This work was funded by a Natural Sciences and Engineering Research Council of Canada-Discovery Grant (RGPIN-2017-05463), the Canada Foundation for Innovation-John R. Evans Leaders Fund (35017), the Campus Alberta Innovates Program and the Alberta Ministry of Economic Development and Trade.

NOTE: RNA is highly susceptible to degradation by ribonucleases (RNases). Take standard precautions to keep the RNA intact. Change gloves frequently. Use filtered pipette tips, nuclease-free plasticware, and nuclease-free chemicals in all steps of the protocol. Use nuclease-free or diethyl pyrocarbonate (DEPC)-treated water for all solutions.
1. Preparation of Solutions
<ol>
	<li>Prepare Toeprinting buffer: 20 mM Tris-HCl (pH 7.6), 100 mM KOAc, 2.5 mM Mg(OAc)2, 5% (w/v) sucrose, 2 mM dithiothreitol (DTT), and 0.5 mM spermidine.
	<ol>
		<li>Store DTT and spermidine in single-use aliquots at -20 &#176;C to avoid repeated freeze-thaw cycles. 
		NOTE: DTT and spermidine should be added to the toeprinting buffer immediately before use. A solution lacking DTT and spermidine can be stored at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Prepare aliquots of 85 mM 5&#39;-guanylyl imidodiphosphate (GMP-PNP) and 91 mM adenosine triphosphate (ATP). Store the aliquots at -20 &#176;C.</li>
	<li>Prepare 450 mL of 6% polyacrylamide-7M urea gel mix: 67.5 mL of 40% acrylamide:bis-acrylamide (19:1), 189 g of urea, 112.5 mL of 5x TBE (Tris/borate/thylenediaminetetraacetic acid (EDTA)), and 120 mL of water. Dissolve the urea by warming in a 37 &#176;C water bath or on a hot plate with stirring. Filter the solution (e.g., 0.2 &#956;m nitrocellulose vacuum filter). 
	NOTE: The solution can be stored at 4 &#176;C for at least one month. 
	Caution: Monomeric acrylamide is a neurotoxin which can be absorbed through the skin. Take great care to avoid skin contact (i.e., wear gloves, a lab coat, and eye protection). Polyacrylamide should also be handled with care, as polymerization may not proceed to 100% completion.</li>
	<li>Prepare formamide loading dye: 95% formamide, 18 mM EDTA, 0.025% (w/v) sodium dodecyl sulfate (SDS), 0.025% (w/v) bromophenol blue, 0.025% (w/v) xylene cyanol. Store at -20 &#176;C.</li>
	<li>Dissolve 1 nmol of primer (5&#39; CTCGATATGTGCATCTGTA; 5&#39; end-labeled with IRDye 800) into 100 &#956;L of water for a working concentration of 10 pmol/&#956;L. Store at -20 &#176;C in single-use aliquots (approximately 10 &#181;L), protected from light.</li>
</ol>
2. Preparation of mRNA
<ol>
	<li>Amplify DNA templates for the synthesis of mRNA by polymerase chain reaction (PCR) from appropriate templates (i.e., genomic DNA or plasmid DNA, as appropriate). Use a high-fidelity DNA polymerase according to the manufacturer&#39;s instructions, with the following reaction conditions (35 cycles): melt, 98 &#176;C, 10 s; anneal, 53 &#176;C, 20 s; extend, 72 &#176;C, 30 s. 
	NOTE: The forward primer (5&#39; AAGCTTAATACGACTCACTATAG) incorporates the T7 promoter sequence to allow for RNA transcription; the reverse primer (5&#39; T51GAATTCGGATCCGACCGTGG) includes 51 thymine residues to provide a poly-A tail for the transcribed RNA. Note that RNA can also be in vitro transcribed from plasmid DNA.</li>
	<li>Use an appropriate transcription kit to in vitro transcribe IRES-containing RNA or capped RNA from the DNA template. Follow the manufacturer&#39;s instructions. Prepare the RNA sample in standard 20 &#956;L reaction volumes. Treat the newly-synthesized RNA with 2 units of RNase-free DNase for 30 min at 37 &#176;C.</li>
	<li>Dilute the DNase-treated RNA to 110 &#181;L with nuclease-free water add 110 &#181;L acid phenol,&#160;vortex 5 s and centrifuge for 3 min at 20,000 x g at room temperature. Remove 100 &#181;L of the aqueous phase to a new 1.5 mL microfuge tube, add 10 &#181;L of 3 M sodium acetate, and vortex 2 s.&#160;Add, 3 volumes of 100% ethanol, vortex 5 s, and precipitate the RNA at -20 &#176;C overnight.</li>
	<li>Centrifuge at &#62;20,000 x g for 30 min at 4 &#176;C and discard the supernatant. Wash the pellet with 500 &#181;L of ice-cold 70% (v/v) ethanol and repeat the centrifugation. Aspirate as much of the supernatant as possible and air-dry the pellet for 5 - 10 min. Be careful not to dislodge the pellet.</li>
	<li>Resuspend the RNA in the appropriate volume of nuclease-free water to yield a working concentration of 0.5 &#956;g/&#956;L. This can be stored at -80 &#176;C or used immediately.</li>
</ol>
3. Toeprinting Reaction
<ol>
	<li>Mix 15 &#956;L of Rabbit Reticulocyte Lysate (RRL, not nuclease-treated), 1 &#956;L (40 units) of RNase Inhibitor, 1 &#181;L of 91 mM ATP (1.82 mM final) and 1 &#956;L of 85 mM GMP-PNP (1.7 mM final) in a 1.5 mL microfuge tube. Incubate at 30 &#176;C for 5 min. 
	NOTE: The RRL should be aliquoted for single use to avoid repetitive freeze-thawing. A critical control is a reaction lacking RRL, in order to elucidate the natural pauses of reverse transcription due to the secondary structure of the RNA.&#160;Add toeprinting buffer to replace RRL for this control.&#160;</li>
	<li>Add 0.5 &#181;g (1 &#181;L) of RNA and incubate at 30 &#176;C for 5 min.</li>
	<li>Add 22 &#181;L of Toeprinting buffer and incubate at 30 &#176;C for 3 min.</li>
	<li>Add 0.5 &#181;L (5 pmol) of IRDye-labeled primer and incubate on ice for 10 min.</li>
	<li>Add 2 &#181;L of 25 mM dNTPs (final concentration: 1 mM each), 2 &#181;L of 100 mM Mg(OAc)2, 1 &#181;L of Avian Myeloblastosis Virus Reverse Transcriptase (AMV-RT) and 3.5 &#181;L of Toeprinting buffer. The final volume is 50 &#956;L.</li>
	<li>Incubate the reaction at 30 &#176;C for 45 min.</li>
	<li>Add 200 &#181;L of nuclease-free water and immediately extract with 250 &#181;L of 25:24:1 phenol:chloroform:isoamyl alcohol (pH approximately 8.0). Vortex 5 s and centrifuge at 20,000 x g for 3 min at room temperature. Remove the aqueous phase to a new 1.5 mL microfuge tube, add 3 volumes of 100% ethanol, vortex 5 s, and precipitate at -20 &#176;C overnight.</li>
	<li>Centrifuge at &#62;20,000 x g for 30 min at 4 &#176;C and discard the supernatant. Wash the DNA pellet with 500 &#181;L of ice-cold 70% (v/v) ethanol. Centrifuge at &#62;20,000 x g for 15 min at 4 &#176;C. Aspirate as much supernatant as possible and air dry the pellet for 5 - 10 min. Be careful not to dislodge the pellet.</li>
	<li>Dissolve the pellet in 6 &#956;L of nuclease-free water and add 3 &#956;L of formamide loading dye.</li>
</ol>
4. Sequencing Reactions
<ol>
	<li>Use the DNA template from 2.1 and the IRDye-labeled primer from step 3.4 for standard sequencing reactions, using dideoxynucleotides (ddNTPs) as chain terminators. Use an appropriate DNA sequencing kit and follow the manufacturer&#39;s instructions.</li>
	<li>Mix 6 &#956;L of each sequencing reaction with 3 &#956;L of formamide loading dye.</li>
</ol>
5. Preparation of Sequencing Gel and Electrophoresis
NOTE: This protocol uses a fluorescence gel-based imager and a 21 cm x 23 cm x 0.2 mm gel, but can be adapted for other sequencers or gel-sizes, if required.
<ol>
	<li>Thoroughly clean the 0.2 mm spacers as well as the short (23 &#215; 25 cm) and long (30 &#215; 25 cm) glass plates with 100% ethanol. Air dry.</li>
	<li>Mix 30 mL of 6% polyacrylamide-7M urea gel mix with 200 &#956;L of 10% (w/v) ammonium persulfate (APS) and 20 &#956;L of tetramethylethylenediamine (TEMED). Pour the gel, taking care to avoid bubbles, and insert the &#39;shark-tooth&#39; gel comb. Allow the gel to polymerize for 1 h at room temperature.</li>
	<li>Assemble the sequencing apparatus and fill the reservoirs with 1x TBE.</li>
	<li>Pre-run for 15 min at 1500 V until the optimal temperature of 55 &#176;C is achieved.</li>
	<li>Heat the sample/loading dye mix (from steps 3.9 or 4.2) to 85 &#176;C for 5 min. Load 1 &#956;L onto the sequencing gel.</li>
	<li>Run the gel at 1500 V for 8 h. The machine will read the bands in real time.</li>
	<li>Disassemble the apparatus, and dispose the acrylamide gel and running buffer.</li>
</ol>

<ol>
	<li>Holcik, M., Sonenberg, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+stress+and+apoptosis.">Translational control in stress and apoptosis.</a> Nat Rev Mol Cell Biol. 6 (4), 318-327 (2005).</li><li>Lacerda, R., Menezes, J., Romao, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=More+than+just+scanning:+the+importance+of+cap-independent+mRNA+translation+initiation+for+cellular+stress+response+and+cancer.">More than just scanning: the importance of cap-independent mRNA translation initiation for cellular stress response and cancer.</a> Cell Mol Life Sci. 74 (9), 1659-1680 (2017).</li><li>Sharma, D. K., Bressler, K., Patel, H., Balasingam, N., Thakor, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+Eukaryotic+Initiation+Factors+during+Cellular+Stress+and+Cancer+Progression.">Role of Eukaryotic Initiation Factors during Cellular Stress and Cancer Progression.</a> J Nucleic Acids. 2016, 8235121 (2016).</li><li>Gebauer, F., Hentze, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+translational+control.">Molecular mechanisms of translational control.</a> Nat Rev Mol Cell Biol. 5 (10), 827-835 (2004).</li><li>Anthony, D. D., Merrick, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+40+S+and+80+S+complexes+with+mRNA+as+measured+by+sucrose+density+gradients+and+primer+extension+inhibition.">Analysis of 40 S and 80 S complexes with mRNA as measured by sucrose density gradients and primer extension inhibition.</a> J Biol Chem. 267 (3), 1554-1562 (1992).</li><li>Hartz, D., McPheeters, D. S., Traut, R., Gold, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extension+inhibition+analysis+of+translation+initiation+complexes.">Extension inhibition analysis of translation initiation complexes.</a> Methods Enzymol. 164, 419-425 (1988).</li><li>Shirokikh, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+ribosome-mRNA+complexes+at+different+translation+stages.">Quantitative analysis of ribosome-mRNA complexes at different translation stages.</a> Nucleic Acids Res. 38 (3), 15 (2010).</li><li>Thakor, N., Holcik, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRES-mediated+translation+of+cellular+messenger+RNA+operates+in+eIF2alpha-+independent+manner+during+stress.">IRES-mediated translation of cellular messenger RNA operates in eIF2alpha- independent manner during stress.</a> Nucleic Acids Res. 40 (2), 541-552 (2012).</li><li>Liwak, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+suppressor+PDCD4+represses+internal+ribosome+entry+site-mediated+translation+of+antiapoptotic+proteins+and+is+regulated+by+S6+kinase+2.">Tumor suppressor PDCD4 represses internal ribosome entry site-mediated translation of antiapoptotic proteins and is regulated by S6 kinase 2.</a> Mol Cell Biol. 32 (10), 1818-1829 (2012).</li><li>Thakor, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mRNA+recruits+the+ribosome+via+eIF3-PABP+bridge+to+initiate+internal+translation.">Cellular mRNA recruits the ribosome via eIF3-PABP bridge to initiate internal translation.</a> RNA Biol. , 1-15 (2016).</li><li>Thoma, C., Bergamini, G., Galy, B., Hundsdoerfer, P., Hentze, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+IRES-mediated+translation+of+the+c-myc+and+BiP+mRNAs+by+the+poly(A)+tail+is+independent+of+intact+eIF4G+and+PABP.">Enhancement of IRES-mediated translation of the c-myc and BiP mRNAs by the poly(A) tail is independent of intact eIF4G and PABP.</a> Mol Cell. 15 (6), 925-935 (2004).</li><li>Baird, S. D., Lewis, S. M., Turcotte, M., Holcik, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+search+for+structurally+similar+cellular+internal+ribosome+entry+sites.">A search for structurally similar cellular internal ribosome entry sites.</a> Nucleic Acids Res. 35 (14), 4664-4677 (2007).</li><li>Merrick, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+that+a+single+GTP+is+used+in+the+formation+of+80+S+initiation+complexes.">Evidence that a single GTP is used in the formation of 80 S initiation complexes.</a> J Biol Chem. 254 (10), 3708-3711 (1979).</li><li>Arnaud, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+New+34-Kilodalton+Isoform+of+Human+Fibroblast+Growth+Factor+2+Is+Cap+Dependently+Synthesized+by+Using+a+Non-AUG+Start+Codon+and+Behaves+as+a+Survival+Factor.">A New 34-Kilodalton Isoform of Human Fibroblast Growth Factor 2 Is Cap Dependently Synthesized by Using a Non-AUG Start Codon and Behaves as a Survival Factor.</a> Mol Cell Biol. 19 (1), 505-514 (1999).</li><li>Dmitriev, S. E., Pisarev, A. V., Rubtsova, M. P., Dunaevsky, Y. E., Shatsky, I. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conversion+of+48S+translation+preinitiation+complexes+into+80S+initiation+complexes+as+revealed+by+toeprinting.">Conversion of 48S translation preinitiation complexes into 80S initiation complexes as revealed by toeprinting.</a> FEBS Lett. 533 (1-3), 99-104 (2003).</li><li>Faye, M. D., Graber, T. E., Holcik, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessment+of+selective+mRNA+translation+in+mammalian+cells+by+polysome+profiling.">Assessment of selective mRNA translation in mammalian cells by polysome profiling.</a> J Vis Exp. (92), e52295 (2014).</li><li>Duncan, C. D. S., Mata, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+cycloheximide+on+the+interpretation+of+ribosome+profiling+experiments+in+Schizosaccharomyces+pombe.">Effects of cycloheximide on the interpretation of ribosome profiling experiments in Schizosaccharomyces pombe.</a> Sci Rep. 7 (1), 10331 (2017).</li><li>Beck, H. J., Janssen, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+Translation+Initiation+Regulation+Mechanism+in+Escherichia+coli+ptrB+Mediated+by+a+5'-Terminal+AUG.">Novel Translation Initiation Regulation Mechanism in Escherichia coli ptrB Mediated by a 5'-Terminal AUG.</a> J Bacteriol. 199 (14), (2017).</li></ol>

The authors have no conflict-of-interest to disclose.

Toeprinting is a powerful technique to directly measure the ability of an RNA of interest to support the formation of translation initiation complexes under highly controlled circumstances. This protocol describes a simplified technique for toeprinting mammalian RNAs. Rabbit reticulocyte lysate (RRL) is used as a convenient source of ribosomes, eIFs, initiator tRNA, and IRES trans-acting factors (ITAFs). The experimenter provides their RNA of choice, and can also supplement the toeprinting reaction with specific...

As translation consumes most cellular energy, it makes sense that translation is tightly regulated1. Conversely, dysregulation of translation-and the consequent alterations in protein output-is often observed in stress-response and disease states, such as cancer1,2. A major advantage of translational control is the speed with which cells can alter their protein output in order to respond to various stimuli3. Translation regulation thus represents an important mechanism that can influence cell survival and death1,2,3. Of the steps of translation, initiation is the most highly regulated and complex3. Briefly, most eukaryotic mRNAs contain a 5&#39; m7G cap that is almost always essential for their translation. Cap-dependent initiation requires eukaryotic initiation factors eIF4E, eIF4A, and eIF4G (the cap-recognition complex) to interact with the 5&#39; end of the mRNA. The 43S preinitiation ribosome complex, which contains eIF2-bound initiator tRNA and eIF3, is recruited to the 5&#39; end of the mRNA via an interaction of eIF4G with eIF3. The preinitiation complex is thought to scan mRNA, aided by eIF4A (an RNA helicase) until the start codon (AUG) is located. The 48S initiation complex is subsequently formed and tRNA is delivered into the P-site of the ribosome. Finally, the 60S and 40S ribosome subunits are united to form the 80S initiation complex, followed by translation elongation1,3,4. In contrast, internal ribosome entry sites (IRESes) bypass the requirement for a 5&#39; cap by recruiting the 40S ribosomal subunit directly to the initiation codon3. Physiological stress conditions attenuate global mRNA translation due to modifications of key general eukaryotic initiation factors (eIFs). However, non-canonical translation initiation mechanisms allow for selective translation of certain mRNAs which often encode stress-response proteins, and dysregulation of non-canonical translation initiation is implicated in disease states like cancer1,2. Discreet RNA regulatory elements, such as cellular IRESes, allow for the translation of such mRNAs2,3.
One particularly interesting aspect of translational control is to understand mechanisms of canonical versus non-canonical translation of a given mRNA. Toeprinting is a technique that allows the detailed mechanistic study of translation initiation of specific RNAs in vitro. The overall goal of toeprinting is to assess the ability of an RNA of interest to nucleate the formation of a translation initiation complex with the ribosome under a variety of conditions, in order to determine which sequences, structural elements, or accessory factors are required for efficient translation initiation. For instance, ribosome recruitment might be hindered in the absence of a 5&#39; cap but stimulated by the presence of an IRES.
The principle of the technique is to in vitro transcribe an RNA of interest, incubate it in the presence of cellular extracts containing translation components (or the purified components) to allow initiation complexes to form, and to reverse transcribe the RNA with a specific primer. Stable RNA-ribosome complexes will cause reverse transcription to stall at the 3&#39; edge of the ribosome-the so-called &#39;toeprint&#39;5,6,7.
In this protocol, the ribosomal subunits, eIFs, tRNAs, and IRES trans-acting factors (ITAFs) are conveniently contributed by rabbit reticulocyte lysate (RRL). Another advantage of this protocol is the use of a fluorescently-labeled primer and fluorescence gel-based imager, rather than a radiolabeled primer. This eliminates extra steps, including radiolabeling the primer, as well as drying the gel and exposing it to an intensifying screen. The fluorescent bands are recorded in real time, as the gel runs, allowing for greater resolution. Uncapped X-linked inhibitor of apoptosis protein (XIAP) IRES RNA is used as an example here, although capped mRNAs can also be analyzed by this technique8.
Unlike western analysis, which measures the final output of the translation process in cell lysates, toeprinting is an in vitro approach to measure translation initiation complex formation on an RNA. This reductionist approach allows for the highly detailed study of substrates or factors that regulate translation initiation (e.g., capped or un-capped mRNA, IRES structure, presence or absence of poly-A tail, provision of specific protein factors, etc.). Hence, toeprinting can be used to study different modes of translation8 or the effects of mRNA structures, such as IRESes, on protein synthesis9,10.

<table><tbody><tr><td>DEPC (Diethyl pyrocarbonate)</td><td>Sigma</td><td>D5758-100ML</td><td></td></tr><tr><td>TRIS base, Ultrapure</td><td>JT Baker</td><td>4109-01</td><td></td></tr><tr><td>KOAc (Potassium acetate)</td><td>Bio Basic</td><td>PB0438</td><td></td></tr><tr><td>Mg(OAc)&lt;sub&gt;2&lt;/sub&gt; (Magnesium acetate tetrahydrate)</td><td>Bio Basic</td><td>MB0326</td><td></td></tr><tr><td>Sucrose, molecular biology grade</td><td>Calbiochem</td><td>573113-1KG</td><td></td></tr><tr><td>Spermidine</td><td>Sigma</td><td>85558</td><td></td></tr><tr><td>GMP-PNP (Guanosine 5&amp;prime;-[&amp;beta;,&amp;gamma;-imido]triphosphate trisodium salt hydrate) 0.1 M solution</td><td>Sigma</td><td>G0635</td><td></td></tr><tr><td>ATP (Adenosine 5&amp;prime;-triphosphate) disodium salt, 100 mM solution</td><td>Sigma</td><td>A6559</td><td></td></tr><tr><td>19:1 Acrylamide:bis-acrylamide, 40%</td><td>Bio Basic</td><td>A0006</td><td></td></tr><tr><td>Urea</td><td>Bio Basic</td><td>UB0148</td><td></td></tr><tr><td>500mL bottle top filtration units, 0.2 &amp;micro;m</td><td>Sarstedt</td><td>83.1823.101</td><td></td></tr><tr><td>Formamide</td><td>Sigma</td><td>F9037-100ML</td><td></td></tr><tr><td>EDTA (disodium salt, dihydrate)</td><td>Bio Basic</td><td>EB0185</td><td></td></tr><tr><td>SDS</td><td>Bio Basic</td><td>SB0485</td><td></td></tr><tr><td>Bromophenol blue</td><td>Bio Basic</td><td>BDB0001</td><td></td></tr><tr><td>Xylene cyanol FF</td><td>Bio Basic</td><td>XB0005</td><td></td></tr><tr><td>MEGAshortscript T7 transcription kit</td><td>Ambion</td><td>AM1354</td><td></td></tr><tr><td>mMESSAGE mMACHINE T7 transcription kit</td><td>Ambion</td><td>AM1344</td><td></td></tr><tr><td>Acid Phenol:Chloroform (5:1)</td><td>Ambion</td><td>AM9722</td><td></td></tr><tr><td>25:24:1 Phenol:Chloroform:Isoamyl Alcohol</td><td>Invitrogen</td><td>15593-049</td><td></td></tr><tr><td>Rabbit Reticulocyte Lysate (RRL). Should NOT be nuclease-treated.</td><td>Green Hectares, USA</td><td></td><td>Contact Green Hectares, ask for 1:1 RRL:water</td></tr><tr><td>RiboLock RNase Inhibitor (40 U/&amp;micro;L)</td><td>Thermo Fisher</td><td>E00382</td><td></td></tr><tr><td>100 mM dNTPs</td><td>Invitrogen</td><td>56172, 56173, 56174, 56175</td><td>Mix equal parts for a stock of 25 mM each.</td></tr><tr><td>AMV-RT, 10 U/&amp;micro;L</td><td>Promega</td><td>M5101</td><td></td></tr><tr><td>Sequenase Version 2.0 DNA Sequencing Kit</td><td>Thermo Fisher</td><td>707701KT</td><td></td></tr><tr><td>Model 4200 IR2 DNA analyzer</td><td>LI-COR</td><td></td><td>Product has been discontinued</td></tr><tr><td>APS (Ammonium Persulfate)</td><td>Bio Basic</td><td>AB0072</td><td></td></tr><tr><td>TEMED</td><td>Bio Basic</td><td>TB0508</td><td></td></tr><tr><td>Phusion High Fidelity Polymerase</td><td>New England Biolabs</td><td>M0530</td><td></td></tr><tr><td>Turbo Dnase</td><td>Thermo Fisher</td><td>AM2238</td><td></td></tr></tbody></table>

toeprinting analysis of translation initiation complex formation on mammalian mrnas

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation of protein synthesis is the key to cellular stress-response, and dysregulation is central to many disease states, such as cancer. For instance, although cellular stress leads to the inhibition of global translation by attenuating cap-dependent initiation, certain stress-response proteins are selectively translated in a cap-independent manner. Discreet RNA regulatory elements, such as cellular internal ribosome entry sites (IRESes), allow for the translation of these specific mRNAs. Identification of such mRNAs, and the characterization of their regulatory mechanisms, have been a key area in molecular biology. Toeprinting is a method for the study of RNA structure and function as it pertains to translation initiation. The goal of toeprinting is to assess the ability of in vitro transcribed RNA to form stable complexes with ribosomes under a variety of conditions, in order to determine which sequences, structural elements, or accessory factors are involved in ribosome binding&#8212;a pre-cursor for efficient translation initiation. Alongside other techniques, such as western analysis and polysome profiling, toeprinting allows for a robust characterization of mechanisms for the regulation of translation initiation.

We have previously described the ability of the XIAP IRES to support cap-independent translation initiation in vitro8,10. Toeprinting was the key technique to interrogate the mechanistic details of the XIAP IRES initiation complex. A DNA construct encoding an mRNA containing the XIAP IRES (Figure 1A) was in vitro transcribed and subjected to toeprinting analysis. The...

Watch this Scientific Journal Video about Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs at JoVE.com

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Toeprinting aims to measure the ability of in vitro transcribed RNA to form translation initiation complexes with ribosomes under a variety of conditions. This protocol describes a method for toeprinting mammalian RNA and can be used to study both cap-dependent and IRES-driven translation.

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation ...

toeprinting-analysis-translation-initiation-complex-formation-on

Research

JoVE Journal

Biochemistry

12.4K Views.  University of Lethbridge. Toeprinting wil het vermogen meten van in vitro Getranscribeerd RNA naar formulier vertaling initiatie complexen met ribosomen onder een aantal voorwaarden. Dit protocol wordt een methode beschreven voor de toeprinting zoogdieren RNA en kan worden gebruikt voor het bestuderen van de GLB-afhankelijke zowel IRES gestuurde vertaling.

Video: Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Quantitative Immunofluorescence to Measure Global Localized Translation

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and organogenesis, as well as in multiple diseases. Numerous publications have convincingly shown that specific mechanisms tightly regulate mRNA translation. Increased interest in the translation-induced regulation of protein expression has led to the development of novel methods to study and follow de novo protein synthesis in cellulo. However, most of these methods are complex, making them costly and often limiting the number of mRNA targets that can be studied. This manuscript proposes a method that requires only basic reagents and a confocal fluorescence imaging system to measure and visualize the changes in mRNA translation that occur in any cell line under various conditions. This method was recently used to show localized translation in the subcellular structures of adherent cells over a short period of time, thus offering the possibility of visualizing de novo translation for a short period during a variety of biological processes or of validating changes in translational activity in response to specific stimuli.

This manuscript describes a method to visualize and quantify localized translation events in subcellular compartments. The approach proposed in this manuscript requires a basic confocal imaging system and reagents and is rapid and cost-effective.

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and ...

Artificial RNA Polymerase II Elongation Complexes for Dissecting Co-transcriptional RNA Processing Events

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA polymerase II and co-transcriptional capping and splicing of the precursor RNA to form the mature mRNA. During mRNA synthesis, the RNA polymerase II elongation complex is a target for regulation by a large collection of transcription factors that control its catalytic activity, as well as the capping, splicing, and 3&#8217;-processing enzymes that create the mature mRNA. Because of the inherent complexity of mRNA synthesis, simpler experimental systems enabling isolation and investigation of its various co-transcriptional stages have great utility.
In this article, we describe one such simple experimental system suitable for investigating co-transcriptional RNA capping. This system relies on defined RNA polymerase II elongation complexes assembled from purified polymerase and artificial transcription bubbles. When immobilized via biotinylated DNA, these RNA polymerase II elongation complexes provide an easily manipulable tool for dissecting co-transcriptional RNA capping and mechanisms by which the elongation complex recruits and regulates capping enzyme during co-transcriptional RNA capping. We anticipate this system could be adapted for studying recruitment and/or assembly of proteins or protein complexes with roles in other stages of mRNA maturation coupled to the RNA polymerase II elongation complex.

Here, we describe the assembly of RNA polymerase II (Pol II) elongation complexes requiring only short synthetic DNA and RNA oligonucleotides and purified Pol II. These complexes are useful for studying mechanisms underlying co-transcriptional processing of transcripts associated with the Pol II elongation complex.

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA ...

Genetics

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

Cap-dependent protein synthesis is the predominant translation pathway in eukaryotic cells. While various biochemical and genetic approaches have allowed extensive studies of cap-dependent translation and its regulation, high resolution kinetic characterization of this translation pathway is still lacking. Recently, we developed an in vitro assay to measure cap-dependent translation kinetics with single-molecule resolution. The assay is based on fluorescently labeled antibody binding to nascent epitope-tagged polypeptide. By imaging the binding and dissociation of antibodies to and from nascent peptide&#8211;ribosome&#8211;mRNA complexes, the translation progression on individual mRNAs can be tracked. Here, we present a protocol for establishing this assay, including mRNA and PEGylated slide preparations, real-time imaging of translation, and analysis of single molecule trajectories. This assay enables tracking of individual cap-dependent translation events and resolves key translation kinetics, such as initiation and elongation rates. The assay can be widely applied to distinct translation systems and should broadly benefit in vitro studies of cap-dependent translation kinetics and translational control mechanisms.

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

Tracking individual translation events allows for high-resolution kinetic studies of cap-dependent translation mechanisms. Here we demonstrate an in vitro single-molecule assay based on imaging interactions between fluorescently labeled antibodies and epitope-tagged nascent peptides. This method enables single-molecule characterization of initiation and peptide elongation kinetics during active in vitro cap-dependent translation.

Cap-dependent protein synthesis is the predominant translation pathway in eukaryotic cells. While various biochemical and genetic approaches have allowed ...

In vivo Interrogation of Central Nervous System Translatome by Polyribosome Fractionation

Multiple processes are involved in gene expression including transcription, translation and stability of mRNAs and proteins. Each of these steps are tightly regulated, affecting the final dynamics of protein abundance. Various regulatory mechanisms exist at the translation step, rendering mRNA levels alone an unreliable indicator of gene expression. In addition, local regulation of mRNA translation has been particularly implicated in neuronal functions, shifting &#39;translatomics&#39; to the focus of attention in neurobiology. The presented method can be used to bridge transcriptomics and proteomics.
Here we describe essential modifications to the technique of polyribosome fractionation, which interrogates the translatome based on the association of actively translated mRNAs to multiple ribosomes and their differential sedimentation in sucrose gradients. Traditionally, working with in vivo samples, particularly of the central nervous system (CNS), has proven challenging due to the restricted amounts of material and the presence of fatty tissue components. In order to address this, the described protocol is specifically optimized for use with minimal amount of CNS material, as demonstrated by the use of single mouse spinal cord and brain. Briefly, CNS tissues are extracted and translating ribosomes are immobilized on mRNAs with cycloheximide. Myelin flotation is then performed to remove lipid rich components. Fractionation is performed on a sucrose gradient where mRNAs are separated according to their ribosomal loading. Isolated fractions are suitable for a range of downstream assays, including new genome wide assay technologies.

In vivo Interrogation of Central Nervous System Translatome by Polyribosome Fractionation

This protocol illustrates essential modifications of polyribosome fractionation in order to study the translatome of in vivo CNS samples. It allows global assessment of translation and transcription regulation through the isolation and comparison of total RNA to ribosome bound RNA fractions.

Multiple processes are involved in gene expression including transcription, translation and stability of mRNAs and proteins. Each of these steps are ...

Neuroscience

Defining the Program of Maternal mRNA Translation during In vitro Maturation using a Single Oocyte Reporter Assay

Events associated with oocyte nuclear maturation have been well described. However, much less is known about the molecular pathways and processes that take place in the cytoplasm in preparation for fertilization and acquisition of totipotency. During oocyte maturation, changes in gene expression depend exclusively on the translation and degradation of maternal messenger RNAs (mRNAs) rather than on transcription. Execution of the translational program, therefore, plays a key role in establishing oocyte developmental competence to sustain embryo development. This paper is part of a focus on defining the program of maternal mRNA translation that takes place during meiotic maturation and at the oocyte-to-zygote transition. In this method paper, a strategy is presented to study the regulation of translation of target mRNAs during in vitro oocyte maturation. Here, a Ypet reporter is fused to the 3&#39; untranslated region (UTR) of the gene of interest and then micro-injected into oocytes together with polyadenylated mRNA encoding for mCherry to control for injected volume. By using time-lapse microscopy to measure reporter accumulation, translation rates are calculated at different transitions during oocyte meiotic maturation. Here, the protocols for oocyte isolation and injection, time-lapse recording, and data analysis have been described, using the Ypet/interleukin-7 (IL-7)-3&#39; UTR reporter as an example.

This protocol describes a reporter assay to study the regulation of mRNA translation in single oocytes during in vitro maturation.

Events associated with oocyte nuclear maturation have been well described. However, much less is known about the molecular pathways and processes that ...

Developmental Biology

Isolation of Translating Ribosomes Containing Peptidyl-tRNAs for Functional and Structural Analyses

Recently, structural and biochemical studies have detailed many of the molecular events that occur in the ribosome during inhibition of protein synthesis by antibiotics and during nascent polypeptide synthesis. Some of these antibiotics, and regulatory nascent polypeptides mostly in the form of peptidyl-tRNAs, inhibit either peptide bond formation or translation termination1-7. These inhibitory events can stop the movement of the ribosome, a phenomenon termed "translational arrest". Translation arrest induced by either an antibiotic or a nascent polypeptide has been shown to regulate the expression of genes involved in diverse cellular functions such as cell growth, antibiotic resistance, protein translocation and cell metabolism8-13. Knowledge of how antibiotics and regulatory nascent polypeptides alter ribosome function is essential if we are to understand the complete role of the ribosome in translation, in every organism.
Here, we describe a simple methodology that can be used to purify, exclusively, for analysis, those ribosomes translating a specific mRNA and containing a specific peptidyl-tRNA14. This procedure is based on selective isolation of translating ribosomes bound to a biotin-labeled mRNA. These translational complexes are separated from other ribosomes in the same mixture, using streptavidin paramagnetic beads (SMB) and a magnetic field (MF). Biotin-labeled mRNAs are synthesized by run-off transcription assays using as templates PCR-generated DNA fragments that contain T7 transcriptional promoters. T7 RNA polymerase incorporates biotin-16-UMP from biotin-UTP; under our conditions approximately ten biotin-16-UMP molecules are incorporated in a 600 nt mRNA with a 25% UMP content. These biotin-labeled mRNAs are then isolated, and used in in vitro translation assays performed with release factor 2 (RF2)-depleted cell-free extracts obtained from Escherichia coli strains containing wild type or mutant ribosomes. Ribosomes translating the biotin-labeled mRNA sequences are stalled at the stop codon region, due to the absence of the RF2 protein, which normally accomplishes translation termination. Stalled ribosomes containing the newly synthesized peptidyl-tRNA are isolated and removed from the translation reactions using SMB and an MF. These beads only bind biotin-containing messages.
The isolated, translational complexes, can be used to analyze the structural and functional features of wild type or mutant ribosomal components, or peptidyl-tRNA sequences, as well as determining ribosome interaction with antibiotics or other molecular factors 1,14-16. To examine the function of these isolated ribosome complexes, peptidyl-transferase assays can be performed in the presence of the antibiotic puromycin1. To study structural changes in translational complexes, well established procedures can be used, such as i) crosslinking to specific amino acids14 and/or ii) alkylation protection assays1,14,17.

A major impediment to biochemical analyses of ribosomes containing nascent peptidyl-tRNAs has been the presence of other ribosomes in the same samples, ribosomes not involved in the translation of the specific mRNA sequence being analyzed. We developed a simple methodology to purify, exclusively, the ribosomes containing the nascent peptidyl-tRNA of interest.

Recently, structural and biochemical studies have detailed many of the molecular events that occur in the ribosome during inhibition of protein synthesis ...

Biology

Analysis of Translation Initiation During Stress Conditions by Polysome Profiling

Precise control of mRNA translation is fundamental for eukaryotic cell homeostasis, particularly in response to physiological and pathological stress. Alterations of this program can lead to the growth of damaged cells, a hallmark of cancer development, or to premature cell death such as seen in neurodegenerative diseases. Much of what is known concerning the molecular basis for translational control has been obtained from polysome analysis using a density gradient fractionation system. This technique relies on ultracentrifugation of cytoplasmic extracts on a linear sucrose gradient. Once the spin is completed, the system allows fractionation and quantification of centrifuged zones corresponding to different translating ribosomes populations, thus resulting in a polysome profile. Changes in the polysome profile are indicative of changes or defects in translation initiation that occur in response to various types of stress. This technique also allows to assess the role of specific proteins on translation initiation, and to measure translational activity of specific mRNAs. Here we describe our protocol to perform polysome profiles in order to assess translation initiation of eukaryotic cells and tissues under either normal or stress growth conditions.

Here, we describe a method to analyze changes in the initiation of mRNA translation of eukaryotic cells in response to stress conditions. This method is based on the velocity separation on sucrose gradients of translating ribosomes from non-translating ribosomes.

Precise control of mRNA translation is fundamental for eukaryotic cell homeostasis, particularly in response to physiological and pathological stress. ...

Polysome Fractionation and Analysis of Mammalian Translatomes on a Genome-wide Scale

mRNA translation plays a central role in the regulation of gene expression and represents the most energy consuming process in mammalian cells. Accordingly, dysregulation of mRNA translation is considered to play a major role in a variety of pathological states including cancer. Ribosomes also host chaperones, which facilitate folding of nascent polypeptides, thereby modulating function and stability of newly synthesized polypeptides. In addition, emerging data indicate that ribosomes serve as a platform for a repertoire of signaling molecules, which are implicated in a variety of post-translational modifications of newly synthesized polypeptides as they emerge from the ribosome, and/or components of translational machinery. Herein, a well-established method of ribosome fractionation using sucrose density gradient centrifugation is described. In conjunction with the in-house developed &#8220;anota&#8221; algorithm this method allows direct determination of differential translation of individual mRNAs on a genome-wide scale. Moreover, this versatile protocol can be used for a variety of biochemical studies aiming to dissect the function of ribosome-associated protein complexes, including those that play a central role in folding and degradation of newly synthesized polypeptides.

Ribosomes play a central role in protein synthesis. Polyribosome (polysome) fractionation by sucrose density gradient centrifugation allows direct determination of translation efficiencies of individual mRNAs on a genome-wide scale. In addition, this method can be used for biochemical analysis of ribosome- and polysome-associated factors such as chaperones and signaling molecules.

mRNA translation plays a central role in the regulation of gene expression and represents the most energy consuming process in mammalian cells. ...

Analysis of Translation in the Developing Mouse Brain using Polysome Profiling

The proper development of the mammalian brain relies on a fine balance of neural stem cell proliferation and differentiation into different neural cell types. This balance is tightly controlled by gene expression that is fine-tuned at multiple levels, including transcription, post-transcription and translation. In this regard, a growing body of evidence highlights a critical role of translational regulation in coordinating neural stem cell fate decisions. Polysome fractionation is a powerful tool for the assessment of mRNA translational status at both global and individual gene levels. Here, we present an in-house polysome profiling pipeline to assess translational efficiency in cells from the developing mouse cerebral cortex. We describe the protocols for sucrose gradient preparation, tissue lysis, ultracentrifugation and fractionation-based analysis of mRNA translational status.

The development of the mammalian brain requires proper control of gene expression at the level of translation. Here, we describe a polysome profiling system with an easy-to-assemble sucrose gradient-making and fractionation platform to assess the translational status of mRNAs in the developing brain.

The proper development of the mammalian brain relies on a fine balance of neural stem cell proliferation and differentiation into different neural cell ...

Rapid In Vivo Fixation and Isolation of Translational Complexes from Eukaryotic Cells

Rapid responses involving fast redistribution of messenger(m)RNA and alterations of mRNA translation are pertinent to ongoing homeostatic adjustments of the cells. These adjustments are critical to eukaryotic cell survivability and &#39;damage control&#39; during fluctuating nutrient and salinity levels, temperature, and various chemical and radiation stresses. Due to the highly dynamic nature of the RNA-level responses, and the instability of many of the RNA:RNA and RNA:protein intermediates, obtaining a meaningful snapshot of the cytoplasmic RNA state is only possible with a limited number of methods. Transcriptome-wide, RNA-seq-based ribosome profiling-type experiments are among the most informative sources of data for the control of translation. However, absence of a uniform RNA and RNA:protein intermediate stabilization can lead to different biases, particularly in the fast-paced cellular response pathways. In this article, we provide a detailed protocol of rapid fixation applicable to eukaryotic cells of different permeability, to aid in RNA and RNA:protein intermediate stabilization. We further provide examples of isolation of the stabilized RNA:protein complexes based on their co-sedimentation with ribosomal and poly(ribo)somal fractions. The separated stabilized material can be subsequently used as part of ribosome profiling-type experiments, such as in Translation Complex Profile sequencing (TCP-seq) approach and its derivatives. Versatility of the TCP-seq-style methods has now been demonstrated by the applications in a variety of organisms and cell types. The stabilized complexes can also be additionally affinity-purified and imaged using electron microscopy, separated into different poly(ribo)somal fractions and subjected to RNA sequencing, owing to the ease of the crosslink reversal. Therefore, methods based on snap-chilling and formaldehyde fixation, followed by the sedimentation-based or other type of RNA:protein complex enrichment, can be of particular interest in investigating finer details of rapid RNA:protein complex dynamics in live cells.

Rapid In Vivo Fixation and Isolation of Translational Complexes from Eukaryotic Cells

We present a technique to rapidly stabilize translational (protein biosynthesis) complexes with formaldehyde crosslinking in live yeast and mammalian cells. The approach enables dissecting transient intermediates and dynamic RNA:protein interactions. The crosslinked complexes can be used in multiple downstream applications such as in deep sequencing-based profiling methods, microscopy, and mass-spectrometry.

Rapid responses involving fast redistribution of messenger(m)RNA and alterations of mRNA translation are pertinent to ongoing homeostatic adjustments of ...

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video