains.

Silver staining is a colorimetric technique widely used to visualize protein bands in polyacrylamide gels following sodium dodecyl sulfate-polyacrylamide ...

Fluorescent Visualization of Mango-tagged RNA in Polyacrylamide Gels via a Poststaining Method

Native and denaturing polyacrylamide gels are routinely used to characterize ribonucleoprotein (RNP) complex mobility and to measure RNA size, respectively. As many gel-imaging techniques use nonspecific stains or expensive fluorophore probes, sensitive, discriminating, and economical gel-imaging methodologies are highly desirable. RNA Mango core sequences are small (19&#8211;22 nt) sequence motifs that, when closed by an arbitrary RNA stem, can be simply and inexpensively appended to an RNA of interest. These Mango tags bind with high affinity and specificity to a thiazole-orange fluorophore ligand called TO1-Biotin, which becomes thousands of times more fluorescent upon binding. Here we show that Mango I, II, III, and IV can be used to specifically image RNA in gels with high sensitivity. As little as 62.5 fmol of RNA in native gels and 125 fmol of RNA in denaturing gels can be detected by soaking gels in an imaging buffer containing potassium and 20 nM TO1-Biotin for 30 min. We demonstrate the specificity of the Mango-tagged system by imaging a Mango-tagged 6S bacterial RNA in the context of a complex mixture of total bacterial RNA.

Here we present a sensitive, rapid, and discriminating post-gel staining method to image RNAs tagged with RNA Mango aptamers I, II, III, or IV, using either native or denaturing polyacrylamide gel electrophoresis (PAGE) gels. After running standard PAGE gels, Mango-tagged RNA can be easily stained with TO1-Biotin and then analyzed using commonly available fluorescence readers.

Native and denaturing polyacrylamide gels are routinely used to characterize ribonucleoprotein (RNP) complex mobility and to measure RNA size, ...

Fast and Sensitive Colloidal Coomassie G-250 Staining for Proteins in Polyacrylamide Gels

Coomassie Brilliant Blue (CBB) is a dye commonly used for the visualization of proteins separated by SDS-PAGE, offering a simple staining procedure and high quantitation. Furthermore, it is completely compatible with mass spectrometric protein identification. But despite these advantages, CBB is regarded to be less sensitive than silver or fluorescence stainings and therefore rarely used for the detection of proteins in analytical gel-based proteomic approaches.
Several improvements of the original Coomassie protocol1 have been made to increase the sensitivity of CBB. Two major modifications were introduced to enhance the detection of low-abundant proteins by converting the dye molecules into colloidal particles: In 1988, Neuhoff and colleagues applied 20% methanol and higher concentrations of ammonium sulfate into the CBB G-250 based staining solution2, and in 2004 Candiano et al. established Blue Silver using CBB G-250 with phosphoric acid in the presence of ammonium sulfate and methanol3. Nevertheless, all these modifications just allow a detection of approximately 10 ng protein. A widely fameless protocol for colloidal Coomassie staining was published by Kang et al. in 2002 where they modified Neuhoff's colloidal CBB staining protocol regarding the complexing substances. Instead of ammonium sulfate they used aluminum sulfate and methanol was replaced by the less toxic ethanol4. The novel aluminum-based staining in Kang's study showed superior sensitivity that detects as low as 1 ng/band (phosphorylase b) with little sensitivity variation depending on proteins.
Here, we demonstrate application of Kang's protocol for fast and sensitive colloidal Coomassie staining of proteins in analytical purposes. We will illustrate the quick and easy protocol using two-dimensional gels routinely performed in our working group.

This video shall popularize a colloidal Coomassie G-250 staining protocol according to Kang et al. for the detection of average 4 ng protein in gels. The staining is completed within 2 hours and without any effort. We routinely use Kang's protocol for analytical purposes in gel-based proteomics.

Coomassie Brilliant Blue (CBB) is a dye commonly used for the visualization of proteins separated by SDS-PAGE, offering a simple staining procedure and ...

Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers

Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the invasion of non-indigenous species. However, an exact identification of field predator-prey interactions is difficult in many cases. These analyses are often based on a visual evaluation of gut content or the analysis of stable isotope ratios (&#948;15N and &#948;13C). Such methods require comprehensive knowledge about, respectively, morphologic diversity or isotopic signature from individual prey organisms, leading to obstacles in the exact identification of prey organisms. Visual gut content analyses especially underestimate soft bodied prey organisms, because maceration, ingestion and digestion of prey organisms make identification of specific species difficult. Hence, polymerase chain reaction (PCR) based strategies, for example the use of group-specific primer sets, provide a powerful tool for the investigation of food web interactions. Here, we describe detailed protocols to investigate the gut contents of macroinvertebrate consumers from the field using group-specific primer sets for nuclear ribosomal deoxyribonucleic acid (rDNA). DNA can be extracted either from whole specimens (in the case of small taxa) or out of gut contents of specimens collected in the field. Presence and functional efficiency of the DNA templates need to be confirmed directly from the tested individual using universal primer sets targeting the respective subunit of DNA. We also demonstrate that consumed prey can be determined further down to species level via PCR with unmodified group-specific primers combined with subsequent single strand conformation polymorphism (SSCP) analyses using polyacrylamide gels. Furthermore, we show that the use of different fluorescent dyes as labels enables parallel screening for DNA fragments of different prey groups from multiple gut content samples via automated fragment analysis.

Most common gut content analyses of macroinvertebrates are visual. Requiring intense knowledge about morphological diversity of prey organisms, they miss soft bodied prey and, due to strong comminution of prey, are nearly impossible for some organisms, including amphipods. We provide detailed, novel genetic approaches for macroinvertebrate prey identification in the diet of amphipods.

Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the ...

Detection of Glycosaminoglycans by Polyacrylamide Gel Electrophoresis and Silver Staining

Sulfated glycosaminoglycans (GAGs) such as heparan sulfate (HS) and chondroitin sulfate (CS) are ubiquitous in living organisms and play a critical role in a variety of basic biological structures and processes. As polymers, GAGs exist as a polydisperse mixture containing polysaccharide chains that can range from 4000 Da to well over 40,000 Da. Within these chains exists domains of sulfation, conferring a pattern of negative charge that facilitates interaction with positively charged residues of cognate protein ligands. Sulfated domains of GAGs must be of sufficient length to allow for these electrostatic interactions. To understand the function of GAGs in biological tissues, the investigator must be able to isolate, purify, and measure the size of GAGs. This report describes a practical and versatile polyacrylamide gel electrophoresis-based technique that can be leveraged to resolve relatively small differences in size between GAGs isolated from a variety of biological tissue types.

This report describes techniques to isolate and purify sulfated glycosaminoglycans (GAGs) from biological samples and a polyacrylamide gel electrophoresis approach to approximate their size. GAGs contribute to tissue structure and influence signaling processes via electrostatic interaction with proteins. GAG polymer length contributes to their binding affinity for cognate ligands.

Sulfated glycosaminoglycans (GAGs) such as heparan sulfate (HS) and chondroitin sulfate (CS) are ubiquitous in living organisms and play a critical role ...

Sodium Dodecyl Sulphate Polyacrylamide Gel Electrophoresis for Protein Analysis: A Technique to Separate and Visualize Proteins Based on Molecular Weight

Source: Sultana, S. et al. <a href="https://www.jove.com/v/62628">Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor</a>. J. Vis. Exp. (2021).
This video demonstrates a denaturing polyacrylamide-based separation technique for proteins. This technique helps in the preliminary identification of proteins based on their molecular weights.

Source: Sultana, S. et al. Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor. J. Vis. ...

JoVE Encyclopedia of Experiments

Biological Techniques

Electrophoresis Techniques

Fluorescent Silver Staining: A Technique to Visualize Total Protein in Polyacrylamide Gels

After electrophoresis, submerge the gel in a 100-milliliter solution containing ethanol and acetic acid on an orbital shaker, and incubate twice for 30 minutes each, at room temperature while shaking at 50 RPM. Next, wash the gel three times with ultrapure water in a clean container, with each wash lasting 10 minutes.
First, dissolve 0.01 grams of silver nitrate in 10 milliliters of ultrapure water to prepare a stock solution with a concentration of 0.1%. Add 100 microliters of this stock solution into 100 milliliters of ultrapure water to make the silver nitrate working solution. In a fume hood, submerge the gel in 100 milliliters of the silver nitrate working solution in a sealed glass chamber.
Use aluminum foil to protect the gel from light during impregnation, and incubate for 1 hour while shaking at 50 RPM on an orbital shaker. After this, wash the gel twice with ultrapure water in a clean container, with each wash using approximately 100 milliliters of water and lasting 60 seconds.
It is important to use ultrapure water to clean the gel after the silver impregnation step to minimize background staining.
First, add 50 milliliters of ultrapure water to 3 milligrams of TPE-4TA dye. Sonicate the solution for 3 minutes, and add 5 microliters of 1 molar sodium hydroxide solution in between each sonication session, to help dissolve the dye, usually up to three times. Then, check the fluorescence of the solution under a 365-nanometer UV lamp to ensure that the dye is fully dissolved. Only weak or non-emissive solutions indicate full dissolution.
To prepare the fluorogenic developing solution, add 10 milliliters of the TPE-4TA stock solution to 90 milliliters of ultrapure water. Use a pH meter to check the pH of the solution. Tune the solution to a pH between 7 and 9, using diluted sodium hydroxide solution or acetic acid, if the pH is out of range.
Next, transfer the gel to a clean and sealable container with 100 milliliters of the fluorogenic developing solution, and ensure that the gel is completely immersed. Seal the container, and cover it to protect it from light. Shake the container overnight on an orbital shaker at 50 RPM and at room temperature.
Transfer the gel to a clean container, and de-stain it in 100 milliliters of 10% ethanol for 30 minutes. Then, rinse the gel in ultrapure water for 5 minutes. The gel can be visualized on a benchtop trans-illuminator, or imaged on a gel documentation machine at the 365-nanometer channel or the 302-nanometer channel.

A Fast Silver Staining Protocol Enabling Simple and Efficient Detection of SSR Markers using a Non-denaturing Polyacrylamide Gel

Samenvatting

Meer video's verkennen