This work was funded by the Guangdong Natural Science Foundation of China (2015A030313500), the Provincial Key International Cooperative Research Platform and the Major Scientific Research Project of Guangdong Higher Education (2015KGJHZ015), the Science and Technology Plan of Guangdong Tobacco Monopoly Administration (201403, 201705), the Science and Technology Plan of Guangdong of China (2016B020201001), the National Innovation Training Project for Undergraduate Students (201711078001). Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the US Department of Agriculture. USDA is an equal opportunity provider and employer.

1. Preparation of PCR Products of SSR Markers
<ol>
	<li>Prepare all chemicals and reagents for PCR reactions including template DNA (30 ng/&#181;L), 2&#215; PCR master mix (containing 2&#215; PCR buffer, 0.4 mM of each dNTP, 3 mM of MgCl2, 0.1 U/&#181;L of Taq DNA polymerase and dyes), 10 &#181;M of each forward and reverse primers, and distilled or deionized water (dH2O). 
	NOTE: The SSR markers used in the present study were PT51333 (forward primer sequence: 5 &#39;-GCACCTTTGGTTATCCGACA-3 &#39; and reverse primer sequence: 5 &#39;-TGCTTTAAGTCATGTACCAAATTGA-3 &#39;) and PT50903 (forward primer sequence: 5 &#39;-AAATTTCTTTCGGTGTGATAACTG-3&#39; and reverse primer sequence: 5&#39;- AGAGACTGCCGTTTGATTTGA -3&#39;) for tobacco, and CX-43 (forward primer sequence: 5&#39;-TGGGGATGTGAGCTTCTTCT-3&#39; and reverse primer sequence:5&#39;- AGGGTTCCTTTGGGGTGATA-3&#39;) and CX-157 (forward primer sequence: 5 &#39;-TCGACGCTGACTTCACTGAC-3 &#39; and reverse primer sequence: 5 &#39;-GGACAGCTTCACACATTTGC-3 &#39;) for flowering Chinese cabbage.</li>
	<li>Prepare 10 &#181;L of PCR mix for amplification by adding 2 &#181;L of template DNA, 5 &#181;L of 2&#215; PCR master mix, 0.2 &#181;L of each forward primer and reverse primer and 2.6 &#181;L of dH2O.</li>
	<li>Perform PCR amplification reaction in a thermocycler with an initial step of 94 &#176;C for 5 min, follow by 38 cycles of 45 s at 94 &#176;C for denaturation, 45 s at 55 &#176;C for primer annealing and 1 min at 72 &#176;C for extension, and a final extension step of 10 min at 72 &#176;C; then store PCR products at 4 &#176;C for later use.</li>
</ol>
2. Preparation of Solutions for Polyacrylamide Gels Casting
<ol>
	<li>Prepare 1 L of 5&#215; TBE buffer by dissolving 54 g of Tris base and 27.5 g boric acid in dH2O, adding 20 mL of 0.5 M EDTA (pH 8.0) and adjusting the solution to a final volume of 1, 000 mL with dH2O. 
	NOTE: TBE buffer can be stored at room temperature for months.</li>
	<li>Prepare 2 L of 0.5&#215; TBE buffer by adding 200 mL of 5&#215; TBE buffer to dH2O to a final volume of 2 L, and store at room temperature.</li>
	<li>Prepare a 6% non-denaturing polyacrylamide gel solution by dissolving 29 g of molecular biology grade acrylamide and 1 g of molecular biology grade N, N&#39;-methylenebisacrylamide in 0.5&#215; TBE buffer to a final volume of 500 mL. Cover the solution bottle with aluminum foil and store at 4 &#176;C for later use. 
	Caution: Acrylamide is considered a potent neurotoxin and should be handled with care. Always wear gloves when weighing powder and handling solutions that contain it.</li>
	<li>Prepare a 20% ammonium persulfate (APS) solution by dissolving 2 g of APS with dH2O to a final volume of 10 mL. It can be stored at -20 &#176;C for months. 
	NOTE: For convenience, 10 mL of 20% APS solution can be aliquoted into 1.5 mL or 2 mL of centrifuge tubes for storage at -20 &#176;C. Thaw and mix well before use.</li>
	<li>Prepare a diluted bind-silane solution by dissolving 3 &#181;L of bind-silane in 0.997 mL of 95% ethanol containing 0.5% of acetic acid. It can be stored at 4 &#176;C for weeks. 
	Caution: Bind-silane is toxic, wear gloves when handling the solution and keep room ventilated.</li>
</ol>
3. Preparation of Polyacrylamide Gels for Electrophoresis
<ol>
	<li>Wash one set of glass plates and spacers with detergent in tap water, followed by a complete rinsing with dH2O. Air dry the plates by setting them in a plate drying rack.</li>
	<li>Disperse 1 mL of bind-silane solution onto the inner surface of a rectangular glass plate, and dry for 5 min. 
	NOTE: If the bind-silane solution is not spread uniformly on the surface of the plate, the gel may be detached during staining and result in an unsatisfactory staining effect.</li>
	<li>Disperse 1 mL of repel-silane onto the inner surface of a notched glass plate with a swab, wipe off excess repel-silane with tissue paper, and air dry for 5 min. 
	NOTE: If the repel-silane does not coat the surface of the glass plate uniformly, it may damage the gel by partially stripping.</li>
	<li>Assemble the glass plates with spacers with the notched plate on top, and clamp both sides of the assembly with casting clamps.</li>
	<li>Pour appropriate amount (40 mL) of 6% non-denaturing polyacrylamide gel solution to a beaker for the plate set of 33 cm width &#215; 10 cm height and spacer thickness of 1.5 mm, add 20 &#181;L of tetramethylethylenediamine (TEMED) and 200 &#181;Lfresh 20% APS and mix gently. 
	NOTE: The appropriate amount (40 mL) of gel solution was calculated from the inner volume of the two plates with a thickness of spacers (30 cm &#215; 8.5 cm &#215; 0.15 cm). As for the amount of TEMED and APS for gel polymerization, there is a standard ratio of gel solution to TEMED and APS based on the reference17. The gel solution described above is stored at 4&#176;C. If gel solution is stored at room temperature, 20 &#181;L of TEMED and 100 &#181;L of 20% APS should be used. Gently stir the mixture of gel solution with a glass stick to avoid air bubbles in the solution.</li>
	<li>Pour the solution immediately and carefully into the assembled glass plates along the edge of the notched plate, fill the space almost to the top, and insert the comb. Add a small volume of gel solution over the comb. 
	NOTE: Keep the glass plates horizontal to prevent the gel from leaking. Remove any bubbles with a bubble hook, if necessary.</li>
	<li>Allow the gel to set for 30 min at room temperature. 
	NOTE: The time for polymerization may change with temperatures of gel solution and environment.</li>
	<li>After the gel is fully polymerization, remove the casting clamps and position the plate set in the electrophoresis tank unit with the notched plate facing toward the upper buffer reservoir, and use large clamps to attach the plate set to the tank unit.</li>
	<li>Pour 1 L of 0.5&#215; TBE buffer into each of the upper and the lower chambers. Remove the comb and flush all the wells thoroughly with buffer using a pipette or syringe. 
	NOTE: Ensure that the gel sandwich at the bottom of the plate is completely soaked in buffer without any bubbles.</li>
</ol>
4. Running Gels
<ol>
	<li>Load about 1 &#181;L of PCR product into each well of the polyacrylamide gel. Load a DNA size ladder to both sides of the gel along with samples of PCR products. Fix the safety cover to the upper buffer chamber.</li>
	<li>Connect the leads to the power supply, matching the color-coded red to red and black to black. Run the gel at a constant voltage of 110 V until the dye reaches a defined position, normally for ~70 min. 
	NOTE: The voltage and running time can be adjusted according to the size of the PCR products.</li>
</ol>
5. Silver Staining for Detecting SSR Markers in a Non-Polyacrylamide Gel
<ol>
	<li>After electrophoresis, drain the buffer from the upper chamber into a large beaker via the valve. Detach the side clamps, remove the plates from the apparatus, carefully separate the notched glass plate along one side with a spatula, and make sure that the gel remains attached to the other glass plate coated with bind silane.</li>
	<li>Make 1 L of fresh impregnation solution by dissolving 1.5 g of AgNO3 in 1 L of dH2O. Prepare 1 L of fresh development solution by dissolving 10 g of NaOH in 900 mL of dH2O, add 1 mL of 37% formaldehyde, and adjust to a final volume of 1 L using dH2O. 
	NOTE: Wear gloves and handle the above chemicals and solutions with care. It is not necessary to keep the solutions and corresponding steps with the solutions in the dark.</li>
	<li>Carefully rinse the gel and glass plate with ample dH2O to remove the electrophoresis buffer, then place the plate with the gel facing up onto a plastic tray and submerge the gel in 1 L of impregnation solution. Put the tray on a shaker.</li>
	<li>Shake the tray gently at 60 r/min for 3-4 min. 
	NOTE: Shaking time can be adjusted according to the gel thickness and concentration of silver nitrate in the impregnation solution.</li>
	<li>Move the plate out of impregnation solution and put it onto another tray. Rinse the residual impregnation solution off from the surface of the plate and the gel using ample dH2O twice for 3-5 s each.</li>
	<li>Place the plate with the gel facing up onto another tray, submerge the plate in 1 L of development solution, then shake the tray gently at 50 r/min for ~3 min. Monitor the appearance of DNA fragments and stop development when the highest ratio of the signal of DNA fragments to the noise of background is observed (this step takes ~3 min).</li>
	<li>Rinse the plate and the gel with ample dH2O twice, and dry the gel plate with a tissue paper.</li>
	<li>Scan the gel using an appropriate scanner. A resolution of 300 dpi gives a clear visualization of DNA fragments. The gel can also be photographed using a camera.</li>
	<li>The banding pattern of SSR markers can be scored based on the DNA fragments in the image.</li>
</ol>

<ol>
	<li>Jiang, G. L., Anderson, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+markers+and+marker-assisted+breeding+in+plants.">Molecular markers and marker-assisted breeding in plants.</a> Plant breeding from laboratories to fields. , 45-83 (2013).</li><li>Powell, W., Machray, G. C., Provan, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymorphism+revealed+by+simple+sequence+repeats.">Polymorphism revealed by simple sequence repeats.</a> Trend Plant Sci. 1, 215-222 (1996).</li><li>Varshney, R. K., Graner, A., Sorrells, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genic+microsatellite+markers+in+plants:+features+and+applications.">Genic microsatellite markers in plants: features and applications.</a> Trend Biotechnol. 23, 48-55 (2005).</li><li>Tuler, A. C., Carrijo, T. T., N&#243;ia, L. R., Ferreira, A., Peixoto, A. L., da Silva Ferreira, M. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SSR+markers:+a+tool+for+species+identification+in+Psidium+(Myrtaceae).">SSR markers: a tool for species identification in Psidium (Myrtaceae).</a> Mol. Biol. Rep. 42, 1501-1513 (2015).</li><li>Rabilloud, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+protein+silver+staining+in+polyacrylamide+gels:+a+10-year+synthesis.">Mechanisms of protein silver staining in polyacrylamide gels: a 10-year synthesis.</a> Electrophoresis. 11, 785-794 (1990).</li><li>Bassam, B. J., Caetano-Anoll&#233;s, G., Gresshoff, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+sensitive+silver+staining+of+DNA+in+polyacrylamide+gels.">Fast and sensitive silver staining of DNA in polyacrylamide gels.</a> Anal. Biochem. 196, 80-83 (1991).</li><li>Liang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+and+effective+method+for+silver+staining+of+PCR+products+separated+in+polyacrylamide+gels.">A rapid and effective method for silver staining of PCR products separated in polyacrylamide gels.</a> Electrophoresis. 35, 2520-2523 (2014).</li><li>Switzer, R. C., Merril, C. R., Shifrin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+highly+sensitive+silver+stain+for+detecting+proteins+and+peptides+in+polyacrylamide+gels.">A highly sensitive silver stain for detecting proteins and peptides in polyacrylamide gels.</a> Anal. Biochem. 98, 231-237 (1979).</li><li>Sanguinetti, C., Dias, N., Simpson, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+silver+staining+and+recovery+of+PCR+products+separated+on+polyacrylamide+gels.">Rapid silver staining and recovery of PCR products separated on polyacrylamide gels.</a> Biotechniques. 17, 915-919 (1994).</li><li>Ji, Y., Qu, C., Cao, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+optimal+method+of+DNA+silver+staining+in+polyacrylamide+gels.">An optimal method of DNA silver staining in polyacrylamide gels.</a> Electrophoresis. 28, 1173-1175 (2007).</li><li>Qu, L., Li, X., Wu, G., Yang, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+and+sensitive+method+of+DNA+silver+staining+in+polyacrylamide+gels.">Efficient and sensitive method of DNA silver staining in polyacrylamide gels.</a> Electrophoresis. 26, 99-101 (2005).</li><li>An, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+silver+staining+procedure+for+nucleic+acids+in+polyacrylamide+gels+without+fixation+and+pretreatment.">A silver staining procedure for nucleic acids in polyacrylamide gels without fixation and pretreatment.</a> Anal. Biochem. 391, 77-79 (2009).</li><li>Byun, S. O., Fang, Q., Zhou, H., Hickford, J. G. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+effective+method+for+silver-staining+DNA+in+large+numbers+of+polyacrylamide+gels.">An effective method for silver-staining DNA in large numbers of polyacrylamide gels.</a> Anal. Biochem. 385, 174-175 (2009).</li><li>Kumar, M., Kim, S. R., Sharma, P. C., Pareek, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+and+efficient+way+to+detect+small+polymorphic+bands+in+plants.">Simple and efficient way to detect small polymorphic bands in plants.</a> Genome Data. 5, 218-222 (2015).</li><li>Liu, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+simple+and+effective+silver+staining+protocol+for+detection+of+DNA+fragments.">Development of a simple and effective silver staining protocol for detection of DNA fragments.</a> Electrophoresis. 38, 1175-1178 (2017).</li><li>Wang, D., Shi, J., Carlson, S. R., Cregan, P. B., Ward, R. W., Diers, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+low-cost,+high-throughput+polyacrylamide+gel+electrophoresis+system+for+genotyping+with+microsatellite+DNA+markers.">A low-cost, high-throughput polyacrylamide gel electrophoresis system for genotyping with microsatellite DNA markers.</a> Crop Sci. 43, 1828-1832 (2003).</li><li>Echt, C. S., May-Marquardt, P., Hseih, M., Zahorchak, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+microsatellite+markers+in+eastern+white+pine.">Characterization of microsatellite markers in eastern white pine.</a> Genome. 39, 1102-1108 (1996).</li></ol>

The authors declare that they have no competing financial interests.

The washing of gel after impregnation is a critical step. Insufficient washing time and water volume may cause the incomplete removal of impregnation solution on the surface of the plate and the gel, and result in a dark background. The appropriate developing time is another key step, over-development can result in a dark-brown background with low contrast image of DNA fragments. In addition, the impregnation step significantly affects staining efficiency of DNA fragments. Although extending the impregnation time over 5 ...

The development of PCR-based markers has revolutionized the science of plant genetics and breeding1. Simple sequence repeat (SSR) markers are among the most commonly used and most versatile DNA markers. Their broad genome coverage, abundance, genome specificity, and repeatability are some of the merits of SSR markers in addition to their codominant inheritance for the detection of heterozygous genotypes2. Several studies have used SSR markers to investigate genetic diversity, track ancestry, construct genetic linkage maps, and map genes for economically important traits3,4.
PCR products of SSR markers are commonly separated using agarose or polyacrylamide gel electrophoresis and then visualized with silver staining or under UV light after staining with ethidium bromide. Silver staining of DNA fragments in polyacrylamide gels is more sensitive than the other staining methods5,6 and has been widely used to detect DNA fragments such as SSR markers7.
Like many biological laboratory techniques, silver staining of polyacrylamide gels has steadily improved since its first being reported as a fragment visualization technique in 19798. The technique was initially modified for detection of DNA fragments by Bassam et al.6 in 1991 and then improved by Sanguinetti and coworkers9 in 1994. The method has been further optimized in the last few decades6,7,9,10,11,12,13,14,15. However, most of these updated versions of the protocols still have some drawbacks such as high technical demand and long processing time for fixation and mounting6, that limit the application of these protocols7,11. An optimal protocol that combines low-cost with high efficiency of DNA fragment detection is urgently needed for routine application of silver staining in biological research.
In addition, polyacrylamide gel can be divided into denaturing and non-denaturing polyacrylamide gels, and both can be used for the detection of SSR markers using the silver staining method. The effect and resolution of which do not significantly differ, but non-denaturing polyacrylamide gels are easier to process and take less time16.
On the basis of the previous research15, the aim of the current study is to describe an optimized silver staining protocol in detail for quick, easy and low-cost detection of SSR markers in a non-denaturing polyacrylamide gel.

<table>
	<tbody>
		<tr>
			<td>PCR master mix (Green Taq Mix)</td>
			<td>Vazyme Biotech Co. Ltd, China</td>
			<td>#P131-03</td>
			<td></td>
		</tr>
		<tr>
			<td>50-2000 bp DNA Ladder</td>
			<td>Bio-Rad, USA</td>
			<td>#170-8200</td>
			<td></td>
		</tr>
		<tr>
			<td>DL500 DNA marker</td>
			<td>Takara Bio Inc., Japan</td>
			<td>#3590A</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris base</td>
			<td>Sangon Biotech Shanghai, China</td>
			<td>#77-86-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Boric acid</td>
			<td>Sangon Biotech Shanghai, China</td>
			<td>#10043-35-3</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA-Na2</td>
			<td>Guangzhou Chemical Reagent Factory, China</td>
			<td>#6381-92-6</td>
			<td></td>
		</tr>
		<tr>
			<td>Acrylamide</td>
			<td>Sangon Biotech Shanghai, China</td>
			<td>#79-06-1</td>
			<td></td>
		</tr>
		<tr>
			<td>N,N&#39;-methylene-bis-acrylamide</td>
			<td>Sangon Biotech Shanghai, China</td>
			<td>#110-26-9</td>
			<td></td>
		</tr>
		<tr>
			<td>N,N,N&#39;,N&#39;-Tetramethylethylenediamine</td>
			<td>Sangon Biotech Shanghai, China</td>
			<td>#110-18-9</td>
			<td></td>
		</tr>
		<tr>
			<td>Ammonium persulfate</td>
			<td>Guangzhou Chemical Reagent Factory, China</td>
			<td>#7727-54-0</td>
			<td></td>
		</tr>
		<tr>
			<td>Bind-silane</td>
			<td>Solarbio Beijing, China</td>
			<td>#B8150</td>
			<td></td>
		</tr>
		<tr>
			<td>AgNO3</td>
			<td>Sinopharm Chemical Reagent Beijing Co.,Ltd, China</td>
			<td>#7761-88-8</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde</td>
			<td>Tianjin DaMao Chemical Reagent Factory, China</td>
			<td>#50-00-0</td>
			<td></td>
		</tr>
		<tr>
			<td>NaOH</td>
			<td>Guangzhou Chemical Reagent Factory, China</td>
			<td>#1310-73-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Acetic acid</td>
			<td>Guangzhou Chemical Reagent Factory, China</td>
			<td>#64-19-7</td>
			<td></td>
		</tr>
		<tr>
			<td>Na2CO3</td>
			<td>Tianjin DaMao Chemical Reagent Factory, China</td>
			<td>#497-19-8</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Guangzhou Chemical Reagent Factory, China</td>
			<td>#64-17-5</td>
			<td></td>
		</tr>
		<tr>
			<td>HNO3</td>
			<td>Guangzhou Chemical Reagent Factory, China</td>
			<td>#7697-37-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Na2S2O3.5H2O</td>
			<td>Sinopharm Chemical Reagent Beijing Co.,Ltd, China</td>
			<td>#10102-17-7</td>
			<td></td>
		</tr>
		<tr>
			<td>Eriochrome black T(EBT)</td>
			<td>Tianjin DaMao Chemical Reagent Factory, China</td>
			<td>#1787-61-7</td>
			<td></td>
		</tr>
		<tr>
			<td>Plastic tray</td>
			<td>Shanghai Yi Chen Plastic Co., Ltd, China</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>TS-1 Shaker</td>
			<td>Qilinbeter JiangSu, China</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>BenQ M800 Scanner</td>
			<td>BenQ, China</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>DYY-6C Power supply</td>
			<td>Beijing Liuyi Instrument Factory, China</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>High throughout vertical gel systems, JY-SCZF</td>
			<td>Beijing Tunyi Electrophoresis Co., Ltd, China</td>
			<td>-</td>
			<td></td>
		</tr>
	</tbody>
</table>

a fast silver staining protocol enabling simple and efficient detection of ssr markers using a non-denaturing polyacrylamide gel

Simple Sequence Repeat (SSR) is one of the most effective markers used in plant and animal genetic research and molecular breeding programs. Silver staining is a widely used method for the detection of SSR markers in a polyacrylamide gel. However, conventional protocols for silver staining are technically demanding and time-consuming. Like many other biological laboratory techniques, silver staining protocols have been steadily optimized to improve detection efficiency. Here, we report a simplified silver staining method that significantly reduces reagent costs and enhances the detection resolution and picture clarity. The new method requires two major steps (impregnation and development) and three reagents (silver nitrate, sodium hydroxide, and formaldehyde), and only 7 min of processing for a non-denaturing polyacrylamide gel. Compared to previously reported protocols, this new method is easier, quicker and uses fewer chemical reagents for SSR detection. Therefore, this simple, low-cost, and effective silver staining protocol will benefit genetic mapping and marker-assisted breeding by a quick generation of SSR marker data.

The PCR amplicons were produced using the corresponding SSR primer pairs in flowering Chinese cabbage and tobacco. After electrophoresis, the polyacrylamide gels were stained using the above silver staining protocol, which unambiguously detected the banding patterns of SSR markers (Figure 1).
To compare the detection efficiency of different silver staining protocols, PCR products of SSR markers in t...

Watch this Scientific Journal Video about A Fast Silver Staining Protocol Enabling Simple and Efficient Detection of SSR Markers using a Non-denaturing Polyacrylamide Gel at JoVE.com

A Fast Silver Staining Protocol Enabling Simple and Efficient Detection of SSR Markers using a Non-denaturing Polyacrylamide Gel

Here, we report a simple and low-cost silver staining protocol which requires only three reagents and 7 min of processing, and is suitable for fast generation of high-quality SSR data in the genetic analysis.

Simple Sequence Repeat (SSR) is one of the most effective markers used in plant and animal genetic research and molecular breeding programs. Silver ...

a-fast-silver-staining-protocol-enabling-simple-efficient-detection

Research

JoVE Journal

Genetics

10.6K Views.  Guangzhou University. Here, we report a simple and low-cost silver staining protocol which requires only three reagents and 7 min of processing, and is suitable for fast generation of high-quality SSR data in the genetic analysis.

Video: A Fast Silver Staining Protocol Enabling Simple and Efficient Detection of SSR Markers using a Non-denaturing Polyacrylamide Gel

Detection of Copy Number Alterations Using Single Cell Sequencing

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and microbial populations. Traditional methods for assessing genetic heterogeneity have been limited by low resolution, low sensitivity, and/or low specificity. Single cell sequencing has emerged as a powerful tool for detecting genetic heterogeneity with high resolution, high sensitivity and, when appropriately analyzed, high specificity. Here we provide a protocol for the isolation, whole genome amplification, sequencing, and analysis of single cells. Our approach allows for the reliable identification of megabase-scale copy number variants in single cells. However, aspects of this protocol can also be applied to investigate other types of genetic alterations in single cells.

Single cell sequencing is an increasingly popular and accessible tool for addressing genomic changes at high resolution. We provide a protocol that uses single cell sequencing to identify copy number alterations in single cells.

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and ...

Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA interactions such as microRNA-mRNA interactions have been shown to regulate gene expression, the full extent to which RNA interactions occur in the cell is still unknown. Previous methods to study RNA interactions have primarily focused on subsets of RNAs that are interacting with a particular protein or RNA species. Here, we detail a method named Sequencing of Psoralen crosslinked, Ligated, and Selected Hybrids (SPLASH) that allows genome-wide capture of RNA interactions in vivo in an unbiased manner. SPLASH utilizes in vivo crosslinking, proximity ligation, and high throughput sequencing to identify intramolecular and intermolecular RNA base-pairing partners globally. SPLASH can be applied to different organisms including bacteria, yeast and human cells, as well as diverse cellular conditions to facilitate the understanding of the dynamics of RNA organization under diverse cellular contexts. The entire experimental SPLASH protocol takes about 5 days to complete and the computational workflow takes about 7 days to complete.

Here, we detail the method of Sequencing of Psoralen crosslinked, Ligated, and Selected Hybrids (SPLASH), which enables genome-wide mapping of intramolecular and intermolecular RNA-RNA interactions in vivo. SPLASH can be applied to study RNA interactomes of organisms including yeast, bacteria and humans.

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA ...

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play in the functioning of cells and whole organisms. This cause has been tremendously aided by the recent introduction of the CRISPR/Cas9 system-a versatile tool that allows researchers to manipulate the genome and transcriptome in order to, among other things, knock out, knock down, or knock in genes in a targeted manner. For the purpose of knocking out a gene, CRISPR/Cas9-mediated double-strand breaks recruit the non-homologous end-joining DNA repair pathway to introduce the frameshift-causing insertion or deletion of nucleotides at the break site. However, an individual guide RNA may cause undesirable off-target effects, and to rule these out, the use of multiple guide RNAs is necessary. This multiplicity of targets also means that a high-volume screening of clones is required, which in turn begs the use of an efficient high-throughput technique to genotype the knockout clones. Current genotyping techniques either suffer from inherent limitations or incur high cost, hence rendering them unsuitable for high-throughput purposes. Here, we detail the protocol for using fluorescent PCR, which uses genomic DNA from crude cell lysate as a template, and then resolving the PCR fragments via capillary gel electrophoresis. This technique is accurate enough to differentiate one base-pair difference between fragments and hence is adequate in indicating the presence or absence of a frameshift in the coding sequence of the targeted gene. This precise knowledge effectively precludes the need for a confirmatory sequencing step and allows users to save time and cost in the process. Moreover, this technique has proven to be versatile in genotyping various mammalian cells of various tissue origins targeted by guide RNAs against numerous genes, as shown here and elsewhere.

The genotyping technique described here, which couples fluorescent polymerase chain reaction (PCR) to capillary gel electrophoresis, allows for high-throughput genotyping of nuclease-mediated knockout clones. It circumvents limitations faced by other genotyping techniques and is more cost effective than sequencing methods.

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play ...

Laser Microirradiation to Study In Vivo Cellular Responses to Simple and Complex DNA Damage

DNA damage induces specific signaling and repair responses in the cell, which is critical for protection of genome integrity. Laser microirradiation became a valuable experimental tool to investigate the DNA damage response (DDR) in vivo. It allows real-time high-resolution single-cell analysis of macromolecular dynamics in response to laser-induced damage confined to a submicrometer region in the cell nucleus. However, various laser conditions have been used without appreciation of differences in the types of damage induced. As a result, the nature of the damage is often not well characterized or controlled, causing apparent inconsistencies in the recruitment or modification profiles. We demonstrated that different irradiation conditions (i.e., different wavelengths as well as different input powers (irradiances) of a femtosecond (fs) near-infrared (NIR) laser) induced distinct DDR and repair protein assemblies. This reflects the type of DNA damage produced. This protocol describes how titration of laser input power allows induction of different amounts and complexities of DNA damage, which can easily be monitored by detection of base and crosslinking damages, differential poly (ADP-ribose) (PAR) signaling, and pathway-specific repair factor assemblies at damage sites. Once the damage conditions are determined, it is possible to investigate the effects of different damage complexity and differential damage signaling as well as depletion of upstream factor(s) on any factor of interest.

Laser Microirradiation to Study In Vivo Cellular Responses to Simple and Complex DNA Damage

The goal of this protocol is to describe how to use laser microirradiation to induce different types of DNA damage, including relatively simple strand breaks and complex damage, to study DNA damage signaling and repair factor assembly at damage sites in vivo.

DNA damage induces specific signaling and repair responses in the cell, which is critical for protection of genome integrity. Laser microirradiation ...

An Array-based Comparative Genomic Hybridization Platform for Efficient Detection of Copy Number Variations in Fast Neutron-induced Medicago truncatula Mutants

Mutants are invaluable genetic resources for gene function studies. To generate mutant collections, three types of mutagens can be utilized, including biological such as T-DNA or transposon, chemical such as ethyl methanesulfonate (EMS), or physical such as ionization radiation. The type of mutation observed varies depending on the mutagen used. For ionization radiation induced mutants, mutations include deletion, duplication, or rearrangement. While T-DNA or transposon-based mutagenesis is limited to species that are susceptible to transformation, chemical or physical mutagenesis can be applied to a broad range of species. However, the characterization of mutations derived from chemical or physical mutagenesis traditionally relies on a map-based cloning approach, which is labor intensive and time consuming. Here, we show that a high-density genome array-based comparative genomic hybridization (aCGH) platform can be applied to efficiently detect and characterize copy number variations (CNVs) in mutants derived from fast neutron bombardment (FNB) mutagenesis in Medicago truncatula, a legume species. Whole genome sequence analysis shows that there are more than 50,000 genes or gene models in M. truncatula. At present, FNB-induced mutants in M. truncatula are derived from more than 150,000 M1 lines, representing invaluable genetic resources for functional studies of genes in the genome. The aCGH platform described here is an efficient tool for characterizing FNB-induced mutants in M. truncatula.

An Array-based Comparative Genomic Hybridization Platform for Efficient Detection of Copy Number Variations in Fast Neutron-induced Medicago truncatula Mutants

This protocol provides experimental steps and information about reagents, equipment, and analysis tools for researchers who are interested in carrying out whole genome array-based comparative genomic hybridization (CGH) analysis of copy number variations in plants.

Mutants are invaluable genetic resources for gene function studies. To generate mutant collections, three types of mutagens can be utilized, including ...

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development of a customizable platform to rapidly generate gene modifications in a wide variety of organisms, including zebrafish. CRISPR-based genome editing uses a single guide RNA (sgRNA) to target a CRISPR-associated (Cas) endonuclease to a genomic DNA (gDNA) target of interest, where the Cas endonuclease generates a double-strand break (DSB). Repair of DSBs by error-prone mechanisms lead to insertions and/or deletions (indels). This can cause frameshift mutations that often introduce a premature stop codon within the coding sequence, thus creating a protein-null allele. CRISPR-based genome engineering requires only a few molecular components and is easily introduced into zebrafish embryos by microinjection. This protocol describes the methods used to generate CRISPR reagents for zebrafish microinjection and to identify fish exhibiting germline transmission of CRISPR-modified genes. These methods include in vitro transcription of sgRNAs, microinjection of CRISPR reagents, identification of indels induced at the target site using a PCR-based method called a heteroduplex mobility assay (HMA), and characterization of the indels using both a low throughput and a powerful next-generation sequencing (NGS)-based approach that can analyze multiple PCR products collected from heterozygous fish. This protocol is streamlined to minimize both the number of fish required and the types of equipment needed to perform the analyses. Furthermore, this protocol is designed to be amenable for use by laboratory personal of all levels of experience including undergraduates, enabling this powerful tool to be economically employed by any research group interested in performing CRISPR-based genomic modification in zebrafish.

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Targeted genome editing in the model system Danio rerio (zebrafish) has been greatly facilitated by the emergence of CRISPR-based approaches. Herein, we describe a streamlined, robust protocol for generation and identification of CRISPR-derived nonsense alleles that incorporates the heteroduplex mobility assay and identification of mutations using next-generation sequencing.

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

A Simple, Rapid, and Quantitative Assay to Measure Repair of DNA-protein Crosslinks on Plasmids Transfected into Mammalian Cells

The purpose of this method is to provide a flexible, rapid, and quantitative technique to examine the kinetics of DNA-protein crosslink (DPC) repair in mammalian cell lines. Rather than globally assaying removal of xenobiotic-induced or spontaneous chromosomal DPC removal, this assay examines the repair of a homogeneous, chemically defined lesion specifically introduced at one site within a plasmid DNA substrate. Importantly, this approach avoids the use of radioactive materials and is not dependent on expensive or highly-specialized technology. Instead, it relies on standard recombinant DNA procedures and widely available real-time, quantitative polymerase chain reaction (qPCR) instrumentation. Given the inherent flexibility of the strategy utilized, the size of the crosslinked protein, as well as the nature of the chemical linkage and the precise DNA sequence context of the attachment site can be varied to address the respective contributions of these parameters to the overall efficiency of DPC repair. Using this method, plasmids containing a site-specific DPC were transfected into cells and low molecular weight DNA recovered at various times post-transfection. Recovered DNA is then subjected to strand-specific primer extension (SSPE) using a primer complementary to the damaged strand of the plasmid. Since the DPC lesion blocks Taq DNA polymerase, the ratio of repaired to un-repaired DNA can be quantitatively assessed using qPCR. Cycle threshold (CT) values are used to calculate percent repair at various time points in the respective cell lines. This SSPE-qPCR method can also be used to quantitatively assess the repair kinetics of any DNA adduct that blocks Taq polymerase.

The goal of this protocol is to quantify the repair of defined DNA-protein crosslinks on plasmid DNA. Lesioned plasmids are transfected into recipient mammalian cell lines and low-molecular weight harvested at multiple time points post-transfection. DNA repair kinetics are quantified using strand-specific primer extension followed by qPCR.

The purpose of this method is to provide a flexible, rapid, and quantitative technique to examine the kinetics of DNA-protein crosslink (DPC) repair in ...

Lentiviral Mediated Production of Transgenic Mice: A Simple and Highly Efficient Method for Direct Study of Founders

For almost 40 years, pronuclear DNA injection represents the standard method to generate transgenic mice with random integration of transgenes. Such a routine procedure is widely utilized throughout the world and its main limitation resides in the poor efficacy of transgene integration, resulting in a low yield of founder animals. Only few percent of animals born after implantation of injected fertilized oocytes have integrated the transgene. In contrast, lentiviral vectors are powerful tools for integrative gene transfer and their use to transduce fertilized oocytes allows highly efficient production of founder transgenic mice with an average yield above 70%. Furthermore, any mouse strain can be used to produce transgenic animal and the penetrance of transgene expression is extremely high, above 80% with lentiviral mediated transgenesis compared to DNA microinjection. The size of the DNA fragment that can be cargo by the lentiviral vector is restricted to 10 kb and represents the major limitation of this method. Using a simple and easy to perform injection procedure beneath the zona pellucida of fertilized oocytes, more than 50 founder animals can be produced in a single session of microinjection. Such a method is highly adapted to perform, directly in founder animals, rapid gain and loss of function studies or to screen genomic DNA regions for their ability to control and regulate gene expression in vivo.

Here, we present a protocol to promote transgene integration and production of founder transgenic mice with high efficacy by a simple injection of a lentiviral vector in the perivitelline space of a fertilized oocyte.

For almost 40 years, pronuclear DNA injection represents the standard method to generate transgenic mice with random integration of transgenes. Such a ...

A Fast and Quantitative Method for Post-translational Modification and Variant Enabled Mapping of Peptides to Genomes

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly being extended to integrative studies to enhance the understanding of molecular dynamics within cells. Current tools for the visualization and integration of proteomics with other omics datasets are inadequate for large-scale studies. Furthermore, they only capture basic sequence identify, discarding post-translational modifications and quantitation. To address these issues, we developed PoGo to map peptides with associated post-translational modifications and quantification to reference genome annotation. In addition, the tool was developed to enable the mapping of peptides identified from customized sequence databases incorporating single amino acid variants. While PoGo is a command line tool, the graphical interface PoGoGUI enables non-bioinformatics researchers to easily map peptides to 25 species supported by Ensembl genome annotation. The generated output borrows file formats from the genomics field and, therefore, visualization is supported in most genome browsers. For large-scale studies, PoGo is supported by TrackHubGenerator to create web-accessible repositories of data mapped to genomes that also enable an easy sharing of proteogenomics data. With little effort, this tool can map millions of peptides to reference genomes within only a few minutes, outperforming other available sequence-identity based tools. This protocol demonstrates the best approaches for proteogenomics mapping through PoGo with publicly available datasets of quantitative and phosphoproteomics, as well as large-scale studies.

Here we present the proteogenomic tool PoGo and protocols for fast, quantitative, post-translational modification and variant enabled mapping of peptides identified through mass spectrometry onto reference genomes. This tool is of use to integrate and visualize proteogenomic and personal proteomic studies interfacing with orthogonal genomics data.

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly ...