We would like to acknowledge the laboratory of Lane Christenson for providing the digital PCR machine used in these experiments and for the technical support provided. We would also like to thank Dr. Thomas Yankee for his guidance and mentorship. These studies were supported by the Tripp Family Foundation.

All mouse experiments were performed in compliance, and with approval from, the University of Kansas Medical Center Institutional Animal Care and Use Committee. All healthy human blood samples were obtained under informed consent and with approval from the Institutional Review Board at the University of Kansas Medical Center.
1. Irradiation of NSG Mice
<ol>
	<li>One day prior to PBMC injection, irradiate 8&#8211;12-week old NSG mice (either sex can be used). In a sterile biosafety cabinet, place mice in a sterilized pie cage or microisolator. Irradiate mice in a Cs137 source or small animal irradiator (e.g., RS 2000) with a total dose of 150 cGy with slow rotation to ensure even irradiation.</li>
	<li>Place mice into clean cages in a sterile biosafety cabinet.</li>
</ol>
2. Preparation of human PBMC for injection
<ol>
	<li>Collect enough healthy human blood to isolate 1.1 x 107 PBMC per mouse. Dilute the heparinized blood in an equal volume of 2% fetal bovine serum (FBS) in phosphate buffered saline (PBS). 
	NOTE: With this protocol, the PMBC yield is generally 0.5&#8211;1 x 107 per 10 mL of whole blood. Each mouse will receive 107 PBMC in 100 &#181;L of PBS. The extra 1 x 106 in 10 &#181;L per mouse ensures that each mouse receives the full dosage of PBMC, should there be any issues with filling syringes.</li>
	<li>Add 15 mL lymphocyte separation density gradient medium (e.g., Ficoll) to a 50 mL conical tube and then carefully overlay up to 25 mL of diluted blood on top of the density gradient. Centrifuge the tube containing density gradient and diluted blood at 400 x g for 40 min at room temperature without brake.</li>
	<li>Harvest the PBMC interface into 10 mL of PBS in a 50 mL conical tube. Centrifuge the cells at 400 x g for 10 min. Remove the supernatant.</li>
	<li>Loosen pellet by flicking tube and resuspend in 10 mL PBS to wash the PBMC. Centrifuge the cells at 400 x g for 5 min.</li>
	<li>(Optional) Discard the supernatant and lyse red blood cells (RBCs) in the cell pellet by adding a volume of Ammonium-Chloride-Potassium (ACK) lysis buffer that is equal to the pellet volume. Gently resuspend the pellet and swirl the tube for 30&#8211;60 s. Fill tube with serum-free RPMI media and centrifuge the tube at 400 x g for 5 min.</li>
	<li>Remove the supernatant and re-suspend the cell pellet in 5 mL of PBS. Count the cells using trypan blue exclusion with a hemocytometer and a microscope.</li>
	<li>Centrifuge the cells at 400 x g for 5 min. Remove the supernatant and resuspend cells at 1 x 108 cells/mL in PBS.</li>
</ol>
3. Retro-orbital injection of human PBMC into mice21
<ol>
	<li>Place an anesthesia chamber in a laminar flow hood to maintain sterility. Pre-charge the anesthesia chamber with 5% isoflurane and 1 L/min oxygen flow rate for 5 min.</li>
	<li>Reduce isoflurane to 2% and put mice from the same cage into the anesthesia chamber. Once mice lose righting, anesthetize mice for 5 min in chamber. During this time, pre-fill syringe with 100 &#181;L (1 x 107 cells) of cell suspension.</li>
	<li>Place mouse on a heating pad with its nose in a nose cone to maintain anesthesia. Check for loss of consciousness by pinching a foot pad and checking for lack of reflex.</li>
	<li>Restrain mouse with the thumb and middle finger. Insert the 28 G 1/2 in needle with the bevel down lateral to the medial canthus, through the conjunctival membrane until the back of the eye is reached. Slightly retract the needle and slowly inject 100 &#956;L of cells (1 x 107 cells).</li>
	<li>Fully retract the needle and properly dispose of the syringe and needle. Close the eyelid and apply mild pressure to the injection site with a gauze sponge.</li>
	<li>Examine the injection site for swelling or other visible trauma. Allow the mouse to regain consciousness in a sterile cage lined with paper towels to prevent aspiration of bedding before moving to home cage.&#160;After any bleeding has stopped, apply a single drop of proparacaine to the eye for analgesia. 
	NOTE: Tail vein injection is an alternative method of intravenous injection of PBMC for this protocol as described by Macholz et al.22.</li>
</ol>
4. Clinical Scoring of acute GVHD in Mice (Figure 1)23
<ol>
	<li>Measure GVHD score every other day until mice reach a score of a 2 and then every day until day of sacrifice.
	<ol>
		<li>Place the cage in a laminar flow hood, remove the food and water and put the lid back on. Score activity by observing mice for 5 min and assign scores as follows: 0 = mouse starts walking within a couple minutes and keeps walking around cage, 1 = mouse takes a more than a couple minutes to get up and walks slowly around cage, 2 = mouse doesn&#8217;t get up in 5 min and only walks when touched.</li>
	</ol>
	</li>
	<li>Weigh each mouse in a glass beaker and give a weight loss score: 0 = &#60;10% change, 1 = 10&#8211;25% change and 2 = &#62;25% change.</li>
	<li>While the mouse is still in the beaker, inspect for posture: 0 = normal, 1 = hunching at rest, 2 = hunching impairs movement; fur texture: 0 = normal, 1 = mild to moderate ruffling, 2 = severe ruffling, and skin integrity : 0 = normal, 1 = scaling of paws/tail, 2 = obvious areas of denuded skin (look at ears, tail and paws for scaling).</li>
	<li>With five categories and a score of 0&#8211;2 for each category, a mouse can reach a maximum score of 10. When a mouse reaches a score of 7 or greater or reaches 42 days post-injection, euthanize mouse via CO2 euthanasia or other method approved by the local Institutional Animal Care and Use Committee. 
	NOTE: To ensure accuracy of results, the scoring is performed by a researcher who is blinded to the treatment groups24. Additionally, although &#62;20% of body weight loss is the recommended humane endpoint for many IACUC protocols, with additional justification IACUC approval of this protocol can be obtained.</li>
</ol>
5. Harvesting tissues for genomic DNA from euthanized mice and isolating genomic DNA
<ol>
	<li>Dissect mice using sterile surgical tools. Cut a small piece of tissue about 3 mm x 0.5 mm in size from an organ of interest, e.g., lung, liver, or spleen. Weigh the tissue sample and place the tissue piece in a sterile 1.5 mL tube. If collecting multiple tissues, wash tools with ethanol between cutting each organ.</li>
	<li>Freeze tissues by submerging the tubes containing the tissue in liquid nitrogen until it stops bubbling and store in -80 &#176;C overnight. Thaw the tissue samples and lyse them according to a genomic DNA (gDNA) isolation kit.</li>
	<li>Isolate genomic DNA according to manufacturer&#8217;s instructions as described in the kit. Be sure to note the amount of tissue that was processed per microliter of eluted gDNA (mg/&#956;L). 
	NOTE: Frozen tissues can be stored at -80 &#176;C for processing at a later time.</li>
</ol>
6. Quantification of human T cells using digital PCR (Figure 2)
<ol>
	<li>Prepare digital PCR reactions according to the protocol for DNA binding dyes for the digital PCR machine being used. Use the following primers specific for human CD3 epsilon genomic DNA (NCBI Reference Sequence: NG_007383.1); Forward Primer: AGGCTGCCTTAACTCCCAAG, Reverse Primer: GCCCTACCAGCTGTGGAAAC. These primers will yield a single band of 105 bp. 
	NOTE: Add 0.5 &#956;L of a restriction enzyme, such as HindIII, to each reaction to digest the genomic DNA. Be sure to test out different gDNA dilutions to optimize separation of positive and negative droplets. Additionally, a subset of infiltrating T cells may be non-pathogenic regulatory T cells. These cells can be quantified using additional primers for regulatory T cell markers.</li>
	<li>Carry out the digital PCR reaction under the following conditions: Lid at 105 &#176;C, 95 &#176;C for 10 min (1 cycle); 95 &#176;C for 30 s, ramp 2 &#176;C/s and 55 &#176;C for 1 min, ramp 2 &#176;C/s (40 cycles); 72 &#176;C for 10 min, 12 &#176;C hold. 
	NOTE: These parameters may need to be adjusted depending on digital PCR equipment.</li>
	<li>Acquire digital PCR data with analysis software. Report data as numbers of copies per mg of tissue using the following equation: (number of copies/&#956;L) x (&#956;L of gDNA in reaction) x (dilution factor)/(mg of tissue/&#956;L of total gDNA )</li>
</ol>

<ol>
	<li>Jagasia, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Risk+factors+for+acute+GVHD+and+survival+after+hematopoietic+cell+transplantation.">Risk factors for acute GVHD and survival after hematopoietic cell transplantation.</a> Blood. 119 (1), 296-307 (2012).</li><li>Bolanos-Meade, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phase+3+clinical+trial+of+steroids/mycophenolate+mofetil+vs+steroids/placebo+as+therapy+for+acute+GVHD:+BMT+CTN+0802.">Phase 3 clinical trial of steroids/mycophenolate mofetil vs steroids/placebo as therapy for acute GVHD: BMT CTN 0802.</a> Blood. 124 (22), 3221-3227 (2014).</li><li>Gooley, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduced+mortality+after+allogeneic+hematopoietic-cell+transplantation.">Reduced mortality after allogeneic hematopoietic-cell transplantation.</a> New England Journal of Medicine. 363 (22), 2091-2101 (2010).</li><li>Hahn, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Significant+improvement+in+survival+after+allogeneic+hematopoietic+cell+transplantation+during+a+period+of+significantly+increased+use,+older+recipient+age,+and+use+of+unrelated+donors.">Significant improvement in survival after allogeneic hematopoietic cell transplantation during a period of significantly increased use, older recipient age, and use of unrelated donors.</a> Journal of Clinical Oncology. 31 (19), 2437-2449 (2013).</li><li>Khoury, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+survival+after+acute+graft-versus-host+disease+diagnosis+in+the+modern+era.">Improved survival after acute graft-versus-host disease diagnosis in the modern era.</a> Haematologica. 102 (5), 958-966 (2017).</li><li>King, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+peripheral+blood+leucocyte+non-obese+diabetic-severe+combined+immunodeficiency+interleukin-2+receptor+gamma+chain+gene+mouse+model+of+xenogeneic+graft-versus-host-like+disease+and+the+role+of+host+major+histocompatibility+complex.">Human peripheral blood leucocyte non-obese diabetic-severe combined immunodeficiency interleukin-2 receptor gamma chain gene mouse model of xenogeneic graft-versus-host-like disease and the role of host major histocompatibility complex.</a> Clinical &amp; Experimental Immunology. 157 (1), 104-118 (2009).</li><li>Lucas, P. J., Shearer, G. M., Neudorf, S., Gress, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+antimurine+xenogeneic+cytotoxic+response.+I.+Dependence+on+responder+antigen-presenting+cells.">The human antimurine xenogeneic cytotoxic response. I. Dependence on responder antigen-presenting cells.</a> Journal of Immunology. 144 (12), 4548-4554 (1990).</li><li>Ito, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+sensitive+model+for+xenogenic+GVHD+using+severe+immunodeficient+NOG+mice.">Highly sensitive model for xenogenic GVHD using severe immunodeficient NOG mice.</a> Transplantation. 87 (11), 1654-1658 (2009).</li><li>Kawasaki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+Analysis+of+the+Activation+and+Proliferation+Kinetics+and+Effector+Functions+of+Human+Lymphocytes,+and+Antigen+Presentation+Capacity+of+Antigen-Presenting+Cells+in+Xenogeneic+Graft-Versus-Host+Disease.">Comprehensive Analysis of the Activation and Proliferation Kinetics and Effector Functions of Human Lymphocytes, and Antigen Presentation Capacity of Antigen-Presenting Cells in Xenogeneic Graft-Versus-Host Disease.</a> Biology of Blood and Marrow Transplantation. 24 (8), 1563-1574 (2018).</li><li>Ito, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Novel+Xenogeneic+Graft-Versus-Host+Disease+Model+for+Investigating+the+Pathological+Role+of+Human+CD4(+)+or+CD8.">A Novel Xenogeneic Graft-Versus-Host Disease Model for Investigating the Pathological Role of Human CD4(+) or CD8.</a> T Cells Using Immunodeficient NOG Mice. American Journal of Transplantation. 17 (5), 1216-1228 (2017).</li><li>Trotta, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+anti-IL-2+antibody+that+potentiates+regulatory+T+cells+by+a+structure-based+mechanism.">A human anti-IL-2 antibody that potentiates regulatory T cells by a structure-based mechanism.</a> Nature Medicine. 24 (7), 1005-1014 (2018).</li><li>Dijke, I. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discarded+Human+Thymus+Is+a+Novel+Source+of+Stable+and+Long-Lived+Therapeutic+Regulatory+T+Cells.">Discarded Human Thymus Is a Novel Source of Stable and Long-Lived Therapeutic Regulatory T Cells.</a> American Journal of Transplantation. 16 (1), 58-71 (2016).</li><li>Huang, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+Gingiva-Derived+Mesenchymal+Stem+Cells+Inhibit+Xeno-Graft-versus-Host+Disease+via+CD39-CD73-Adenosine+and+IDO+Signals.">Human Gingiva-Derived Mesenchymal Stem Cells Inhibit Xeno-Graft-versus-Host Disease via CD39-CD73-Adenosine and IDO Signals.</a> Frontiers in Immunology. 8, 68 (2017).</li><li>Stockis, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blocking+immunosuppression+by+human+Tregs+in+vivo+with+antibodies+targeting+integrin+alphaVbeta8.">Blocking immunosuppression by human Tregs in vivo with antibodies targeting integrin alphaVbeta8.</a> Proceedings of the National Academy of Sciences of the United States of America. 114 (47), E10161-E10168 (2017).</li><li>Vogelstein, B., Kinzler, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR.">Digital PCR.</a> Proceedings of the National Academy of Sciences of the United States of America. 96 (16), 9236-9241 (1999).</li><li>Quan, P. L., Sauzade, M., Brouzes, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=dPCR:+A+Technology+Review.">dPCR: A Technology Review.</a> Sensors (Basel). 18 (4), (2018).</li><li>Sykes, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitation+of+targets+for+PCR+by+use+of+limiting+dilution.">Quantitation of targets for PCR by use of limiting dilution.</a> Biotechniques. 13 (3), 444-449 (1992).</li><li>Ma, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Bacterial+Contamination+in+Goat+Milk+Powder+Using+PacBio+Single+Molecule+Real-Time+Sequencing+and+Droplet+Digital+PCR.">Evaluation of Bacterial Contamination in Goat Milk Powder Using PacBio Single Molecule Real-Time Sequencing and Droplet Digital PCR.</a> Journal of Food Protection. , 1791-1799 (2018).</li><li>Vitale, S. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+optimized+workflow+to+evaluate+estrogen+receptor+gene+mutations+in+small+amounts+of+cell-free+DNA.">An optimized workflow to evaluate estrogen receptor gene mutations in small amounts of cell-free DNA.</a> Journal of Molecular Diagnostics. , (2018).</li><li>Gorgannezhad, L., Umer, M., Islam, M. N., Nguyen, N. T., Shiddiky, M. J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+tumor+DNA+and+liquid+biopsy:+opportunities,+challenges,+and+recent+advances+in+detection+technologies.">Circulating tumor DNA and liquid biopsy: opportunities, challenges, and recent advances in detection technologies.</a> Lab Chip. 18 (8), 1174-1196 (2018).</li><li>Yardeni, T., Eckhaus, M., Morris, H. D., Huizing, M., Hoogstraten-Miller, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retro-orbital+injections+in+mice.">Retro-orbital injections in mice.</a> LabAnimal. 40 (5), 155-160 (2011).</li><li>Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Manual+restraint+and+common+compound+administration+routes+in+mice+and+rats.">Manual restraint and common compound administration routes in mice and rats.</a> Journal of Visualized Experiments. (67), (2012).</li><li>Cooke, K. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+experimental+model+of+idiopathic+pneumonia+syndrome+after+bone+marrow+transplantation:+I.+The+roles+of+minor+H+antigens+and+endotoxin.">An experimental model of idiopathic pneumonia syndrome after bone marrow transplantation: I. The roles of minor H antigens and endotoxin.</a> Blood. 88 (8), 3230-3239 (1996).</li><li>Weisdorf, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prospective+grading+of+graft-versus-host+disease+after+unrelated+donor+marrow+transplantation:+a+grading+algorithm+versus+blinded+expert+panel+review.">Prospective grading of graft-versus-host disease after unrelated donor marrow transplantation: a grading algorithm versus blinded expert panel review.</a> Biology of Blood and Marrow Transplantation. 9 (8), 512-518 (2003).</li><li>Nervi, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Factors+affecting+human+T+cell+engraftment,+trafficking,+and+associated+xenogeneic+graft-vs-host+disease+in+NOD/SCID+beta2mnull+mice.">Factors affecting human T cell engraftment, trafficking, and associated xenogeneic graft-vs-host disease in NOD/SCID beta2mnull mice.</a> Experimental Hematology. 35 (12), 1823-1838 (2007).</li><li>Leon-Rico, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+haematopoietic+stem+cell+engraftment+through+the+retro-orbital+venous+sinus+and+the+lateral+vein:+alternative+routes+for+bone+marrow+transplantation+in+mice.">Comparison of haematopoietic stem cell engraftment through the retro-orbital venous sinus and the lateral vein: alternative routes for bone marrow transplantation in mice.</a> LabAnimal. 49 (2), 132-141 (2015).</li><li>Ali, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xenogeneic+graft-versus-host-disease+in+NOD-scid+IL-2Rgammanull+mice+display+a+T-effector+memory+phenotype.">Xenogeneic graft-versus-host-disease in NOD-scid IL-2Rgammanull mice display a T-effector memory phenotype.</a> PLoS One. 7 (8), e44219 (2012).</li><li>van Rijn, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+xenograft+model+for+graft-versus-host+disease+by+intravenous+transfer+of+human+peripheral+blood+mononuclear+cells+in+RAG2-/-+gammac-/-+double-mutant+mice.">A new xenograft model for graft-versus-host disease by intravenous transfer of human peripheral blood mononuclear cells in RAG2-/- gammac-/- double-mutant mice.</a> Blood. 102 (7), 2522-2531 (2003).</li><li>Wunderlich, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=OKT3+prevents+xenogeneic+GVHD+and+allows+reliable+xenograft+initiation+from+unfractionated+human+hematopoietic+tissues.">OKT3 prevents xenogeneic GVHD and allows reliable xenograft initiation from unfractionated human hematopoietic tissues.</a> Blood. 123 (24), e134-e144 (2014).</li><li>Schroeder, M. A., DiPersio, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+of+graft-versus-host+disease:+advances+and+limitations.">Mouse models of graft-versus-host disease: advances and limitations.</a> Disease Models &amp; Mechanisms. 4 (3), 318-333 (2011).</li><li>Zeiser, R., Blazar, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preclinical+models+of+acute+and+chronic+graft-versus-host+disease:+how+predictive+are+they+for+a+successful+clinical+translation?.">Preclinical models of acute and chronic graft-versus-host disease: how predictive are they for a successful clinical translation?.</a> Blood. 127 (25), 3117-3126 (2016).</li></ol>

No conflicts of interest declared.

Disease progression is generally consistent in the xenoGVHD model, even with injection of PBMC from different donors, so multiple experiments can be combined. The key steps required to maintain this consistency are proper i.v. injection technique, blinding and consistent scoring. A study by Nervi et al.25 demonstrated that compared to intravenous tail vein injection, retro-orbital injections of PBMC resulted in more consistent engraftment and more severe GVHD. Leon-Rico et al.26<...

Allogeneic hematopoietic stem cell transplant (HSCT) has become routine treatment for patients suffering from hematological malignancies such as leukemia with poor prognosis. A significant complication of HSCT is acute graft-versus-host disease (GVHD). A 2012 study reported that acute GVHD developed in 39% of HSCT patients receiving transplants from sibling donors and 59% of patients receiving transplants from unrelated donors1. Acute GVHD occurs when donor-derived T cells attack recipient&#8217;s organs. The only successful therapy for GVHD is treatment with highly immunosuppressive drugs2, which are highly toxic and increase the risk of infection and tumor recurrence. Thus, despite improvements that have been made in acute GVHD survival in recent years3,4,5, there is still a critical need for improved GVHD therapies with minimal toxicity that promote long-term remission.
The overall goal of the following methods is to induce and score xenogeneic GVHD (xenoGVHD). The xenoGVHD model was developed as a tool to induce acute GVHD with human cells rather than murine cells allowing for more direct translation of pre-clinical GVHD research to clinical trials6. This model involves intravenously injecting human peripheral blood mononuclear cells (PBMC) into NOD-SCID IL-2R&#947;null (NSG) mice that are sublethally irradiated. Injected human T cells are activated by human antigen presenting cells (APCs) presenting murine antigen and the activated T cells migrate to distant tissues resulting in systemic inflammation and ultimately death6,7,8,9,10. Disease pathology and progression in the xenoGVHD model closely mimic human acute GVHD. Specifically, the pathogenic human T cells are reactive to murine major histocompatibility complex (MHC) proteins, which is similar to the T cell alloreactivity in human GVHD6,9. The primary advantage of the xenoGVHD model over the mouse MHC-mismatch model, the other widely used GVHD model, is it allows for testing of therapies on human cells rather than murine cells. This allows for testing of products that can directly be translated to the clinic without any modifications because they are made to target human cells. Recently, this model has been used to test a human anti-IL-2 antibody11, human thymic regulatory T cells (Tregs)12 and human mesenchymal stem cells13 as potential treatments for acute GVHD. In a wider context, this model can be used as an in vivo suppression assay for any drug or cell type that can suppress human T cell activity. For example, Stockis et al.14 used the xenoGVHD model to study the effect of blocking integrin &#945;V&#946;8 on Treg suppressive activity in vivo. Thus, the xenoGVHD model can provide insight into the mechanism of any therapy targeting T cells in an in vivo setting.
An additional method described in this protocol is how to detect human T cells in mouse tissues using digital polymerase chain reaction (dPCR). The goal of this method is to offer a tool to quantify migration and proliferation of T cells in target tissues, which measure efficacy of immunosuppressive therapies being tested in this model. dPCR is a relatively novel method for quantification of nucleic acids15. Briefly, the PCR reaction mixture is divided into partitions that contain small numbers of the target sequence or no target at all. The target sequence is then amplified and detected using DNA intercalating dyes or fluorescent target-specific probes. dPCR quantifies the number of copies of target sequence based on the fraction of positive partitions and Poisson&#8217;s statistics15,16. Detecting T cells with dPCR requires much less tissue compared with other alternative methods, including flow cytometry and histology, and can be performed on frozen or fixed tissue. dPCR does not require a standard curve to determine copy numbers, nor are technical replicates required. This reduces the amount of reagent and template DNA needed for dPCR compared to traditional quantitative PCR (qPCR)16. Partitioning the PCR reaction into sub-reactions in dPCR effectively concentrates targets17. Thus, dPCR is primarily a tool for detection of rare targets in a large amount of non-target DNA. For example, dPCR is being used to detect bacterial contamination in milk18, identify rare mutations in the estrogen receptor gene19, and detect circulating tumor DNA in the blood of patients20. In this protocol, dPCR serves as an efficient tool for detecting and quantifying human T cells in tissues of mice with xenoGVHD.

<table><tbody><tr><td>1.5 mL eppendorf tubes</td><td>Fisher</td><td>05-408-129</td><td></td></tr><tr><td>10 mL serological pipet</td><td>VWR International</td><td>89130-898</td><td></td></tr><tr><td>10mL BD Vacutainers - Green capped with Sodium Heparin</td><td>Becton Dickinson</td><td>366480</td><td></td></tr><tr><td>250 &amp;micro;L Ranin pipette tips</td><td>Rainin</td><td>17001118</td><td>Do not use other pipettes or pipet tips for droplet generation</td></tr><tr><td>50 mL conical tube</td><td>VWR International</td><td>89039-656</td><td></td></tr><tr><td>96-Well ddPCR plate</td><td>Bio-Rad</td><td>12001925</td><td></td></tr><tr><td>ACK (Ammonium-Chloride-Potassium) Lysing Buffer</td><td>Lonza</td><td>10-548E</td><td>Optional</td></tr><tr><td>Alcohol Wipes</td><td>Fisher Scientific</td><td>6818</td><td></td></tr><tr><td>Anesthesia Chamber</td><td>World Precision Instruments</td><td>EZ-178</td><td>Provided by animal facility</td></tr><tr><td>Anesthesia Machine</td><td>Parkland Scientific</td><td>PM1002</td><td>Provided by animal facility</td></tr><tr><td>BD Vacutainer Safety-Lok Blood Collection Set</td><td>Becton Dickinson</td><td>367281</td><td></td></tr><tr><td>DG8 Cartridges and Gaskets for QX100/QX200 Droplet Generator</td><td>Bio-Rad</td><td>1864007</td><td></td></tr><tr><td>DNAse and RNAse free Molecular Grade H2O</td><td>Life Technologies</td><td>1811318</td><td></td></tr><tr><td>Ethyl alcohol, Pure,200 proof, for molecular biology</td><td>Sigma-Aldrich</td><td>E7023-500ML</td><td></td></tr><tr><td>Fetal Bovine Serum</td><td>Atlanta Biologicals</td><td>S11150</td><td></td></tr><tr><td>Ficoll</td><td>Fisher Scientific</td><td>45001750</td><td></td></tr><tr><td>Insulin Syringe</td><td>Fisher Scientific</td><td>329424</td><td></td></tr><tr><td>Isoflurane</td><td>Sigma-Aldrich</td><td>CDS019936</td><td>Provided by animal facility</td></tr><tr><td>Liquid nitrogen</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>Mouse Irradiator Pie Cage</td><td>Braintree Scientific, Inc.</td><td>MPC 1</td><td>Holds up to 11 mice</td></tr><tr><td>Nexcare Gentle Paper Tape (a.k.a. 3M Micropore Surgical Tape / 3/4&quot;)</td><td>Fisher Scientific</td><td>19-027-761</td><td></td></tr><tr><td>P1000 pipetman</td><td>MidSci</td><td>A-1000</td><td></td></tr><tr><td>P200 pipetman</td><td>MidSci</td><td>A-200</td><td></td></tr><tr><td>Pierceable Foil Heat Seal</td><td>Bio-Rad</td><td>1814040</td><td></td></tr><tr><td>Pipetaid Gilson Macroman</td><td>Fisher Scientific</td><td>F110756</td><td></td></tr><tr><td>Pipet-Lite Multi Pipette L8-200XLS+</td><td>Rainin</td><td>17013805</td><td>Do not use other pipettes or pipet tips for droplet generation</td></tr><tr><td>Qiagen DNeasy Blood and Tissue Kit</td><td>Qiagen</td><td>69506</td><td></td></tr><tr><td>qPCR plates</td><td>VWR International</td><td>89218-292</td><td></td></tr><tr><td>QX200 Droplet Digital PCR System</td><td>Bio-Rad</td><td>12001925</td><td>Includes droplet generator, droplet reader, laptop computer, software, associated component consumables, for EvaGreen or probe-based digital PCR applications</td></tr><tr><td>QX200 Droplet Generation Oil for EvaGreen</td><td>Bio-Rad</td><td>1864006</td><td></td></tr><tr><td>QX200 ddPCR EvaGreen Supermix</td><td>Bio-Rad</td><td>1864033</td><td></td></tr><tr><td>RNase and DNase-free plate seal</td><td>Thermo Scientific</td><td>12565491</td><td></td></tr><tr><td>RPMI Advanced 1640</td><td>Life Technologies</td><td>12633012</td><td></td></tr><tr><td>Sterile Gauze Pads (2&quot; x 2&quot;, 12-Ply)</td><td>Fisher Scientific</td><td>67522</td><td></td></tr><tr><td>Sterile Phosphate Buffered Saline</td><td>Fisher Scientific</td><td>21040CV</td><td></td></tr><tr><td>Sterile reservoir</td><td>VWR International</td><td>89094-662</td><td></td></tr><tr><td>Surgial Scissors</td><td>Kent Scientific</td><td>INS600393-4</td><td></td></tr><tr><td>Surgical Forceps</td><td>Kent Scientific</td><td>INS650914-4</td><td></td></tr></tbody></table>

induction and scoring of graft-versus-host disease in a xenogeneic murine model and quantification of human t cells in mouse tissues using digital pcr

Acute graft-versus-host disease (GVHD) is a significant limitation for patients receiving hematopoietic stem cell transplant as therapy for hematological deficiencies and malignancies. Acute GVHD occurs when donor T cells recognize host tissues as a foreign antigen and mount an immune response to the host. Current treatments involve toxic immunosuppressive drugs that render patients susceptible to infection and recurrence. Thus, there is ongoing research to provide an acute GVHD therapy that can effectively target donor T cells and reduce side effects. Much of this pre-clinical work uses the xenogenic GVHD (xenoGVHD) murine model that allows for testing of immunosuppressive therapies on human cells rather than murine cells in an in vivo system. This protocol outlines how to induce xenoGVHD and how to blind and standardize clinical scoring to ensure consistent results. Additionally, this protocol describes how to use digital PCR to detect human T cells in mouse tissues, which can subsequently be used to quantify efficacy of tested therapies. The xenoGVHD model not only provides a model to test GVHD therapies but any therapy that can suppress human T cells, which could then be applied to many inflammatory diseases.

Sublethally irradiated 8-12-week old NSG mice of both sexes that received human PBMC started displaying clinical signs of GVHD around day 10 post injection compared to negative control mice that received PBS only (Figure 1A). XenoGVHD mice had a median survival of 23.5 days (Figure 1B). With digital PCR, CD3 epsilon positive human T cells could be detected in the lung and liver samples of mice that received human PBMC. Tissue sam...

Watch this Scientific Journal Video about Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR at JoVE

Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR

Here, we present a protocol to induce and score disease in a xenogeneic graft-versus-host disease (xenoGVHD) model. xenoGVHD provides an in vivo model to study immunosuppression of human T cells. Additionally, we describe how to detect human T cells in tissues with digital PCR as a tool to quantify immunosuppression.

Acute graft-versus-host disease (GVHD) is a significant limitation for patients receiving hematopoietic stem cell transplant as therapy for hematological ...

induction-scoring-graft-versus-host-disease-xenogeneic-murine-model

Research

JoVE Journal

Immunology and Infection

7.0K Views.  University of Kansas Medical Center. Dit protocol beschrijft hoe xenograft-versus-host ziekte, of xenoGVHD induceren, en hoe klinische scores blind en standaardiseren om consistente resultaten te garanderen. Het xenoGVHD-model biedt een in vivo methode voor het testen van immunosuppressieve therapieën tegen menselijke in plaats van murine T-cellen, waardoor de vertaling van deze studies naar de kliniek wordt verbeterd. Het aantonen van de procedure zal Amara Seng zijn, een afgestudeerde student van mijn laboratorium.Een ...

Video: Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR

Induction of Graft-versus-host Disease and In Vivo T Cell Monitoring Using an MHC-matched Murine Model

Graft-versus-host disease (GVHD) is the limiting barrier to the broad use of bone marrow transplant as a curative therapy for a variety of hematological deficiencies. GVHD is caused by mature alloreactive T cells present in the bone marrow graft that are infused into the recipient and cause damage to host organs. However, in mice, T cells must be added to the bone marrow inoculum to cause GVHD. Although extensive work has been done to characterize T cell responses post transplant, bioluminescent imaging technology is a non-invasive method to monitor T cell trafficking patterns in vivo. 
Following lethal irradiation, recipient mice are transplanted with bone marrow cells and splenocytes from donor mice. T cell subsets from L2G85.B6 (transgenic mice that constitutively express luciferase) are included in the transplant. By only transplanting certain T cell subsets, one is able to track specific T cell subsets in vivo, and based on their location, develop hypotheses regarding the role of specific T cell subsets in promoting GVHD at various time points. At predetermined intervals post transplant, recipient mice are imaged using a Xenogen IVIS CCD camera. Light intensity can be quantified using Living Image software to generate a pseudo-color image based on photon intensity (red = high intensity, violet = low intensity). 
Between 4-7 days post transplant, recipient mice begin to show clinical signs of GVHD. Cooke et al.1 developed a scoring system to quantitate disease progression based on the recipient mice fur texture, skin integrity, activity, weight loss, and posture. Mice are scored daily, and euthanized when they become moribund. Recipient mice generally become moribund 20-30 days post transplant. 
Murine models are valuable tools for studying the immunology of GVHD. Selectively transplanting particular T cell subsets allows for careful identification of the roles each subset plays. Non-invasively tracking T cell responses in vivo adds another layer of value to murine GVHD models.

Induction of Graft-versus-host Disease and In Vivo T Cell Monitoring Using an MHC-matched Murine Model

Murine bone marrow transplantation is a widely used technique to study immunological mechanisms governing graft-versus-host disease in humans. The ability to monitor T cell trafficking patterns in vivo allows for detailed analysis of the development and perpetuation of T cell responses during graft-versus-host disease.

Graft-versus-host disease (GVHD) is the limiting barrier to the broad use of bone marrow transplant as a curative therapy for a variety of hematological ...

A Human Peripheral Blood Mononuclear Cell (PBMC) Engrafted Humanized Xenograft Model for Translational Immuno-oncology (I-O) Research

The discovery and development of immuno-oncology (I-O) therapy in recent years represents a milestone in the treatment of cancer. However, treatment challenges persist. Robust and disease-relevant animal models are vital resources for continued preclinical research and development in order to address a range of additional immune checkpoints. Here, we describe a human peripheral blood mononuclear cell (PBMC) &#8212; based humanized xenograft model. BGB-A317 (Tislelizumab), an investigational humanized anti-PD-1 antibody in late-stage clinical development, is used as an example to discuss platform set-up, model characterization and drug efficacy evaluations. These humanized mice support the growth of most human tumors tested, thus allowing the assessment of I-O therapies in the context of both human immunity and human cancers. Once established, our model is comparatively time- and cost-effective, and usually yield highly reproducible results. We suggest that the protocol outlined in this article could serve as a general guideline for establishing mouse models reconstituted with human PBMC and tumors for I-O research.

A Human Peripheral Blood Mononuclear Cell PBMC Engrafted Humanized Xenograft Model for Translational Immuno-oncology I-O Research

We describe a human peripheral blood mononuclear cell (PBMC) &#8212; based humanized xenograft mouse model for translational immuno-oncology research. This protocol could serve as a general guideline for establishing and characterizing similar models for I-O therapy assessment.

The discovery and development of immuno-oncology (I-O) therapy in recent years represents a milestone in the treatment of cancer. However, treatment ...

Cancer Research

Using Quantitative Real-time PCR to Determine Donor Cell Engraftment in a Competitive Murine Bone Marrow Transplantation Model

Murine bone marrow transplantation models provide an important tool in measuring hematopoietic stem cell (HSC) functions and determining genes/molecules that regulate HSCs. In these transplant model systems, the function of HSCs is determined by the ability of these cells to engraft and reconstitute lethally irradiated recipient mice. Commonly, the donor cell contribution/engraftment is measured by antibodies to donor- specific cell surface proteins using flow cytometry. However, this method heavily depends on the specificity and the ability of the cell surface marker to differentiate donor-derived cells from recipient-originated cells, which may not be available for all mouse strains. Considering the various backgrounds of genetically modified mouse strains in the market, this cell surface/ flow cytometry-based method has significant limitations especially in mouse strains that lack well-defined surface markers to separate donor cells from congenic recipient cells. Here, we reported a PCR-based technique to determine donor cell engraftment/contribution in transplant recipient mice. We transplanted male donor bone marrow HSCs to lethally irradiated congenic female mice. Peripheral blood samples were collected at different time points post transplantation. Bone marrow samples were obtained at the end of the experiments. Genomic DNA was isolated and the Y chromosome specific gene, Zfy1, was amplified using quantitative Real time PCR. The engraftment of male donor-derived cells in the female recipient mice was calculated against standard curve with known percentage of male vs. female DNAs. Bcl2 was used as a reference gene to normalize the total DNA amount. Our data suggested that this approach reliably determines donor cell engraftment and provides a useful, yet simple method in measuring hematopoietic cell reconstitution in murine bone marrow transplantation models. Our method can be routinely performed in most laboratories because no costly equipment such as flow cytometry is required.

Determining donor cell engraftment presents a challenge in mouse bone marrow transplant models that lack well-defined phenotypical markers. We described a methodology to quantify male donor cell engraftment in female transplant recipient mice. This method can be used in all mouse strains for the study of HSC functions.

Murine bone marrow transplantation models provide an important tool in measuring hematopoietic stem cell (HSC) functions and determining genes/molecules ...

Medicine

Generation of Subcutaneous and Intrahepatic Human Hepatocellular Carcinoma Xenografts in Immunodeficient Mice

In vivo experimental models of hepatocellular carcinoma (HCC) that recapitulate the human disease provide a valuable platform for research into disease pathophysiology and for the preclinical evaluation of novel therapies. We present a variety of methods to generate subcutaneous or orthotopic human HCC xenografts in immunodeficient mice that could be utilized in a variety of research applications. With a focus on the use of primary tumor tissue from patients undergoing surgical resection as a starting point, we describe the preparation of cell suspensions or tumor fragments for xenografting. We describe specific techniques to xenograft these tissues i) subcutaneously; or ii) intrahepatically, either by direct implantation of tumor cells or fragments into the liver, or indirectly by injection of cells into the mouse spleen. We also describe the use of partial resection of the native mouse liver at the time of xenografting as a strategy to induce a state of active liver regeneration in the recipient mouse that may facilitate the intrahepatic engraftment of primary human tumor cells. The expected results of these techniques are illustrated. The protocols described have been validated using primary human HCC samples and xenografts, which typically perform less robustly than the well-established human HCC cell lines that are widely used and frequently cited in the literature. In comparison with cell lines, we discuss factors which may contribute to the relatively low chance of primary HCC engraftment in xenotransplantation models and comment on technical issues that may influence the kinetics of xenograft growth. We also suggest methods that should be applied to ensure that xenografts obtained accurately resemble parent HCC tissues.

Human tumor xenografts in immunodeficient mice are valuable tools to study cancer biology. Specific protocols to generate subcutaneous and intrahepatic xenografts from human hepatocellular carcinoma cells or tumor fragments are described. Liver regeneration induced by partial hepatectomy in recipient mice is presented as a strategy to facilitate intrahepatic engraftment.

In  vivo experimental models of hepatocellular carcinoma (HCC) that recapitulate  the human disease provide a valuable platform for research into disease  ...

Testing Cancer Immunotherapeutics in a Humanized Mouse Model Bearing Human Tumors

Reversing the immunosuppressive nature of the tumor microenvironment is critical for the successful treatment of cancers with immunotherapy drugs. Murine cancer models are extremely limited in their diversity and suffer from poor translation to the clinic. To serve as a more physiological preclinical model for immunotherapy studies, this protocol has been developed to evaluate the treatment of human tumors in a mouse reconstituted with a human immune system. This unique protocol demonstrates the development of human immune system (HIS, &#34;humanized&#34;) mice, followed by implantation of a human tumor, either a cell-line derived xenograft (CDX) or a patient derived xenograft (PDX). HIS mice are generated by injecting CD34+ human hematopoietic stem cells isolated from umbilical cord blood into neonatal BRGS (BALB/c Rag2-/- IL2R&#947;C-/- NODSIRP&#945;) highly immunodeficient mice that are also capable of accepting a xenogeneic tumor. The importance of the kinetics and characteristics of the human immune system development and tumor implantation is emphasized. Finally, an in-depth evaluation of the tumor microenvironment using flow cytometry is described. In numerous studies using this protocol, it was found that the tumor microenvironment of individual tumors is recapitulated in HIS-PDX mice; &#34;hot&#34; tumors exhibit large immune infiltration while &#34;cold&#34; tumors do not. This model serves as a testing ground for combination immunotherapies for a wide range of human tumors and represents an important tool in the quest for personalized medicine.

This protocol outlines the generation of human immune system (HIS) mice for immuno-oncology studies. Instructions and considerations in the use of this model for testing human immunotherapeutics on human tumors implanted in this model are presented with an emphasis on characterizing the response of the human immune system to the tumor.

Reversing the immunosuppressive nature of the tumor microenvironment is critical for the successful treatment of cancers with immunotherapy drugs. Murine ...

Expression of Exogenous Cytokine in Patient-derived Xenografts via Injection with a Cytokine-transduced Stromal Cell Line

Patient-derived xenograft (PDX) mice are produced by transplanting human cells into immune deficient mice. These models are an important tool for studying the mechanisms of normal and malignant hematopoiesis and are the gold standard for identifying effective chemotherapies for many malignancies. PDX models are possible because many of the mouse cytokines also act on human cells. However, this is not the case for all cytokines, including many that are critical for studying normal and malignant hematopoiesis in human cells. Techniques that engineer mice to produce human cytokines (transgenic and knock-in models) require significant expense before the usefulness of the model has been demonstrated. Other techniques are labor intensive (injection of recombinant cytokine or lentivirus) and in some cases require high levels of technical expertise (hydrodynamic injection of DNA). This report describes a simple method for generating PDX mice that have exogenous human cytokine (TSLP, thymic stromal lymphopoietin) via weekly intraperitoneal injection of stroma that have been transduced to overexpress this cytokine. Use of this method provides an in vivo source of continuous cytokine production that achieves physiological levels of circulating human cytokine in the mouse. Plasma levels of human cytokine can be varied based on the number of stromal cells injected, and cytokine production can be initiated at any point in the experiment. This method also includes cytokine-negative control mice that are similarly produced, but through intraperitoneal injection of stroma transduced with a control vector. We have previously demonstrated that leukemia cells harvested from TSLP-expressing PDX, as compared to control PDX, exhibit a gene expression pattern more like the original patient sample. Together the cytokine-producing and cytokine-negative PDX mice produced by this method provide a model system that we have used successfully to study the role of TSLP in normal and malignant hematopoiesis.

Described here is a method for producing exogenous cytokine in patient-derived xenograft (PDX) mice via weekly intraperitoneal injection of a cytokine-transduced stromal cell line. This method broadens the utility of PDX and provides the option for transient or sustained exogenous cytokine delivery in a multitude of PDX models.

Patient-derived xenograft (PDX) mice are produced by transplanting human cells into immune deficient mice. These models are an important tool for studying ...

Induction of Intestinal Graft-versus-host Disease and Its Mini-endoscopic Assessment in Live Mice

Acute graft-versus-host disease (GvHD) represents the most severe complication that patients previously undergoing allogeneic hematopoietic stem cell transplantation (allo-HCT) face and is frequently associated with a poor clinical outcome. While, for instance, GvHD manifestations of the skin are usually responsive to established immune-suppressive therapies and are, hence, not taking a fatal course, the presence and the intensity of intestinal GvHD, especially of the mid-to-lower parts of the gut, strongly influence the outcome and overall survival of patients with acute GvHD. Therapeutic options are essentially limited to the classic immune-suppressive agents yielding only moderate disease-mitigating effects. Hence, detailed knowledge about the tissue-resident immune cascade, changes in the intestinal microbiota, and the stromal response prior, upon, and after intestinal GvHD onset are urgently needed to understand the events and mechanisms underlying its pathogenesis and to develop innovative therapeutic options. Murine models of GvHD are frequently employed to identify and functionally assess molecules and pathways putatively driving intestinal GvHD. However, means to specifically monitor and evaluate intestinal inflammation over time are essentially lacking since established scores to assess and grade acute GvHD are routinely comprised of various parameters which rather reflect&#160;systemic GvHD manifestations. The detailed evaluation of intestinal GvHD has been restricted to studies using euthanized mice, thereby essentially excluding longitudinal (i.e., kinetic) analyses of the colonic compartment under a given experimental condition (e.g., antibody-mediated blockade of a proinflammatory cytokine) in live mice (i.e., in vivo). The mini-endoscopic in situ assessment of the distal colon of allo-HCT-treated mice described here allows a) a detailed macroscopic evaluation of different aspects of intestinal inflammation and b) the option to collect tissue samples for downstream analyses at various time points over the course of the observation period. Overall, the mini-endoscopic approach provides a major advance in preclinical noninvasive monitoring and assessment of intestinal GvHD.

Here, we present a protocol that describes allogeneic hematopoietic stem cell transplantation and allows repetitive mini-endoscopic evaluations of the distal colon in situ for the presence, characteristics, and severity of colonic inflammation within live mice suffering from intestinal graft-versus-host disease.

Acute graft-versus-host disease (GvHD) represents the most severe complication that patients previously undergoing allogeneic hematopoietic stem cell ...

Bone Marrow Transplantation Platform to Investigate the Role of Dendritic Cells in Graft-versus-Host Disease

Allogeneic bone marrow transplantation (BMT) is an effective therapy for hematological malignancies due to the graft-versus-leukemia (GVL) effect to eradicate tumors. However, its application is limited by the development of graft-versus-host disease (GVHD), a major complication of BMT. GVHD is evoked when T-cells in the donor grafts recognizealloantigen expressed by recipient cells and mount unwanted immunological attacks against recipient healthy tissues. Thus, traditional therapies are designed to suppress donor T-cell alloreactivity. However, these approaches substantially impair the GVL effect so that the recipient&#39;s survival is not improved. Understanding the effects of therapeutic approaches on BMT, GVL, and GVHD, is thus essential. Due to the antigen-presenting and cytokine-secreting capacities to stimulate donor T-cells, recipient dendritic cells (DCs) play a significant role in the induction of GVHD. Therefore, targeting recipient DCs becomes a potential approach for controlling GVHD. This work provides a description of a novel BMT platform to investigate how host DCs regulate GVH and GVL responses after transplantation. Also presented is an effective BMT model to study the biology of GVHD and GVL after transplantation.

Graft-versus-host disease is a major complication after allogeneic bone marrow transplantation. Dendritic cells play a critical role in the pathogenesis of graft-versus-host disease. The current article describes a novel bone marrow transplantation platform to investigate the role of dendritic cells in the development of graft-versus-host disease and the graft-versus-leukemia effect.

Allogeneic bone marrow transplantation (BMT) is an effective therapy for hematological malignancies due to the graft-versus-leukemia (GVL) effect to ...

Xenograft Skin Model to Manipulate Human Immune Responses In Vivo

The human skin xenograft model, in which human donor skin is transplanted onto an immunodeficient mouse host, is an important option for translational research in skin immunology. Murine and human skin differ substantially in anatomy and immune cell composition. Therefore, traditional mouse models have limitations for dermatological research and drug discovery. However, successful xenotransplants are technically challenging and require optimal specimen and mouse graft site preparation for graft and host survival. The present protocol provides an optimized technique for transplanting human skin onto mice and discusses necessary considerations for downstream experimental aims. This report describes the appropriate preparation of a human donor skin sample, assembly of a surgical setup, mouse and surgical site preparation, skin transplantation, and post-surgical monitoring. Adherence to these methods allows for maintenance of xenografts for over 6 weeks post-surgery. The techniques outlined below allow maximum grafting efficiency due to the development of engineering controls, sterile technique, and pre- and post-surgical conditioning. Appropriate performance of the xenograft model results in long-lived human skin graft samples for experimental characterization of human skin and preclinical testing of compounds in vivo.

Xenograft Skin Model to Manipulate Human Immune Responses In Vivo

The present protocol describes how to graft human skin onto non-obese diabetic (NOD)-scid interleukin-2 gamma chain receptor (NSG) mice. A detailed description of the preparation of human skin for transplant, preparation of mice for transplant, transplantation of split-thickness human skin, and post-transplantation recovery procedure are included in the report.

The human skin xenograft model, in which human donor skin is transplanted onto an immunodeficient mouse host, is an important option for translational ...

A Technique to Generate a Human PBMC-Engrafted Humanized Xenograft Mouse Model

Source: Li, Z., et al. <a href="https://app.jove.com/v/59679">A Human Peripheral Blood Mononuclear Cell (PBMC) Engrafted Humanized Xenograft Model for Translational Immuno-oncology (I-O) Research.</a> J. Vis. Exp. (2019)
This video demonstrates an assay to generate a humanized xenograft mouse model. An immunocompromised mouse is injected with cyclophosphamide to cause immune cell depletion. Patient-derived tumor cells mixed with human peripheral blood mononuclear cells (PBMCs) in a hydrogel are subcutaneously injected into the mouse, forming a tumor with infiltrating T cells.

All procedures involving sample collection have been performed in accordance with the institute&#39;s IRB guidelines. All procedures involving animal ...

Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR

Samenvatting

Meer video's verkennen