The research was supported by CGC.NL and the Netherlands Cardio Vascular Research Initiative: the Dutch Heart Foundation, the Dutch Federation of University Medical Centers, the Netherlands Organization for Health Research and Development, and the Royal Netherlands Academy of Sciences Grant awarded to the Phaedra-Impact (http://www.phaedraresearch.nl). JM is supported by the Chinese Scholarship Council. GSD is supported by a Trampoline grant from AFM-Telethon [22379], FOP Italia and a grant from La Fundaci&#243; La Marat&#243; de TV3 (#202038).

1. Induction of EndMT by TGF-&#946;2
<ol>
	<li>MS-1 cells&#160;in Dulbecco&#39;s modified Eagle&#160;medium (DMEM) containing 10% fetal bovine serum (FBS) and 100 U/mL penicillin/streptomycin in an incubator (5% CO2, 37 &#176;C). Coat all culture dishes/plates with 0.1% w/v gelatin for 10 min before use.</li>
	<li>Gently wash MS-1 cells with 1x phosphate buffered saline (PBS), add 2 mL of trypsin-EDTA solution (0.25% trypsin and 0.02% EDTA) to a 10 cm dish, and incubate for 2 min at 37 &#176;C to detach them. Subsequently, add 5 mL of complete culture medium to quench the reaction.</li>
	<li>Transfer the cell suspension to a 15 mL tube and centrifuge at 200 x g for 3 min at room temperature.</li>
	<li>Discard the supernatant and resuspend the cells in 4 mL of fresh medium containing FBS and penicillin/streptomycin. Count the cells using an automatic cell counter.</li>
	<li>Seed 1 x 103 cells per cm2 for further culture. For example, seed 9.5 x 103 cells/well for 6-well plates, or 1.9 x 103 cells/well for 24-well plates.</li>
	<li>Incubate the cells overnight to allow them to adhere and recover, then stimulate MS-1 cells with TGF-&#946;2 for 3 days. Add the TGF-&#946; receptor kinase inhibitor SB431542 (5 &#181;M) 30 min before TGF-&#946;2 stimulation. Treat other cells with vehicle (DMSO). 
	NOTE: Dissolve TGF-&#946;2 in 4 mM HCl containing 0.1% human bovine serum albumin (BSA). Add the same amount of ligand buffer without TGF-&#946;2 to the control group. The TGF-&#946;2 concentration may be adapted to be 0.1-1 ng/mL for specific assays. See indications in the corresponding figures.</li>
	<li>After 3 days, examine the cell morphology with bright field imaging (with an inverted microscope) and perform immunofluorescence staining (see step 2) to assess EndMT-related marker changes. Perform at least three independent experiments to obtain biological triplicates.</li>
</ol>
2. Immunofluorescence staining
<ol>
	<li>Trypsinize cultured MS-1 cells (step 1.2) and then reseed 1.9 x 103 cells on a 0.1% w/v gelatin-coated 12 mm round cover glass placed on the bottom of a 24-well plate.</li>
	<li>After culturing the cells overnight, add TGF-&#946;2 (final concentration 1 ng/mL) to the cells for 3 days. Use medium containing ligand buffer as a negative control.</li>
	<li>Perform Pecam-1 and Sm22&#945; staining.
	<ol>
		<li>After stimulating the cells with TGF-&#946;2 (or Control) for 3 days, remove the medium, and wash the cells with 1x PBS.</li>
		<li>Add 300 &#181;L of 4% formaldehyde to each well and incubate for 10 min at room temperature to fix the cells. Wash 3x with 1x PBS after incubation.</li>
		<li>Add 300 &#181;L of 0.1% Triton X-100 in 1x PBS to each well and incubate for 10 min at room temperature to permeabilize the cells. After incubation, remove the Triton X-100 solution and wash the cells 3x with 1x PBS.</li>
		<li>Block the cells with 3% bovine serum albumin (BSA) in 1x PBS for 45 min at room temperature.</li>
		<li>Dilute the primary Pecam-1 and Sm22&#945; antibodies that recognize murine proteins 1:500 with 1x PBS. Then incubate the fixed cells with primary antibodies for 45 min at room temperature.</li>
		<li>After washing 3x with 1x PBS, incubate the cells with 1000x diluted secondary antibodies, including donkey anti-rat Alexa 488 and goat anti-rabbit Alexa 594, for 45 min at room temperature. 
		&#8203;NOTE: Protect the samples from light during staining.</li>
		<li>After rinsing 3x with 1x PBS, place the cover glass seeded with cells face down on a drop of mounting medium containing 4&#39;,6-diamidino-2-phenylindole (DAPI) on a slide to stain the nuclei.</li>
		<li>Fix the periphery of the cover glass with transparent nail polish and store it at 4 &#176;C.</li>
		<li>Acquire representative images with a confocal microscope. Set the laser wavelengths at 405 nm, 488 nm and 552 nm to detect DAPI, Pecam-1 and Sm22&#945;, respectively. For each channel, all the pictures were taken with the same settings and exposure time. Perform at least three independent experiments to obtain biological triplicates.</li>
	</ol>
	</li>
</ol>
3. Knock out of Snail using CRISPR/Cas9 editing
<ol>
	<li>Design two independent sgRNAs targeting murine Snail.
	<ol>
		<li>Design sgRNAs using the online tools CHOPCHOP (https://chopchop.cbu.uib.no/) and Cas-OFFinder (http://www.rgenome.net/cas-offinder/) according to the targeted gene name and species.</li>
		<li>Predict the off-target activity of the designed sgRNAs targeting to Snail with two independent algorithms, including Cas-OFFinder (http://www.rgenome.net/cas-offinder/)&#160;and CHOPCHOP (http://chopchop.cbu.uib.no/).</li>
		<li>Choose two sgRNAs with the lowest off-activity. Design two complementary sgRNA oligos with the BveI cut site. The sense oligo starts with 5&#39;-ACCG-3&#39; and the antisense oligo starts with 5&#39;-AAAC-3&#39;.</li>
		<li>Order the oligos to be commercially synthesized for further use.</li>
	</ol>
	</li>
	<li>Clone the complementary guide RNA oligos into the BveI-digested AA19 pLKO.1-puro.U6.sgRNA.BveI-stuffer Lentiviral vector plasmid to generateAA19 pLKO.1-Snail-sgRNA16.
	<ol>
		<li>Cut the AA19 pLKO.1-puro.U6.sgRNA.BveI-stuffer plasmid with the BveI enzyme16. Mix 2 &#181;g of AA19 pLKO.1-puro.U6.sgRNA.BveI-stuffer plasmid, 5 &#181;L of 10x Buffer O, and 5 &#181;L of BveI enzyme and add sterile water to reach a total volume of 50 &#181;L.</li>
		<li>Vortex and briefly spin down the reaction mix. Incubate the reaction at 37 &#176;C for 1 h.</li>
		<li>Load the reaction mix on a 1% agarose gel and run in 1x Tris-acetate-EDTA (TAE, 50x TAE stock: 242 g of Tris base dissolved in water, 57.1 mL of glacial acetic acid, 100 mL of 500 mM EDTA (pH 8.0) solution, and add water to a total of 1 L) buffer until a good separation is achieved.</li>
		<li>Cut the backbone fragment from the gel, isolate it with a gel extraction kit according to the manufacturer&#39;s protocol (see the Table of Materials) and elute the backbone in 40 &#181;L elution buffer (EB).</li>
		<li>Mix 5 &#181;L of 100 pmol/&#181;L sense oligo and 5 &#181;L of 100 pmol/&#181;L antisense oligo with 1 &#181;L of 1 M Tris-HCl (pH 8.0) and add sterile water to reach a total of 100 &#181;L to anneal the gRNA oligos. Incubate the mixture for 5 min at 100 &#176;C, and then cover the tubes with aluminum foil. After that, slowly cool the solution to room temperature for further use as an insert.</li>
		<li>To ligate the complementary gRNA oligos and the BveI-digested backbone, mix 1 &#181;L of isolated BveI cut AA19 pLKO.1-puro.U6.sgRNA.BveI-stuffer backbone and 2 &#181;L of insert (diluted 1:300) with 2 &#181;L of 10x T4 DNA ligase buffer and 1 &#181;L of T4 DNA ligase, and add sterile water to reach a total of 20 &#181;L. Briefly spin the tube, and incubate it for 4 h at room temperature for further use. 
		&#8203;NOTE: When performing the ligation, ensure two control groups are included. For one control group, mix 1 &#181;L of isolated backbone, 2 &#181;L of 10x T4 DNA ligase buffer, and 1 &#181;L of T4 DNA ligase and add sterile water to reach a total of 20 &#181;L, but without oligo DNA. For the other control group, mix 1 &#181;L of isolated backbone and 2 &#181;L of 10x T4 DNA ligase buffer, and add sterile water to reach a total of 20 &#181;L, but without the annealed oligos&#160;and T4 ligase. These two control ligations are used to determine the reaction background in the next transformation step and indicate of how efficient the ligation is.</li>
	</ol>
	</li>
	<li>Transform the reaction mixture into competent TOP10 E. coli.
	<ol>
		<li>Collect the competent TOP10 E. coli. cells from the -80 &#176;C freezer, and thaw them on ice.</li>
		<li>Add 2 &#181;L of ligation mixture to 50 &#181;L of competent cells and keep the tube on ice for 30 min.</li>
		<li>Heat-shock the tube at 42 &#176;C for 30 s. Put the tube on ice for 2 min.</li>
		<li>Add 950 &#181;L of fresh lysogeny broth (LB) medium to the mixture and shake vigorously at 37 &#176;C for 60 min.</li>
		<li>Spin down and plate the cells on a warm ampicillin (100 &#181;g/mL) resistance LB plate. Incubate the plate at 37 &#176;C overnight.</li>
	</ol>
	</li>
	<li>Verify the successful insertion of the gRNA oligos&#160;in the plasmid.
	<ol>
		<li>Pick 3-5 colonies on the plate in 1 mL of ampicillin (100 &#181;g/mL) containing LB medium and shake overnight at 30 &#176;C.</li>
		<li>Isolate the plasmid DNA with a plasmid kit according to the manufacturer&#39;s protocol (Table of Materials) and sequence it with the U6 promoter primer 5&#39;- GAGGGCCTATTTCCCATGATT -3&#39; to verify the successful insertion of the gRNA oligo.</li>
	</ol>
	</li>
</ol>
4. Generate Snail knockout MS-1 cells
<ol>
	<li>Produce lentiviral particles carrying Cas9 or Snail-targeting gRNAs.
	<ol>
		<li>Culture HEK 293T cells in DMEM containing 10% fetal bovine serum and 100 U/mL penicillin/streptomycin in 14.5 cm dishes (or T75 flasks) in an incubator (5% CO2, 37 &#176;C).</li>
		<li>Mix 9.9 &#181;g of targeting gene plasmid, AA19 pLKO.1-Snail-sgRNA or pLV-Cas917 plasmid, together with the helper plasmids 3.5 &#181;g of pCMV-VSVG (encoding the G protein of the vesicular stomatitis virus, VSV-G), 6.6 &#181;g of rev-responsive element plasmid pMDLg-RRE (encoding Gag and Pol), and 5.0 &#181;g of pRSV-REV (encoding Rev) in 500 &#181;L of serum free medium. Resuspend 50 &#181;L of polyethylenimine (PEI) (2.5 mg/mL) in 500 &#181;L of serum free medium. Gently mix plasmids and PEI preparations by pipetting up and down. Incubate the mixture for 20 min at room temperature.</li>
		<li>Transfect HEK 293T cells by adding the mixture medium from step 4.1.2 to 80% confluent cells in 14.5 cm dishes (or T75 flasks) which contain DMEM medium with 10% FBS and 100 U/mL penicillin/streptomycin. HEK293T cells are used because they are easily transfected and generate high levels of virus18.</li>
		<li>Transfer transfected HEK 293T cells to a biosafety in microbiological and biomedical laboratory (BMBL) to culture them for 24 h.</li>
		<li>In a BMBL laboratory, replace the transfection medium from HEK 293T cells with 12 mL of fresh complete DMEM containing FBS and penicillin/streptomycin. Incubate the cells for 24 h.</li>
		<li>Collect and filter the medium with a 20 mL syringe and a 0.45 &#181;m filter. Transfer the conditioned medium into a 15 mL polypropylene tube.</li>
		<li>Add 12 mL of fresh complete DMEM containing FBS and penicillin/streptomycin to the HEK 293T culture dish and culture for an additional 24 h.</li>
		<li>Collect and filter the medium with a 20 mL syringe and a 0.45 &#181;m filter. Transfer the conditioned medium into a 15 mL polypropylene tube. Store the medium containing lentiviral particles as 1 mL aliquots at -80 &#176;C for further use.</li>
	</ol>
	</li>
	<li>Infect MS-1 cells with the pLV-Cas9 virus.
	<ol>
		<li>Seed 1 x 105 MS-1 cells per well in a 6-well plate for 24 h before lentivirus infection.</li>
		<li>Thaw the frozen aliquots of pLV-Cas9 virus in a 37 &#176;C water bath.</li>
		<li>Mix 1 mL of virus medium with 1 mL of fresh DMEM medium containing FBS and penicillin/streptomycin. Add polybrene to the medium (final concentration as 10 &#956;g/mL) to increase the infection efficiency.</li>
		<li>Remove the medium from the 6-well plate and replace it with the virus/polybrene mix medium and culture the cells in an incubator for 24 h. 24 h post-infection, replace the medium with fresh medium and culture the cells for another 24 h. 
		&#8203;NOTE: Always keep an uninfected well as a control group.</li>
		<li>Aspirate the medium from the infected group and control group and replace it with DMEM medium with 4 &#181;g/mL blasticidin.</li>
		<li>Return the plate to a 37 &#176;C incubator and culture the cells for 1 week. Uninfected cells will die due to the effect of blasticidin. Split the surviving cells when they reach 80% cell confluency and continue with blasticidin selection.</li>
		<li>Confirm the expression of Cas9 in MS-1 cells by western blotting using an antibody against Cas9 (molecular weight of Cas9 is approximately 160 kDa).</li>
	</ol>
	</li>
	<li>Separately infect pLV-Cas9 MS-1 cells with two independent gRNA lentiviruses.
	<ol>
		<li>Seed 1 x 105 pLV-Cas9 MS-1 cells per well in a 6-well plate for 24 h before infection.</li>
		<li>Follow the same protocol as described in 4.2 to separately infect cells with two gRNA lentiviruses.</li>
		<li>After 24 h of infection with the gRNA virus, refresh the medium and culture the cells for another 24 h.</li>
		<li>Replace the medium with DMEM with 1 &#181;g/mL puromycin. Return the plate to a 37 &#176;C incubator and culture the cells for 1 week. Ensure the uninfected cells are completely dead. Split the cells when they reach 80% confluency and continue puromycin selection.</li>
		<li>Confirm the knock-out of Snail in MS-1 cells by western blotting using an antibody against Snail (molecular weight of Snail is approximately 35 kDa).</li>
	</ol>
	</li>
</ol>

<ol><li>Ma, J., Sanchez-Duffhues, G., Goumans, M. -J., Ten Dijke, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((TGF-%CE%B2-induced+endothelial+to+mesenchymal+transition+in+disease+and+tissue+engineering%5BTitle%5D)+AND+%22Frontiers+in+Cell+and+Developmental+Biology%22%5BJournal%5D)">TGF-β-induced endothelial to mesenchymal transition in disease and tissue engineering.</a> Frontiers in Cell and Developmental Biology. 8, (2020).</li>
<li>Piera-Velazquez, S., Jimenez, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Endothelial+to+mesenchymal+transition%3A+role+in+physiology+and+in+the+pathogenesis+of+human+diseases%5BTitle%5D)+AND+%22Physiological+Reviews%22%5BJournal%5D)">Endothelial to mesenchymal transition: role in physiology and in the pathogenesis of human diseases.</a> Physiological Reviews. 99 (2), 1281-1324 (2019).</li>
<li>Sánchez-Duffhues, G., de Vinuesa, G. A., ten Dijke, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Endothelial-to-mesenchymal+transition+in+cardiovascular+diseases%3A+developmental+signaling+pathways+gone+awry%5BTitle%5D)+AND+%22Developmental+Dynamics%22%5BJournal%5D)">Endothelial-to-mesenchymal transition in cardiovascular diseases: developmental signaling pathways gone awry.</a> Developmental Dynamics. 247 (3), 492-508 (2018).</li>
<li>Evrard, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Endothelial+to+mesenchymal+transition+is+common+in+atherosclerotic+lesions+and+is+associated+with+plaque+instability%5BTitle%5D)+AND+%22Nature+Communications%22%5BJournal%5D)">Endothelial to mesenchymal transition is common in atherosclerotic lesions and is associated with plaque instability.</a> Nature Communications. 7 (1), 1-16 (2016).</li>
<li>Qiao, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Endothelial+fate+mapping+in+mice+with+pulmonary+hypertension%5BTitle%5D)+AND+%22Circulation%22%5BJournal%5D)">Endothelial fate mapping in mice with pulmonary hypertension.</a> Circulation. 129 (6), 692-703 (2014).</li>
<li>Zeisberg, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Endothelial-to-mesenchymal+transition+contributes+to+cardiac+fibrosis%5BTitle%5D)+AND+%22Nature+Medicine%22%5BJournal%5D)">Endothelial-to-mesenchymal transition contributes to cardiac fibrosis.</a> Nature Medicine. 13 (8), 952-961 (2007).</li>
<li>Clere, N., Renault, S., Corre, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Endothelial-to-mesenchymal+transition+in+cancer%5BTitle%5D)+AND+%22Frontiers+in+Cell+and+Developmental+Biology%22%5BJournal%5D)">Endothelial-to-mesenchymal transition in cancer.</a> Frontiers in Cell and Developmental Biology. 8, (2020).</li>
<li>Saito, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((EMT+and+EndMT%3A+regulated+in+similar+ways%5BTitle%5D)+AND+%22The+Journal+of+Biochemistry%22%5BJournal%5D)">EMT and EndMT: regulated in similar ways.</a> The Journal of Biochemistry. 153 (6), 493-495 (2013).</li>
<li>Bolós, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+transcription+factor+Slug+represses+E-cadherin+expression+and+induces+epithelial+to+mesenchymal+transitions%3A+a+comparison+with+Snail+and+E47+repressors%5BTitle%5D)+AND+%22Journal+of+Cell+Science%22%5BJournal%5D)">The transcription factor Slug represses E-cadherin expression and induces epithelial to mesenchymal transitions: a comparison with Snail and E47 repressors.</a> Journal of Cell Science. 116 (3), 499-511 (2003).</li>
<li>Aird, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Endothelial+cell+heterogeneity%5BTitle%5D)+AND+%22Cold+Spring+Harbor+Perspectives+in+Medicine%22%5BJournal%5D)">Endothelial cell heterogeneity.</a> Cold Spring Harbor Perspectives in Medicine. 2 (1), 006429(2012).</li>
<li>Yang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Guidelines+and+definitions+for+research+on+epithelial-mesenchymal+transition%5BTitle%5D)+AND+%22Nature+Reviews+Molecular+Cell+Biology%22%5BJournal%5D)">Guidelines and definitions for research on epithelial-mesenchymal transition.</a> Nature Reviews Molecular Cell Biology. , 1-12 (2020).</li>
<li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+new+frontier+of+genome+engineering+with+CRISPR-Cas9%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346 (6213), (2014).</li>
<li>Hsu, P. D., Lander, E. S., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Development+and+applications+of+CRISPR-Cas9+for+genome+engineering%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Development and applications of CRISPR-Cas9 for genome engineering.</a> Cell. 157 (6), 1262-1278 (2014).</li>
<li>Arbiser, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Oncogenic+H-ras+stimulates+tumor+angiogenesis+by+two+distinct+pathways%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+USA%22%5BJournal%5D)">Oncogenic H-ras stimulates tumor angiogenesis by two distinct pathways.</a> Proceedings of the National Academy of Sciences USA. 94 (3), 861-866 (1997).</li>
<li>MA, J., et al. TGF-?-induced endothelial to mesenchymal transition results from a balance between SNAIL and ID factors. Frontiers in Cell and Developmental Biology. 182 (9), (2021).</li>
<li>Chen, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Probing+the+impact+of+chromatin+conformation+on+genome+editing+tools%5BTitle%5D)+AND+%22Nucleic+Acids+Research%22%5BJournal%5D)">Probing the impact of chromatin conformation on genome editing tools.</a> Nucleic Acids Research. 44 (13), 6482-6492 (2016).</li>
<li>Hunter, F. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Functional+CRISPR+and+shRNA+screens+identify+involvement+of+mitochondrial+electron+transport+in+the+activation+of+evofosfamide%5BTitle%5D)+AND+%22Molecular+Pharmacology%22%5BJournal%5D)">Functional CRISPR and shRNA screens identify involvement of mitochondrial electron transport in the activation of evofosfamide.</a> Molecular Pharmacology. 95 (6), 638-651 (2019).</li>
<li>Mao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Lentiviral+vectors+mediate+long-term+and+high+efficiency+transgene+expression+in+HEK+293T+cells%5BTitle%5D)+AND+%22International+Journal+of+Medical+Sciences%22%5BJournal%5D)">Lentiviral vectors mediate long-term and high efficiency transgene expression in HEK 293T cells.</a> International Journal of Medical Sciences. 12 (5), 407(2015).</li>
<li>Liu, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Deubiquitinase+activity+profiling+identifies+UCHL1+as+a+candidate+oncoprotein+that+promotes+TGF%CE%B2-induced+breast+cancer+metastasis%5BTitle%5D)+AND+%22Clinical+Cancer+Research%22%5BJournal%5D)">Deubiquitinase activity profiling identifies UCHL1 as a candidate oncoprotein that promotes TGFβ-induced breast cancer metastasis.</a> Clinical Cancer Research. 26 (6), 1460-1473 (2020).</li>
<li>Medici, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Conversion+of+vascular+endothelial+cells+into+multipotent+stem-like+cells%5BTitle%5D)+AND+%22Nature+Medicine%22%5BJournal%5D)">Conversion of vascular endothelial cells into multipotent stem-like cells.</a> Nature Medicine. 16 (12), 1400(2010).</li>
<li>Kokudo, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Snail+is+required+for+TGF%CE%B2-induced+endothelial-mesenchymal+transition+of+embryonic+stem+cell-derived+endothelial+cells%5BTitle%5D)+AND+%22Journal+of+Cell+Science%22%5BJournal%5D)">Snail is required for TGFβ-induced endothelial-mesenchymal transition of embryonic stem cell-derived endothelial cells.</a> Journal of Cell Science. 121 (20), 3317-3324 (2008).</li>
<li>Dong, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-cell+RNA-seq+analysis+unveils+a+prevalent+epithelial%2Fmesenchymal+hybrid+state+during+mouse+organogenesis%5BTitle%5D)+AND+%22Genome+Biology%22%5BJournal%5D)">Single-cell RNA-seq analysis unveils a prevalent epithelial/mesenchymal hybrid state during mouse organogenesis.</a> Genome Biology. 19 (1), 1-20 (2018).</li>
<li>Oatley, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-cell+transcriptomics+identifies+CD44+as+a+marker+and+regulator+of+endothelial+to+haematopoietic+transition%5BTitle%5D)+AND+%22Nature+communications%22%5BJournal%5D)">Single-cell transcriptomics identifies CD44 as a marker and regulator of endothelial to haematopoietic transition.</a> Nature communications. 11 (1), 1-18 (2020).</li>
<li>Halaidych, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Inflammatory+responses+and+barrier+function+of+endothelial+cells+derived+from+human+induced+pluripotent+stem+cells%5BTitle%5D)+AND+%22Stem+Cell+Reports%22%5BJournal%5D)">Inflammatory responses and barrier function of endothelial cells derived from human induced pluripotent stem cells.</a> Stem Cell Reports. 10 (5), 1642-1656 (2018).</li>
<li>Li, Y., Lui, K. O., Zhou, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Reassessing+endothelial-to-mesenchymal+transition+in+cardiovascular+diseases%5BTitle%5D)+AND+%22Nature+Reviews+Cardiology%22%5BJournal%5D)">Reassessing endothelial-to-mesenchymal transition in cardiovascular diseases.</a> Nature Reviews Cardiology. 15 (8), 445-456 (2018).</li>
<li>Ran, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome+engineering+using+the+CRISPR-Cas9+system%5BTitle%5D)+AND+%22Nature+Protocols%22%5BJournal%5D)">Genome engineering using the CRISPR-Cas9 system.</a> Nature Protocols. 8 (11), 2281-2308 (2013).</li>
<li>Grav, L. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((One-step+generation+of+triple+knockout+CHO+cell+lines+using+CRISPR%2FCas9+and+fluorescent+enrichment%5BTitle%5D)+AND+%22Biotechnology+Journal%22%5BJournal%5D)">One-step generation of triple knockout CHO cell lines using CRISPR/Cas9 and fluorescent enrichment.</a> Biotechnology Journal. 10 (9), 1446-1456 (2015).</li>
<li>Abudayyeh, O. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RNA+targeting+with+CRISPR-Cas13%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">RNA targeting with CRISPR-Cas13.</a> Nature. 550 (7675), 280-284 (2017).</li>
<li>Paddison, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cloning+of+short+hairpin+RNAs+for+gene+knockdown+in+mammalian+cells%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">Cloning of short hairpin RNAs for gene knockdown in mammalian cells.</a> Nature Methods. 1 (2), 163-167 (2004).</li>
<li>Reynolds, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rational+siRNA+design+for+RNA+interference%5BTitle%5D)+AND+%22Nature+Biotechnology%22%5BJournal%5D)">Rational siRNA design for RNA interference.</a> Nature Biotechnology. 22 (3), 326-330 (2004).</li>
<li>Lourenço, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((C%2FEBP%C9%91+is+crucial+determinant+of+epithelial+maintenance+by+preventing+epithelial-to-mesenchymal+transition%5BTitle%5D)+AND+%22Nature+Communications%22%5BJournal%5D)">C/EBPɑ is crucial determinant of epithelial maintenance by preventing epithelial-to-mesenchymal transition.</a> Nature Communications. 11 (1), 1-18 (2020).</li>
</ol>

The authors have nothing to disclose.

Understanding the mechanism of EndMT is critical for modulating this process and targeting EndMT-related diseases. Here, we described methods to perform a TGF-&#946;-induced EndMT assay and interrogate the role of the EndMT-TF Snail in TGF-&#946;-triggered EndMT, by performing CRISPR/Cas9-mediated stable gene depletion of Snail from cells. The depletion of Snail using CRISPR/Cas9 approach successfully abrogated TGF-&#946;2 driven EndMT in MS-1 cells (Figure 3C). To study the effects of any cytokines, like TGF-&#946;, on EndMT, ECs were exposed to cytokines and then the occurrence of EndMT was assessed according to morphological changes and endothelial and mesenchymal marker expression changes in cells. TGF-&#946;2 strongly induced EndMT in MS-1 cells accompanied by a strong increase in the expression of the transcription factor Snail. The EndMT-TFs induced by TGF-&#946; can differ according to the species or tissue-specific endothelial cell type. For example, we observed that Snail but not Slug was significantly upregulated by TGF-&#946; in MS-1 cells, while in human umbilical vein endothelial cells (HUVECs), both Snail&#160;and Slug&#160;are increased after exposure to TGF-&#946;20.
We assessed the extent of the EndMT process in two ways by examining cell morphology changes and then by investigating changes in EndMT-related markers expression. After TGF-&#946; exposure for 3 days, cells underwent EndMT with consistent morphological variations and changes in the expression of EndMT-related markers. In addition to the immunofluorescence staining we performed here, marker variations can also be monitored by western blotting at the protein expression level or by qRT-PCR (Real-Time Quantitative Reverse Transcription PCR) at the gene levels21. In addition to these two time- and cost-saving methods that we showed in this protocol, there are other methods to examine EndMT. For example, performing transcriptome analysis (by RNA sequencing or qPCR) to compare the expression levels of endothelial- and mesenchymal-related genes between treated and control cells can precisely assess EndMT22,23. In addition, EndMT often involves the stable loss of barrier function, which can be assessed by impedance spectroscopy24. Furthermore, additional proof of the acquisition of stem cell-like properties by EndMT-derived cells may be examined. For instance, under specific culture conditions, EndMT mesenchymal-like cells can be further differentiated into osteoblasts, chondrocytes, adipocytes or (myo)fibroblasts. Therefore, additional analysis to confirm the differentiation into different cell types belonging to the mesoderm lineage (i.e., gene expression and matrix staining) is useful for demonstrating the multipotent nature of EndMT-derived cells. Finally, the EndMT assessment methods are not limited to in vitro studies, but can be extrapolated to investigate the relation between EndMT and some diseases in vivo or in ex vivo organs. In this sense, the use of endothelial-specific lineage tracing strategies is broadly extended to EndMT-related research25.
To investigate the role of Snail during EndMT, in this study CRISPR/Cas9 gene editing was used to knock out this gene. The data showed that TGF-&#946;2 failed to mediate EndMT in Snail deficient MS-1 cells. This observation demonstrated that Snail is essential for TGF-&#946;2 induced EndMT in MS-1 cells. We used an independent U6-driven sgRNA expression cassette to introduce specific sgRNAs for Cas9 to target Snail. In addition to this method, Ran et al.26 described another strategy for cloning the sgRNA oligos sequence into the Cas9 scaffold to generate a construct containing both Cas9 and gRNAs. Emerging novel approaches allow for CRISPR/Cas to incorporate additional functions. For example, double or triple knockouts can be achieved by delivering more sgRNAs into cells expressing Cas927. The engineered Cas13 protein targets and digests RNA molecules without disrupting endogenous DNA28. Besides knocking out genes with CRISPR/Cas, short hairpin RNAs (shRNAs) can be used as alternatives to stably knock down targeted gene expression29. For all CRISPR/Cas gene editing methods, off-target cleavage should always be taken into consideration. In addition, small interfering RNAs (siRNAs) transiently silence gene expression and the siRNA concentration is diluted with cell division30. Both these methods partially suppress targeted gene expression. In contrast, ectopic gene expression is also used to verify gene function during EndMT/EMT31. This approach can determine if the upregulation of a gene is sufficient to elicit an EndMT response. Therefore, currently there are a multitude of technical strategies that can be used to identify and verify potential regulators of EndMT. Besides, transcriptomic analysis can be a good option in the identification and comprehensive analysis of EndMT related regulators. We recommend using different complementary approaches to investigate the modulation of EndMT.
In summary, we introduced a workflow to identify factors that may play functional roles during TGF-&#946;-induced EndMT. This method can also be used to study whether other stimuli (i.e., cytokines, growth factors, mechanical stimuli, cell-cell interactions) can modulate EndMT, and the interplay of TGF-&#946; with other stimuli. In addition, we highlighted an approach using CRIPSR/Cas gene editing to elucidate whether a certain gene is required for TGF-&#946;-induced EndMT. To illustrate this methodology, we used the strong EndMT inducer TGF-&#946;2 in MS-1 cells, but the protocols can be adapted to other cytokines and other cell types. We expect that this detailed protocol described will serve as a stepping stone for future EndMT-related studies.

Endothelial to mesenchymal transition (EndMT) is a multistep and dynamic biological phenomenon that has been linked to diverse physiological and pathological processes1,2. Upon EndMT endothelial cells gradually lose their endothelial traits, while acquiring mesenchymal properties3; thus, tightly compacted and well organized endothelial cells differentiate into elongated mesenchymal-like cells. Morphological changes in EndMT coincide with alterations in the expression of certain genes and proteins. In general, the expression of proteins that maintain endothelial characteristics, including vascular endothelial (VE)-cadherin, platelet/EC adhesion molecule-1 (CD31/Pecam-1) declines. Simultaneously, proteins related to mesenchymal functions, such as &#945;-smooth muscle actin (&#945;-Sma) and smooth muscle protein 22&#945; (Sm22&#945;) accumulate. Emerging results have demonstrated that postnatal EndMT contributes to the development of human diseases, such as cancer, cardiac fibrosis, pulmonary arterial hypertension (PAH), atherosclerosis (AS), organ fibrosis, etc2,4,5,6,7. A deeper understanding of the underlying mechanisms of EndMT and how to direct the EndMT process will provide novel therapeutic methods for EndMT-related diseases and regenerative medicine.
TGF-&#946; is one of the main EndMT inducers, and other known involved factors include Wnt/&#946;-catenin, Notch, and some inflammatory cytokines1. As the cellular context is key for responses triggered by TGF-&#946;, the interplay of TGF-&#946; with other EndMT promoting signals is relevant for TGF-&#946; to elicit an EndMT response. Upon the activation of TGF-&#946; cell surface type I and type II serine/threonine kinase receptors, the intracellular canonical Smad pathway is activated. TGF-&#946; receptor-mediated phosphorylated Smad2/3 form heteromeric complexes with Smad4 that translocate into the nucleus, where they upregulate the expression of EndMT-related transcription factors. Similar to epithelial-mesenchymal transition (EMT), transcription factors such as Snail, Slug, Twist, Zeb1 and Zeb2 are induced by TGF-&#946; signaling and contribute to gene reprogramming in EndMT8.
Snail has been frequently identified as a key factor in EndMT. Snail binds to the promoter of genes encoding cell-cell adhesion proteins and suppresses their transcription, which is counterbalanced by the enhancement of the expression of mesenchymal proteins9. Endothelial cells comprise a very heterogeneous population and the relative influence of diverse extracellular stimuli on EndMT may differ among endothelial cellular contexts or cell types10. Due to its similarities with EMT, some methodologies are useful to investigate both mechanisms EMT and EndMT8. In this regard, the EMT International Association (TEMTIA) strongly emphasizes the need of complementary techniques to ultimately demonstrate the occurrence of EMT/EndMT11.
Here we describe a method to monitor and visualize the TGF-&#946;-induced EndMT process. Immunofluorescence staining provides the basic information about expression changes in targeted proteins/markers, which are used as indicators of whether the EndMT process occurs. Additionally, the immunofluorescence staining can visualize the localization of proteins/markers and cell morphology. To study the potential activity of specific TFs (or other upstream or downstream regulators) involved in TGF-&#946; mediated EndMT, we describe a protocol using clustered regularly interspaced short palindromic repeats (CRISPR) /CRISPR-associated protein 9 (Cas9) gene editing to deplete specific genes from cells, using the TF Snail as an example. Cas9 is a dual RNA-guided DNA endonuclease that recognizes and cleaves sequences complementary to CRISPR sequences in bacteria12. The CRISPR/Cas9 system is currently extensively utilized because it facilitates genetic engineering in vitro and in vivo13. Directed by a single guide RNA (sgRNA), ectopically expressed Cas9 generates a double strand break at a preselected targeting sequence in a specific gene locus. Non-homologous end joining (NHEJ) takes place to repair Cas9-induced strand breaks, via random nucleotide insertions or deletions thereby leading to the disruption and inactivation of the targeted gene. We describe in detail methods for designing selective sgRNAs and generating lentiviral-compatible vectors containing the designed sgRNAs. As a result, stable gene-depleted endothelial cells can be generated in an efficient and reliable manner.
In this study, we used murine pancreatic microvascular endothelial cells (MS-1)14 as a model system to examine the TGF-&#946;2-induced EndMT process. Our previous study demonstrated that Snail is the main transcription factor increased by TGF-&#946;2, by which EndMT is induced in MS-1 cells15. Upon CRISPR/Cas9 gene editing to abrogate Snail expression in MS-1 cells, TGF-&#946;2 failed to mediate EndMT. This workflow can be applied to study other (suspected) EndMT-related genes.

<table><tbody><tr><td>0.45 &amp;mu;m filter</td><td>Pall Corporation, USA</td><td>4614</td><td></td></tr><tr><td>10&amp;times; T4 DNA ligase buffer</td><td>Thermofisher Scientific, USA</td><td>B69</td><td></td></tr><tr><td>12 mm round glass slice</td><td>Knittel Glass,Germany</td><td>VD10012Y1A.01</td><td></td></tr><tr><td>20 mL syringe</td><td>BD Eclipse, USA</td><td>300629</td><td></td></tr><tr><td>4&amp;prime;,6-diamidino-2-phenylindole (DAPI)</td><td>Vector Laboratories, USA</td><td>H-1200</td><td>VECTASHIELD Antifade&amp;nbsp;Mounting Media</td></tr><tr><td>AA19_PLKO vector</td><td>Dr. M Gon&amp;ccedil;alves, Leiden University Medical Center, Netherlands</td><td></td><td>Gift</td></tr><tr><td>Ampicillin</td><td>Serva Electrophoresis, USA</td><td>1339903</td><td></td></tr><tr><td>Anti-Mouse IgG</td><td>GE Healthcare, USA</td><td>NA931</td><td></td></tr><tr><td>Anti-Rabbit IgG</td><td>Cell signaling, USA</td><td>7074</td><td></td></tr><tr><td>Agarose</td><td>Roche, Switzerland</td><td>11388991001</td><td></td></tr><tr><td>Blasticidin</td><td>Invitrogen, USA</td><td>R21001</td><td></td></tr><tr><td>Buffer O (10X)</td><td>Thermofisher Scientific, USA</td><td>BO5</td><td></td></tr><tr><td>BveI (Bspm1)</td><td>Thermofisher Scientific, USA</td><td>ER 1741</td><td></td></tr><tr><td>Confocal microscope</td><td>Leica Microsystems, Germany</td><td>SP8</td><td></td></tr><tr><td>DMEM</td><td>&amp;nbsp;Thermo Fisher Scientific, USA</td><td>11965092</td><td></td></tr><tr><td>Donkey anti-rat Alexa 488</td><td>&amp;nbsp;Invitrogen, USA</td><td>A21208</td><td></td></tr><tr><td>FBS</td><td>&amp;nbsp;Thermo Fisher Scientific, USA</td><td>16000044</td><td></td></tr><tr><td>Formaldehyde</td><td>&amp;nbsp;Thermo Fisher Scientific, USA</td><td>28908</td><td></td></tr><tr><td>Inverted microscope</td><td>Leica Microsystems, Germany</td><td>DMi8</td><td></td></tr><tr><td>Goat anti-rabbit Alexa 594</td><td>&amp;nbsp;Invitrogen,USA</td><td>A11012</td><td></td></tr><tr><td>LabNed Plasmid kit</td><td>LabNed, USA</td><td>LN2400004</td><td></td></tr><tr><td>MS-1 cell line</td><td>American Type Culture Collection (ATCC)</td><td></td><td></td></tr><tr><td>Nail polish</td><td>HEMA, Netherlands</td><td></td><td>Transparent</td></tr><tr><td>Pecam-1 antibody</td><td>&amp;nbsp;Becton Dickinson,USA</td><td>553370</td><td></td></tr><tr><td>PEI</td><td>Polysciences, USA</td><td>23966-1</td><td></td></tr><tr><td>PLV-Cas9 plasmid</td><td>Sigma-Aldrich, USA</td><td>Cas9BST-1EA</td><td></td></tr><tr><td>Puromycin</td><td>Sigma-Aldrich, USA</td><td>P9620</td><td></td></tr><tr><td>QIAquick gel extraction kit</td><td>Qiagen, Germany</td><td>28706</td><td></td></tr><tr><td>Sm22a antibody</td><td>&amp;nbsp;Abcam, UK</td><td>ab14106</td><td></td></tr><tr><td>Snail</td><td>Cell signaling, USA</td><td>3879</td><td></td></tr><tr><td>T4 DNA ligase</td><td>Thermofisher Scientific, USA</td><td>EL 0014</td><td></td></tr><tr><td>TC20 automated Cell Counter</td><td>Bio-Rad, USA</td><td>1450102</td><td></td></tr><tr><td>Human TGF-&amp;beta;2</td><td>Joachim Nickel, University of Wurzburg</td><td>Gift</td><td>Other commercial recommendation: 302-B2, R&amp;amp;D systems</td></tr><tr><td>Triton X-100</td><td>Merck, USA</td><td>1086031000</td><td></td></tr><tr><td>SB431542</td><td>Tocris Bioscience, UK</td><td>1614</td><td></td></tr><tr><td>Tris</td><td>Roche, Switzerland</td><td>11814273001</td><td></td></tr></tbody></table>

tgf-&#946;-mediated endothelial to mesenchymal transition (endmt) and the functional assessment of endmt effectors using crispr/cas9 gene editing

In response to specific external cues and the activation of certain transcription factors, endothelial cells can differentiate into a mesenchymal-like phenotype, a process that is termed endothelial to mesenchymal transition (EndMT). Emerging results have suggested that EndMT is causally linked to multiple human diseases, such as fibrosis and cancer. In addition, endothelial-derived mesenchymal cells may be applied in tissue regeneration procedures, as they can be further differentiated into various cell types (e.g., osteoblasts and chondrocytes). Thus, the selective manipulation of EndMT may have clinical potential. Like epithelial-mesenchymal transition (EMT), EndMT can be strongly induced by the secreted cytokine transforming growth factor-beta (TGF-&#946;), which stimulates the expression of so-called EndMT transcription factors (EndMT-TFs), including Snail and Slug. These EndMT-TFs then up- and downregulate the levels of mesenchymal and endothelial proteins, respectively. Here, we describe methods to investigate TGF-&#946;-induced EndMT in vitro, including a protocol to study the role of particular TFs in TGF-&#946;-induced EndMT. Using these techniques, we provide evidence that TGF-&#946;2 stimulates EndMT in murine pancreatic microvascular endothelial cells (MS-1 cells), and that the genetic depletion of Snail using clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9)-mediated gene editing, abrogates this phenomenon. This approach may serve as a model to interrogate potential modulators of endothelial biology, and can be used to perform genetic or pharmacological screens in order to identify novel regulators of EndMT, with potential application in human disease.

TGF-&#946;2 induces EndMT and stimulates Snail expression in MS-1 endothelial cells 
TGF-&#946; is one of the cytokines with greatest potential to induce EndMT. After treating MS-1 cells with TGF-&#946;2 (1 ng/mL) for 3 days, endothelial MS-1 cells lose their cobblestone-like structure and differentiate into spindle-shaped mesenchymal-like cells (Figure 1A)15. To further verify the role of TGF-&#946;2 in inducing cell phenotypic changes, we pre-treated the cells with the small molecule activin receptor-like kinase (ALK)4/ALK5/ALK7 inhibitor SB431542 before TGF-&#946;2 stimulation19. SB431542 completely abrogated TGF-&#946;2-induced cell morphology changes (Figure 1A). The TGF-&#946;2 induced EndMT process was further investigated by studying changes in the expression of EndMT-related markers. As shown in Figure 1B, the endothelial protein Pecam-1 was potently decreased after TGF-&#946;2 stimulation, while the mesenchymal factor Sm22&#945; was profoundly upregulated by TGF-&#946;215. These data are consistent with the notion that TGF-&#946;2 triggered EndMT in MS-1 cells. Next, we investigated the effects of TGF-&#946;2 on Snail and Slug expression. As shown in Figure 1C, Snail was markedly upregulated by TGF-&#946;2, while Slug expression was not influenced by TGF-&#946;2 in MS-1 cells15. The quantification of Snail expression from three independent experiments is shown in Figure 1D.
Depletion of Snail by CRISPR/Cas9 in MS-1 endothelial cells 
As Snail was induced by TGF-&#946;2 and likely involved in TGF-&#946;2-mediated EndMT, we performed CRISPR/Cas9 gene editing to genetically deplete Snail expression in MS-1 cells. We hypothesized that the depletion of Snail would be sufficient to inhibit TGF-&#946;2-induced EndMT. As shown in Figure 2A, we generated Snail knockout cells in two steps. Firstly, Cas9 was ectopically expressed by infecting MS-1 cells with a Cas9 expressing lentivirus. Since there is a blasticidin resistance cassette in the pLV-Cas9 construct, we checked the expression of Cas9 by Western blot analysis in blasticidin resistant cells (Figure 2D). Subsequently, we introduced sgRNAs that specifically targeted Snail to disrupt its protein expression. This procedure was also performed by infection with lentiviral particles carrying the AA19 pLKO.1-Snail-sgRNA construct, which includes a puromycin expression cassette. Cas9-expressing cells were again infected with gRNA containing lentivirus and further selected with puromycin. Two complementary sgRNA&#160;oligos targeting murine Snail were designed with a predicted low off-target activity (Figure 2B,C). After introducing two independent Snail sgRNAs in Cas9 expressing MS-1 cells, Snail protein expression was abrogated (Figure 2D)15.
Deficiency of Snail inhibits&#160;TGF-&#946;2-induced EndMT in&#160;MS-1 cells 
To demonstrate the function of Snail in TGF-&#946;2-mediated EndMT, we performed an EndMT assay in Snail-depleted cells and compared it with parental MS-1 cells. As shown in Figure 3A, the knockout of Snail was sufficient to inhibit the fibroblast-like cell morphology driven by TGF-&#946;2 in MS-1 cells15. In addition, the TGF-&#946;2-mediated decline in Pecam-1 and enhancement of Sm22&#945; were completely blocked in Snail-depleted MS-1 cells. In summary, we demonstrated that Snail is critical for TGF-&#946;2-mediated EndMT in MS-1 cells (Figure 3B)15.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/62198/62198fig1v2.jpg" /> 
Figure 1. TGF-&#946;2 induces EndMT and Snail expression in MS-1 cells. A. Effects of TGF-&#946;2 and/or TGF-&#946; type I receptor kinase inhibitor&#160;SB-431542 on cell morphology. Brightfield images of MS-1 cells upon treatment with TGF-&#946;2 (1 ng/mL) and/or SB-431542 (SB, 5 &#181;M, administered 30 min prior to TGF-&#946;2) for 2 days. Scale bar represents 200 &#181;m. B. Immunofluorescence staining of Pecam-1 (green) and Sm22&#945; (red) in MS-1 cells cultured in medium containing TGF-&#946;2 (1 ng/mL) for 3 days. Nuclei are visualized in blue (DAPI). Scale bar: 50 &#181;m. C. Western blot with whole cell lysate of TGF-&#946;2 stimulated MS-1 cells. The expression of Snail, but not Slug, was enhanced by TGF-&#946;2 stimulation, as previously reported in Ma et al15. D. Quantification of Snail expression by integrating the results from three independent western blot experiments. <a href="https://www.jove.com/files/ftp_upload/62198/62198fig1v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/62198/62198fig2v2.jpg" /> 
Figure 2. Depletion of Snail by CRISPR-Cas9 gene editing. A. Scheme depicting how to generate Snail knockout cells. Bsd: Blasticidin. Puro: Puromycin. B. Oligonucleotides of two independent sgRNAs targeting Snail using CHOPCHOP (http://chopchop.cbu.uib.no/)&#160;and Cas-OFFinder&#160;(http://www.rgenome.net/cas-offinder/).&#160;C. The predicted off-target activity of the two gRNAs for Snail using&#160;Cas-OFFinder (http://www.rgenome.net/cas-offinder/).&#160;D. Cas9 and Snail expression in wild type (WT) and Cas9-overexpressed MS-1 measured by Western blot analysis. E. Knockout of Snail with two independent gRNAs in MS-1 cells as measured by Western blot analysis. We reported similar results in Ma et al15. <a href="https://www.jove.com/files/ftp_upload/62198/62198fig2v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/62198/62198fig3v2.jpg" /> 
Figure 3. Genetic depletion of Snail inhibits TGF-&#946;2-induced EndMT in MS-1 cells. A. Brightfield images of MS-1 cells upon treatment with TGF-&#946;2 (0.1 ng/mL) for 3 days in wildtype (WT, upper panel) and Snail knocked out (lower panel) cells. Scale bar represents 200 &#181;m. B. Immunofluorescent staining for Pecam-1 (green), Sm22&#945; (red) and nuclei (blue) of MS-1 cells cultured in medium containing TGF-&#946;2 (1 ng/mL) for 3 days. Depletion of Snail abrogated TGF-&#946;2-induced decrease of Pecam-1 and increase of Sm22&#945; expression. Scale bar represents 50 &#181;m. C. Schematic representation of the effect of Snail knockout on TGF-&#946;-induced EndMT in MS-1 cells. TGF-&#946; stimulates the expression of Snail through Smad pathway by phosphorylating Smad2/3 and further drives EndMT. Knocking out Snail using CRISPR/Cas9-based gene editing abrogated TGF-&#946;-mediated EndMT. <a href="https://www.jove.com/files/ftp_upload/62198/62198fig3v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about TGF-Î²-mediated Endothelial to Mesenchymal Transition EndMT and the Functional Assessment of EndMT Effectors using CRISPR/Cas9 Gene Editing at JoVE.com

TGF-&#946;-mediated Endothelial to Mesenchymal Transition EndMT and the Functional Assessment of EndMT Effectors using CRISPR/Cas9 Gene Editing

We describe methods to investigate TGF-&#946;2-induced EndMT in endothelial cells by observing cell morphology changes and examining the expression EndMT-related marker changes using immunofluorescence staining. CRISPR/Cas9 gene editing was described and used to deplete the gene encoding Snail to investigate its role in TGF-&#946;2-induced EndMT.

TGF-&#946;-mediated Endothelial to Mesenchymal Transition (EndMT) and the Functional Assessment of EndMT Effectors using CRISPR/Cas9 Gene Editing

In response to specific external cues and the activation of certain transcription factors, endothelial cells can differentiate into a mesenchymal-like ...

tgf-mediated-endothelial-to-mesenchymal-transition-endmt-functional

Research

JoVE Journal

Biology

5.1K Views.  Leiden University Medical Center. Endotheel naar mesenchymale overgang is een cellulair proces waarbij endotheelcellen hun kasseienmorfologie veranderen in een fibroblast-achtig fenotype. En de cytokine TGF-beta, die groeifactor bèta transformeert, is een belangrijke drijfveer voor deze overgang. Analyse van de veranderingen in de celmorfologie en de expressieniveaus van endotheel- en mesenchymale markers stelt ons in staat om het optreden van endotheel- naar mesenchymale overgang te beoordelen.Opkomende gegevens kopp...

Video: TGF-β-mediated Endothelial to Mesenchymal Transition EndMT and the Functional Assessment of EndMT Effectors using CRISPR/Cas9 Gene Editing

Using CRISPR/Cas9 Gene Editing to Investigate the Oncogenic Activity of Mutant Calreticulin in Cytokine Dependent Hematopoietic Cells

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to generate RNA-guided nucleases, such as CRISPR-associated (Cas) 9 for site-specific eukaryotic genome editing. Genome engineering by Cas9 is used to efficiently, easily and robustly modify endogenous genes in many biomedically-relevant mammalian cell lines and organisms. Here we show an example of how to utilize the CRISPR/Cas9 methodology to understand the biological function of specific genetic mutations. We model calreticulin (CALR) mutations in murine interleukin-3 (mIL-3) dependent pro-B (Ba/F3) cells by delivery of single guide RNAs (sgRNAs) targeting the endogenous Calr locus in the specific region where insertion and/or deletion (indel) CALR mutations occur in patients with myeloproliferative neoplasms (MPN), a type of blood cancer. The sgRNAs create double strand breaks (DSBs) in the targeted region that are repaired by non-homologous end joining (NHEJ) to give indels of various sizes. We then employ the standard Ba/F3 cellular transformation assay to understand the effect of physiological level expression of Calr mutations on hematopoietic cellular transformation. This approach can be applied to other genes to study their biological function in various mammalian cell lines.

Targeted gene editing using CRISPR/Cas9 has greatly facilitated the understanding of the biological functions of genes. Here, we utilize the CRISPR/Cas9 methodology to model calreticulin mutations in cytokine-dependent hematopoietic cells in order to study their oncogenic activity.

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to ...

Cancer Research

Generating CRISPR/Cas9 Mediated Monoallelic Deletions to Study Enhancer Function in Mouse Embryonic Stem Cells

Enhancers control cell identity by regulating tissue-specific gene expression in a position and orientation independent manner. These enhancers are often located distally from the regulated gene in intergenic regions or even within the body of another gene. The position independent nature of enhancer activity makes it difficult to match enhancers with the genes they regulate. Deletion of an enhancer region provides direct evidence for enhancer activity and is the gold standard to reveal an enhancer's role in endogenous gene transcription. Conventional homologous recombination based deletion methods have been surpassed by recent advances in genome editing technology which enable rapid and precisely located changes to the genomes of numerous model organisms. CRISPR/Cas9 mediated genome editing can be used to manipulate the genome in many cell types and organisms rapidly and cost effectively, due to the ease with which Cas9 can be targeted to the genome by a guide RNA from a bespoke expression plasmid. Homozygous deletion of essential gene regulatory elements might lead to lethality or alter cellular phenotype whereas monoallelic deletion of transcriptional enhancers allows for the study of cis-regulation of gene expression without this confounding issue. Presented here is a protocol for CRISPR/Cas9 mediated deletion in F1 mouse embryonic stem (ES) cells (Mus musculus129 x Mus castaneus). Monoallelic deletion, screening and expression analysis is facilitated by single nucleotide polymorphisms (SNP) between the two alleles which occur on average every 125 bp in these cells.

Experimental validation of enhancer activity is best approached by loss-of-function analysis. Presented here is an efficient protocol that uses CRISPR/Cas9 mediated deletion to study allele-specific regulation of gene transcription in F1 ES cells which contain a hybrid genome (Mus musculus129 x Mus castaneus).

Enhancers control cell identity by regulating tissue-specific gene expression in a position and orientation independent manner. These enhancers are often ...

Developmental Biology

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration of transgenes. However, due to the low efficiency of homologous recombination (HR) and various indel mutations of non-homologous end joining (NHEJ)-based strategies in non-dividing cells, in vivo genome editing remains a great challenge. Here, we describe a homology-mediated end joining (HMEJ)-based CRISPR/Cas9 system for efficient in vivo precise targeted integration. In this system, the targeted genome and the donor vector containing homology arms (~800 bp) flanked by single guide RNA (sgRNA) target sequences are cleaved by CRISPR/Cas9. This HMEJ-based strategy achieves efficient transgene integration in mouse zygotes, as well as in hepatocytes in vivo. Moreover, a HMEJ-based strategy offers an efficient approach for correction of fumarylacetoacetate hydrolase (Fah) mutation in the hepatocytes and rescues Fah-deficiency induced liver failure mice. Taken together, focusing on targeted integration, this HMEJ-based strategy provides a promising tool for a variety of applications, including generation of genetically modified animal models and targeted gene therapies.

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

The clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9 (CRISPR/Cas9) system provides a promising tool for genetic engineering, and opens up the possibility of targeted integration of transgenes. We describe a homology-mediated end joining (HMEJ)-based strategy for efficient DNA targeted integration in vivo and targeted gene therapies using CRISPR/Cas9.

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration ...

Genetics

A New Toolkit for Evaluating Gene Functions using Conditional Cas9 Stabilization

The clustered regularly interspaced short palindromic repeat- (CRISPR-) associated protein 9 (CRISPR/Cas9) technology has become a prevalent laboratory tool to introduce accurate and targeted modifications in the genome. Its enormous popularity and rapid spread are attributed to its easy use and accuracy compared to its predecessors. Yet, the constitutive activation of the system has limited applications. In this paper, we describe a new method that allows temporal control of CRISPR/Cas9 activity based on conditional stabilization of the Cas9 protein. Fusing an engineered mutant of the rapamycin-binding protein FKBP12 to Cas9 (DD-Cas9) enables the rapid degradation of Cas9 that in turn can be stabilized by the presence of an FKBP12 synthetic ligand (Shield-1). Unlike other inducible methods, this system can be adapted easily to generate bi-cistronic systems to co-express DD-Cas9 with another gene of interest, without conditional regulation of the second gene. This method enables the generation of traceable systems as well as the parallel, independent manipulation of alleles targeted by Cas9 nuclease. The platform of this method can be used for the systematic identification and characterization of essential genes and the interrogation of the functional interactions of genes in in vitro and in vivo settings.

Here, we describe a genome-editing tool based on the temporal and conditional stabilization of clustered regularly interspaced short palindromic repeat- (CRISPR-) associated protein 9 (Cas9) under the small molecule, Shield-1. The method can be used for cultured cells and animal models.

The clustered regularly interspaced short palindromic repeat- (CRISPR-) associated protein 9 (CRISPR/Cas9) technology has become a prevalent laboratory ...

Studying TGF-&#946; Signaling and TGF-&#946;-induced Epithelial-to-mesenchymal Transition in Breast Cancer and Normal Cells

Transforming growth factor-&#946; (TGF-&#946;) is a secreted multifunctional factor that plays a key role in intercellular communication. Perturbations of TGF-&#946; signaling can lead to breast cancer. TGF-&#946; elicits its effects on proliferation and differentiation via specific cell surface TGF-&#946; type I and type II receptors (i.e., T&#946;RI and T&#946;RII) that contain an intrinsic serine/threonine kinase domain. Upon TGF-&#946;-induced heteromeric complex formation, activated T&#946;RI elicits intracellular signaling by phosphorylating SMAD2 and SMAD3. These activated SMADs form heteromeric complexes with SMAD4 to regulate specific target genes, including plasminogen activation inhibitor 1 (PAI-1, encoded by the SERPINE1 gene). The induction of epithelial-to-mesenchymal transition (EMT) allows epithelial cancer cells at the primary site or during colonization at distant sites to gain an invasive phenotype and drive tumor progression. TGF-&#946; acts as a potent inducer of breast cancer invasion by driving EMT. Here, we describe systematic methods to investigate TGF-&#946; signaling and EMT responses using premalignant human MCF10A-RAS (M2) cells and mouse NMuMG epithelial cells as examples. We describe methods to determine TGF-&#946;-induced SMAD2 phosphorylation by Western blotting, SMAD3/SMAD4-dependent transcriptional activity using luciferase reporter activity and SERPINE1 target gene expression by quantitative real-time-polymerase chain reaction (qRT-PCR). In addition, methods are described to examine TGF-&#946;-induced EMT by measuring changes in morphology, epithelial and mesenchymal marker expression, filamentous actin staining and immunofluorescence staining of E-cadherin. Two selective small molecule TGF-&#946; receptor kinase inhibitors, GW788388 and SB431542, were used to block TGF-&#946;-induced SMAD2 phosphorylation, target genes and changes in EMT marker expression. Moreover, we describe the transdifferentiation of mesenchymal breast Py2T murine epithelial tumor cells into adipocytes. Methods to examine TGF-&#946;-induced signaling and EMT in breast cancer may contribute to new therapeutic approaches for breast cancer.

We describe a systematic workflow to investigate TGF-&#946; signaling and TGF-&#946;-induced EMT by studying the protein and gene expression involved in this signaling pathway. The methods include Western blotting, a luciferase reporter assay, qPCR, and immunofluorescence staining.

Transforming growth factor-&#946; (TGF-&#946;) is a secreted multifunctional factor that plays a key role in intercellular communication. Perturbations of ...

Suppression of Pro-fibrotic Signaling Potentiates Factor-mediated Reprogramming of Mouse Embryonic Fibroblasts into Induced Cardiomyocytes

Trans-differentiation of one somatic cell type into another has enormous potential to model and treat human diseases. Previous studies have shown that mouse embryonic, dermal, and cardiac fibroblasts can be reprogrammed into functional induced-cardiomyocyte-like cells (iCMs) through overexpression of cardiogenic transcription factors including GATA4, Hand2, Mef2c, and Tbx5 both in vitro and in vivo. However, these previous studies have shown relatively low efficiency. In order to restore heart function following injury, mechanisms governing cardiac reprogramming must be elucidated to increase efficiency and maturation of iCMs.
We previously demonstrated that inhibition of pro-fibrotic signaling dramatically increases reprogramming efficiency. Here, we detail methods to achieve a reprogramming efficiency of up to 60%. Furthermore, we describe several methods including flow cytometry, immunofluorescent imaging, and calcium imaging to quantify reprogramming efficiency and maturation of reprogrammed fibroblasts. Using the protocol detailed here, mechanistic studies can be undertaken to determine positive and negative regulators of cardiac reprogramming. These studies may identify signaling pathways that can be targeted to promote reprogramming efficiency and maturation, which could lead to novel cell therapies to treat human heart disease.

Here we present a robust method to reprogram primary embryonic fibroblasts into functional cardiomyocytes through overexpression of GATA4, Hand2, Mef2c, Tbx5, miR-1, and miR-133 (GHMT2m) alongside inhibition of TGF-&#946; signaling. Our protocol generates beating cardiomyocytes as early as 7 days post-transduction with up to 60% efficiency.

Trans-differentiation of one somatic cell type into another has enormous potential to model and treat human diseases. Previous studies have shown that ...

Isolation and Culture Expansion of Tumor-specific Endothelial Cells

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model for developing new angiogenesis inhibitors for cancer. However, long-term in vitro expansion of murine endothelial cells (EC) is challenging due to phenotypic drift in culture (endothelial-to-mesenchymal transition) and contamination with non-EC. This is especially true for TEC which are readily outcompeted by co-purified fibroblasts or tumor cells in culture. Here, a high fidelity isolation method that takes advantage of immunomagnetic enrichment coupled with colony selection and in vitro expansion is described. This approach generates pure EC fractions that are entirely free of contaminating stromal or tumor cells. It is also shown that lineage-traced Cdh5cre:ZsGreenl/s/l reporter mice, used with the protocol described herein, are a valuable tool to verify cell purity as the isolated EC colonies from these mice show durable and brilliant ZsGreen fluorescence in culture.

We report a reliable method to isolate and culture primary tumor-specific endothelial cells from genetically engineered mouse models.

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model ...

Medicine

Lentiviral CRISPR/Cas9-Mediated Genome Editing for the Study of Hematopoietic Cells in Disease Models

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting from advances in genome editing technology and lentivirus-mediated transgene delivery systems, an efficient and economical method is described here that establishes mice in which genes are manipulated specifically in hematopoietic stem cells. Lentiviruses are used to transduce Cas9-expressing lineage-negative bone marrow cells with a guide RNA (gRNA) targeting specific genes and a red fluorescence reporter gene (RFP), then these cells are transplanted into lethally-irradiated C57BL/6 mice. Mice transplanted with lentivirus expressing non-targeting gRNA are used as controls. Engraftment of transduced hematopoietic stem cells are evaluated by flow cytometric analysis of RFP-positive leukocytes of peripheral blood. Using this method, ~90% transduction of myeloid cells and ~70% of lymphoid cells at 4 weeks after transplantation can be achieved. Genomic DNA is isolated from RFP-positive blood cells, and portions of the targeted site DNA are amplified by PCR to validate the genome editing. This protocol provides a high-throughput evaluation of hematopoiesis-regulatory genes and can be extended to a variety of mouse disease models with hematopoietic cell involvement.

Described are protocols for the highly efficient genome editing of murine hematopoietic stem and progenitor cells (HSPC) by the CRISPR/Cas9 system to rapidly develop mouse model systems with hematopoietic system-specific gene modifications.

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting ...

Immunology and Infection

Fabricating Mouse Tendon Assembloids to Study Cellular Interactions in Disease

Engineering Tendon Assembloids to Probe Cellular Crosstalk in Disease and Repair

Tendons enable locomotion by transferring muscle forces to bones. They rely on a tough tendon core comprising collagen fibers and stromal cell populations. This load-bearing core is encompassed, nourished, and repaired by a synovial-like tissue layer comprising the extrinsic tendon compartment. Despite this sophisticated design, tendon injuries are common, and clinical treatment still relies on physiotherapy and surgery. The limitations of available experimental model systems have slowed the development of novel disease-modifying treatments and relapse-preventing clinical regimes. 
In vivo human studies are limited to comparing healthy tendons to end-stage diseased or ruptured tissues sampled during repair surgery and do not allow the longitudinal study of the underlying tendon disease. In vivo animal models also present important limits regarding opaque physiological complexity, the ethical burden on the animals, and large economic costs associated with their use. Further, in vivo animal models are poorly suited to systematic probing of drugs and multicellular, multi-tissue interaction pathways. Simpler in vitro model systems have also fallen short. One major reason is a failure to adequately replicate the three-dimensional mechanical loading necessary to meaningfully study tendon cells and their function. 
The new 3D model system presented here alleviates some of these issues by exploiting murine tail tendon core explants. Importantly, these explants are easily accessible in large numbers from a single mouse, retain 3D in situ loading patterns at the cellular level, and feature an in vivo-like extracellular matrix. In this protocol, step-by-step instructions are given on how to augment tendon core explants with collagen hydrogels laden with muscle-derived endothelial cells, tendon-derived fibroblasts, and bone marrow-derived macrophages to substitute disease- and injury-activated cell populations within the extrinsic tendon compartment. It is demonstrated how the resulting tendon assembloids can be challenged mechanically or through defined microenvironmental stimuli to investigate emerging multicellular crosstalk during disease and injury.

Author Spotlight: Advancing Tendon Research by Developing Mouse Assembloids to Understand Cellular Mechanisms

Here, we present an assembloid model system to mimic tendon cellular crosstalk between the load-bearing tendon core tissue and an extrinsic compartment containing cell populations activated by disease and injury. As an important use case, we demonstrate how the system can be deployed to probe disease-relevant activation of extrinsic endothelial cells.

Tendons enable locomotion by transferring muscle forces to bones. They rely on a tough tendon core comprising collagen fibers and stromal cell ...

Bioengineering

Molecular Analysis of Endothelial-mesenchymal Transition Induced by Transforming Growth Factor-&#946; Signaling

Phenotypic plasticity of endothelial cells underlies cardiovascular system development, cardiovascular diseases, and various conditions associated with organ fibrosis. In these conditions, differentiated endothelial cells acquire mesenchymal-like phenotypes. This process is called endothelial-mesenchymal transition (EndMT) and is characterized by downregulation of endothelial markers, upregulation of mesenchymal markers, and morphological changes. EndMT is induced by several signaling pathways, including transforming growth factor (TGF)-&#946;, Wnt, and Notch, and regulated by molecular mechanisms similar to those of epithelial-mesenchymal transition (EMT) important for gastrulation, tissue fibrosis, and cancer metastasis. Understanding the mechanisms of EndMT is important to develop diagnostic and therapeutic approaches targeting EndMT. Robust induction of EndMT in vitro is useful to characterize common gene expression signatures, identify druggable molecular mechanisms, and screen for modulators of EndMT. Here, we describe an in vitro method for induction of EndMT. MS-1 mouse pancreatic microvascular endothelial cells undergo EndMT after prolonged exposure to TGF-&#946; and show upregulation of mesenchymal markers and morphological changes as well as induction of multiple inflammatory chemokines and cytokines. Methods for the analysis of microRNA (miRNA) modulation are also included. These methods provide a platform to investigate mechanisms underlying EndMT and the contribution of miRNAs to EndMT.

A protocol for in vitro induction of endothelial-mesenchymal transition (EndMT), which is useful for investigating cellular signaling pathways involved in EndMT, is described. In this experimental model, EndMT is induced by treatment with TGF-&#946; in MS-1 endothelial cells.

Phenotypic plasticity of endothelial cells underlies cardiovascular system development, cardiovascular diseases, and various conditions associated with ...

TGF-β-mediated Endothelial to Mesenchymal Transition (EndMT) and the Functional Assessment of EndMT Effectors using CRISPR/Cas9 Gene Editing

Samenvatting

Meer video's verkennen