The authors would like to thank Ekaterina V. Nikitina for kindly providing gDNA of EBV. Muhannad Ateiah, Maria Y. Berezovskaya, and Maria S. Rubel thank the Ministry of Education and Science of the Russian Federation (Grant No FSER-2022-0009) and the Priority 2030 program.

1. DNM design
<ol>
	<li>Select a unique region within the genome of interest. 
	NOTE: This work uses a region of the Epstein-Barr virus (EBV) genome in positions 13972-14154 (OR652423.1).</li>
	<li>Create a primer set for the amplification of the selected fragment, for example, via Primer3 tool embedded in Ugene26.</li>
	<li>Open the UNAFold web tool27 (see Table of Materials) and insert the selected region. Change&#160;the folding temperature to 55 &#176;C, and ionic conditions to 250 mM of monovalent ions, and 200 mM of Mg2+.
	<ol>
		<li>Open the resulting secondary structure of the ssDNA fragment and select a stable hairpin. Locate the DNA-nanomachines&#39; binding site in the&#160;unstructured regions or, alternatively, on the loops of the hairpin structures to achieve a stronger binding of the target.</li>
	</ol>
	</li>
	<li>If the targeted analyte site is folded in a stem-loop structure, place Arm 1 and 2 as follows: Ensure that Arm 2 binds one side of the stem, the loop, and 3-5 nt of the second stem side; Arm 1 binds a fragment of the second stem side.</li>
	<li>Open the DinaMelt tool28 (see Table of Materials) and analyze the sequences of the arms and their reverse-complement sequences. Use the DinaMelt tool to make sure that the Tm of Arms 2 and 3 is above 65 &#176;C: at least 10 &#176;C above the assay temperature (55 &#176;C).
	<ol>
		<li>Keep the Tm of Arm 1 at least 1-3 &#176;C above the reaction temperature (55&#160;&#176;C) if high recognition selectivity is&#160;to be achieved29.</li>
	</ol>
	</li>
	<li>Combine Arms 1 and 2 sequences with the DNAzyme core&#39;s halves and the F-sub binding fragments13.</li>
	<li>Analyze the secondary structure of the designed DNA strands using UNAFold27. 
	NOTE: 55 &#176;C (assay temperature), 200 mM Mg2+, 250 mM monovalent ions (HEPES, Na+, K+).
	<ol>
		<li>Use the design only if the folding &#916;G is lower than - 4 kcal/mol. Try to avoid long CG-rich sequences. If the secondary structure is too stable, introduce a mutation to the Arm to increase the folding &#916;G30. Alternatively, placing Arm 3 2-3 nt away from Arm 2 is another strategy to change the Arm 3&#160;sequence to avoid stable intermolecular structures.</li>
	</ol>
	</li>
	<li>Create a random sequence for the DNA tile fragment as long as Arm 3. Combine the Arm 3 sequence with the DNA tile sequence via (dT)4-6 or ethylene glycol (e.g., triethylene glycol (TEG) or hexaethylene glycol (HEG)). The DNM version presented in the experiment uses (dT)6.</li>
	<li>Link Arm 2 with the sequence complementary to the DNA tile fragment selected in step 1.8 via a linker.</li>
	<li>Analyze the secondary structure of the designed DNA strands using the UNAFold web app. Ensure that the folding energy of each DNA strand is above 4 kJ/mol at 55 &#176;C, and avoid long CG-enriched sequences. Preferably, change the DNA tile sequence.</li>
	<li>Draw the structure using any available vector graphics software. This article uses Biorender and Pixelmator Pro for visualization (see Table of Materials). Verify accuracy in 5&#39;-&#62;3&#39; directions for each strand. 
	NOTE: Obtain the sequences from a reliable commercial vendor.</li>
</ol>
2. Functional test of the DNM
<ol>
	<li>Preparation of buffer and reagents
	<ol>
		<li>Prepare the&#160;reaction buffer composed of 50 mM HEPES (pH 7.5-7.8), 50 mM NaCl, 150 mM KCl, and 200 mM MgCl2. Fill with the&#160;deionized water up to 50 mL.</li>
		<li>Prepare 10 &#181;M aliquots of Dzb-Tile and Tile-Arm3 oligonucleotides. Prepare 1 &#181;M solution of the Dza, a 100 &#181;M F-sub, and 1 nM, 10 nM, 100 nM analytes in RNase/free water or sterile deionized water. The details of the oligonucleotide sequences are provided in the Table of Materials.</li>
	</ol>
	</li>
	<li>DNM assembly
	<ol>
		<li>Thaw the oligonucleotide solutions completely before using. Gently mix by tapping (do not intensively vortex). Spin down (rapidly, for a few seconds) the solution using a microcentrifuge.</li>
		<li>Mix 1 &#181;M each of Dzb-Tile and Tile-Arm3 in 200 &#181;L of the reaction buffer in 0.5 mL microcentrifuge tubes.</li>
		<li>Mix the tube gently and spin down the solution.</li>
		<li>Wrap the lid of the closed tube with paraffin film. Alternatively, use screw cap tubes.</li>
		<li>Incubate the tube into a 500 mL beaker with boiling water for 2 min, then turn the heater off and let the temperature passively cool down overnight.</li>
		<li>Prepare the 12% native PAGE: Mix 1 mL of 10&#1093; TBE buffer, 3 mL of 40% AA:BA, deionized water up to 10 mL, 50 &#181;L of APS, and 5 &#181;L of TEMED (see Table of Materials). Move the mixture to the gel cassette and let it polymerize.</li>
		<li>Mix 1 &#181;L of each sample, namely, the assembled DNM, Dzb-Tile, and Tile-arm3, with 1 &#181;L of 4x loading dye and load them into the gel.</li>
		<li>Put the cassette into the chamber, fill it with 1x TBE buffer, and let the gel run for 90 min at 80 V.</li>
		<li>Dye the gel with Ethidium bromide and visualize it using a gel-documenting system (see Table of Materials).</li>
	</ol>
	</li>
	<li>LOD assay
	<ol>
		<li>Prepare 160 &#181;L of 200 nM F-sub in the reaction buffer. This is done to assess the basic background of the substrate stability.</li>
		<li>Prepare 7 aliquots of 160 &#181;L of preassembled DNM, F-sub, and Dza at concentrations of 20 nM of DNM and Dza and 200 nM of F-sub in the reaction buffer. Out of the seven tubes, keep tube #1 as the blank background to assess the spontaneous assembly of the DNAzyme core.</li>
		<li>Add the analyte into tubes #2-7 at the final concentrations of 1 pM, 10 pM, 100 pM, 200 pM, 500 pM and 1000 pM.</li>
		<li>Gently mix, spin down the tubes, and classify&#160;the solutions into three 50 &#181;L portions into a&#160;black 96-well plate. Seal the plate with an optically transparent film.</li>
		<li>Incubate the plate in a water bath at 55 &#176;C for 1 h. Spin down the plate.</li>
		<li>Measure fluorescence at 525 nm (&#955;ex = 495 nm). Calculate the mean and the standard deviation for each point.</li>
		<li>Calculate the blank-to-basic ratio by dividing the signal of the tube that contains F-sub and DNM by the signal of the tube that contains F-sub only. Ensure the ratio is within the 1.1-1.5 range.</li>
		<li>Calculate the signal-to-blank ratio by dividing the signal of the tube that contains F-sub, DNM, and the analyte to the signal of the tube that contains F-sub and DNM only. Consider the signal as true positive if it is higher than the background average plus three standard deviations.</li>
		<li>Repeat the experiment twice and ensure the standard deviation between the analytical repeats is less than 0.5.</li>
	</ol>
	</li>
</ol>

Precision DNAzyme Nanomachines for Discriminative RNA and DNA Analysis

<ol>
	<li>Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolution+of+hybridization+probes+to+DNA+machines+and+robots.">Evolution of hybridization probes to DNA machines and robots.</a> Acc. Chem Res. 52, 1949-1956 (2019).</li><li>Guo, J., Ju, J., Turro, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescent+hybridization+probes+for+nucleic+acid+detection.">Fluorescent hybridization probes for nucleic acid detection.</a> Anal. Bioanal Chem. 402, 3115-3125 (2012).</li><li>Demidov, V. V., Frank-Kamenetskii, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+sides+of+the+coin:+affinity+and+specificity+of+nucleic+acid+interactions.">Two sides of the coin: affinity and specificity of nucleic acid interactions.</a> Tr Bioche Sc. 29 (2), 62-71 (2004).</li><li>Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binary+probes+for+nucleic+acid+analysis.">Binary probes for nucleic acid analysis.</a> Chem Rev. 110, 4709-4723 (2010).</li><li>Marti, A. A., Jockusch, S., Stevens, N., Ju, J., Turro, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescent+hybridization+probes+for+sensitive+and+selective+DNA+and+RNA+detection.">Fluorescent hybridization probes for sensitive and selective DNA and RNA detection.</a> Acc Chem Res. 40 (6), 402-409 (2007).</li><li>Gerasimova, Y. V., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+bacterial+16S+rRNA+using+a+molecular+beacon-based+X+sensor.">Detection of bacterial 16S rRNA using a molecular beacon-based X sensor.</a> Biosens.Bioelectron. 41, 386-390 (2013).</li><li>Dark, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accuracy+of+LightCycler+Septi+Fast+for+the+detection+and+identification+of+pathogens+in+the+blood+of+patients+with+suspected+sepsis:+a+systematic+review+and+meta-analysis.">Accuracy of LightCycler Septi Fast for the detection and identification of pathogens in the blood of patients with suspected sepsis: a systematic review and meta-analysis.</a> Intensive Care Med. 41, 21-33 (2015).</li><li>Maltzeva, Y. I., Gorbenko, D. A., Nikitina, E. V., Rubel, M. S., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visual+Detection+of+Stem-Loop+Primer+Amplification+(SPA)+products+without+denaturation+using+peroxidase-like+DNA+machines+(PxDM).">Visual Detection of Stem-Loop Primer Amplification (SPA) products without denaturation using peroxidase-like DNA machines (PxDM).</a> Int J Mol Sc. 24 (9), 7812 (2023).</li><li>Gorbenko, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+nanomachine+for+visual+detection+of+structured+RNA+and+double+stranded+DNA.">DNA nanomachine for visual detection of structured RNA and double stranded DNA.</a> Chem Comm. 58 (35), 5395-5398 (2022).</li><li>Roembke, B. T., Nakayama, S., Sintim, H. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleic+acid+detection+using+G-quadruplex+amplification+methodologies.">Nucleic acid detection using G-quadruplex amplification methodologies.</a> Methods. 64 (3), 185-198 (2013).</li><li>Mokany, E., Bone, S. M., Young, P. E., Doan, T. B., Todd, A. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MNAzymes,+a+versatile+new+class+of+nucleic+acid+enzymes+that+can+function+as+biosensors+and+molecular+switches.">MNAzymes, a versatile new class of nucleic acid enzymes that can function as biosensors and molecular switches.</a> JACS. 132 (3), 1051-1059 (2010).</li><li>Gerasimova, Y. V., Cornett, E., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+cleaving+deoxyribozyme+sensor+for+nucleic+acid+analysis:+the+limit+of+detection.">RNA cleaving deoxyribozyme sensor for nucleic acid analysis: the limit of detection.</a> Chem Bio Chem. 11, 811-817 (2010).</li><li>Gerasimova, Y. V., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Folding+16S+RNA+in+a+signal-producing+structure+for+detection+of+bacteria.">Folding 16S RNA in a signal-producing structure for detection of bacteria.</a> Angew Chem Int Ed. 52, 10586-10588 (2013).</li><li>Hu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allosteric+DNAzyme-based+encoder+for+molecular+information+transfer.">Allosteric DNAzyme-based encoder for molecular information transfer.</a> Chin. Chem Let. , 109232 (2023).</li><li>Peeters, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solid-phase+PCR-amplified+DNAzyme+activity+for+real-time+FO-SPR+detection+of+the+MCR-2+gene.">Solid-phase PCR-amplified DNAzyme activity for real-time FO-SPR detection of the MCR-2 gene.</a> Anal Chem. 92 (15), 10783-10791 (2020).</li><li>Wood, H. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+typing+of+nontuberculous+Mycobacteria+by+use+of+deoxyribozyme+sensors.">Species typing of nontuberculous Mycobacteria by use of deoxyribozyme sensors.</a> Clin Chem. 65 (2), 333-341 (2019).</li><li>Yan, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultralow+background+one-pot+detection+of+Lead+(II)+using+a+non-enzymatic+double-cycle+system+mediated+by+a+hairpin-involved+DNAzyme.">Ultralow background one-pot detection of Lead (II) using a non-enzymatic double-cycle system mediated by a hairpin-involved DNAzyme.</a> Biosen Bioelectron. 237, 115534 (2023).</li><li>Hasick, N. J., Radhika, R., Todd, A. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subzymes:+Regulating+DNAzymes+for+point+of+care+nucleic+acid+sensing.">Subzymes: Regulating DNAzymes for point of care nucleic acid sensing.</a> Sens. Act. B: Chem. 297, 126704 (2019).</li><li>Safdar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-only,+microwell-based+bioassay+for+multiplex+nucleic+acid+detection+with+single+base-pair+resolution+using+MNAzymes.">DNA-only, microwell-based bioassay for multiplex nucleic acid detection with single base-pair resolution using MNAzymes.</a> Biosen Bioelectron. 152, 112017 (2020).</li><li>Cox, A. J., Bengtson, H. N., Gerasimova, Y. V., Rohde, K. H., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+antenna+tile-associated+deoxyribozyme+sensor+with+improved+sensitivity.">DNA antenna tile-associated deoxyribozyme sensor with improved sensitivity.</a> Chem Bio Chem. 17 (21), 2038-2041 (2016).</li><li>Lyalina, T. A., Goncharova, E. A., Prokofeva, N. Y., Voroshilina, E. S., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+DNA+minimachine+for+selective+and+sensitive+detection+of+DNA.">A DNA minimachine for selective and sensitive detection of DNA.</a> Analyst. 144 (2), 416-420 (2019).</li><li>Ateiah, M., Gandalipov, E. R., Rubel, A. A., Rubel, M. S., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+Nanomachine+(DNM)+Biplex+Assay+for+Differentiating+Bacillus+cereus+Species.">DNA Nanomachine (DNM) Biplex Assay for Differentiating Bacillus cereus Species.</a> Int J Mol Sc. 24 (5), 4473 (2023).</li><li>El-Deeb, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+a+home+test+for+COVID-19+diagnosis:+DNA+machine+for+amplification-free+SARS-CoV-2+detection+in+clinical+samples.">Toward a home test for COVID-19 diagnosis: DNA machine for amplification-free SARS-CoV-2 detection in clinical samples.</a> Chem Med Chem. 17 (20), 202200382 (2022).</li><li>Kirichenko, A., Bryushkova, E., Dedkov, V., Dolgova, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Novel+DNAzyme-based+fluorescent+biosensor+for+detection+of+RNA-containing+Nipah+henipavirus.">A Novel DNAzyme-based fluorescent biosensor for detection of RNA-containing Nipah henipavirus.</a> Biosensors. 13 (2), 252 (2023).</li><li>Akhmetova, M. M., Rubel, M. S., Afanasenko, O. S., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Barley+haplotyping+using+biplex+deoxyribozyme+nanomachine.">Barley haplotyping using biplex deoxyribozyme nanomachine.</a> Sens Act Rep. 4, 100132 (2022).</li><li>Okonechnikov, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unipro+UGENE:+a+unified+bioinformatics+toolkit.">Unipro UGENE: a unified bioinformatics toolkit.</a> Bioinformatics. 28, 1166-1167 (2012).</li><li>Zuker, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mfold+web+server+for+nucleic+acid+folding+and+hybridization+prediction.">Mfold web server for nucleic acid folding and hybridization prediction.</a> Nucleic Acids Res. 31 (13), 3406-3415 (2003).</li><li>Markham, N. R., Zuker, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DINAMelt+web+server+for+nucleic+acid+melting+prediction.">DINAMelt web server for nucleic acid melting prediction.</a> Nucleic Acids Res. 33, W577-W581 (2005).</li><li>Stancescu, M., Fedotova, T. A., Hooyberghs, J., Balaeff, A., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonequilibrium+hybridization+enables+discrimination+of+a+point+mutation+within+5-40+C.">Nonequilibrium hybridization enables discrimination of a point mutation within 5-40 C.</a> JACS. 138 (41), 13465-13468 (2016).</li><li>Dong, J., Ouyang, Y., Wang, J., O'Hagan, M. P., Willner, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+of+dynamic+gated+and+cascaded+transient+DNAzyme+networks.">Assembly of dynamic gated and cascaded transient DNAzyme networks.</a> ACS Nano. 16 (4), 6153-6164 (2022).</li><li>Montserrat Pag&#232;s, A., Hertog, M., Nicola&#239;, B., Spasic, D., Lammertyn, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unraveling+the+kinetics+of+the+10-23+RNA-cleaving+DNAzyme.">Unraveling the kinetics of the 10-23 RNA-cleaving DNAzyme.</a> Int J Mol Sc. 24 (18), 13686 (2023).</li><li>Nguyen, C., Grimes, J., Gerasimova, Y. V., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular-beacon-based+tricomponent+probe+for+SNP+analysis+in+folded+nucleic+acids.">Molecular-beacon-based tricomponent probe for SNP analysis in folded nucleic acids.</a> Chem-eur J. 17 (46), 13052-13058 (2011).</li><li>MacDougall, D., Crummett, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guidelines+for+data+acquisition+and+data+quality+evaluation+in+environmental+chemistry.">Guidelines for data acquisition and data quality evaluation in environmental chemistry.</a> Anal Chem. 52 (14), 2242-2249 (1980).</li><li>Gerasimova, Y. V., Yakovchuk, P., Dedkova, L. M., Hecht, S. M., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expedited+quantification+of+genetically+modified+ribosomal+RNA+by+binary+deoxyribozyme+sensors.">Expedited quantification of genetically modified ribosomal RNA by binary deoxyribozyme sensors.</a> RNA. 10, 1834-1843 (2015).</li><li>Gerasimova, Y. V., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Folding+16S+RNA+in+a+signal-producing+structure+for+detection+of+bacteria.">Folding 16S RNA in a signal-producing structure for detection of bacteria.</a> Angew Chem Int Ed. 52, 10586-10588 (2013).</li><li>. GC Content Calculator Available from: <a target="_blank" href="https://www.biologicscorp.com/tools/GCContent/#.ZEfxPiyOHYU">https://www.biologicscorp.com/tools/GCContent/#.ZEfxPiyOHYU</a> (2023)</li><li>Hussein, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAzyme+nanomachine+with+fluorogenic+substrate+delivery+function:+advancing+sensitivity+in+nucleic+acid+detection.">DNAzyme nanomachine with fluorogenic substrate delivery function: advancing sensitivity in nucleic acid detection.</a> Anal Chem. 95 (51), 18667-18672 (2023).</li><li>Safdar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-only,+microwell-based+bioassay+for+multiplex+nucleic+acid+detection+with+single+base-pair+resolution+using+MNAzymes.">DNA-only, microwell-based bioassay for multiplex nucleic acid detection with single base-pair resolution using MNAzymes.</a> Biosen Bioelectron. 152, 112017 (2020).</li><li>Gerasimova, Y. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deoxyribozyme+cascade+for+visual+detection+of+bacterial+RNA.">Deoxyribozyme cascade for visual detection of bacterial RNA.</a> Chem Bio Chem. 14, 2087-2090 (2013).</li><li>Eckert, K. A., Kunkel, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+polymerase+fidelity+and+the+polymerase+chain+reaction.">DNA polymerase fidelity and the polymerase chain reaction.</a> Gen Res. 1 (1), 17-24 (1991).</li><li>Pandya, K., Jagani, D., Singh, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas+systems:+Programmable+nuclease+revolutionizing+the+molecular+diagnosis.">CRISPR-Cas systems: Programmable nuclease revolutionizing the molecular diagnosis.</a> Mol Biotech. , (2023).</li></ol>

The authors declare no conflict of interest.

The design of DNA machines is straightforward but requires some experience in designing&#160;hybridization probes or functional DNA nanostructures. It is appropriate to keep the analyte fragment as short as possible to diminish the number of possible secondary structures and simplify DNM invasion to the secondary structure. The CG content should preferably be below 60% to avoid stable intramolecular structures. Successful assembly of the DNM is achieved at slow cooling rates. In some cases, DNMs can be spontaneously asse...

One of the earliest methods for&#160;nucleic acid detection is&#160;complementary binding of selective oligonucleotides to the analyzed RNA or DNA sequences. This method employs nucleic acid fragments (probes) that can form Watson-Crick base pairs with a targeted DNA or RNA analyte1. The complex is then differentiated from the analyte and the unbound probe by a variety of techniques. Certain methods, such as Northern blotting, in situ hybridization, or qPCR, are based on the&#160;phenomenon&#160;of complementary binding2. The most common hybridization probes have two significant drawbacks: low sensitivity (they can reach micromolar to nanomolar levels) as well as low selectivity to single nucleotide variations (SNV), including point mutations. The issue requires a sophisticated approach since the solutions to these drawbacks conflict with each other3. To provide the best selectivity, the detecting oligonucleotide should be kept short enough to form unstable hybrids with mismatched analytes. Such short oligonucleotides are not able to bind targeted nucleic acids tightly and unwind their secondary structures, thus often failing to provide a detectable signal. It is especially challenging to detect CG-rich fragments in biological RNA, or double-stranded DNA (dsDNA). On the other hand, long probes are insensitive to SNV3. To break the deadlock, the concept of a binary probe has been&#160;developed4.
Binary sensors split a single detection probe into two pieces and specialize its fragments, keeping one of them long to unwind the hairpins or invade the dsDNA. The second binary probe fragment remains short to be sensitive to a mismatched base, thus providing a means for detecting SNV. The signal will be produced if the two binary sensor parts are joined together4. The full complex can be visualized via FRET5, molecular beacon probe6,7, or G-quadruplexes with peroxidase-like activity8,9,10, or else RNA-cleaving11,12,13 DNAzyme. Binary sensors with a 10-23 DNAzyme core have been amply described. They have been adapted to detect single-stranded nucleic acid fragments&#160;created synthetically11, or single-stranded amplification products14,15. Detection without amplification is also possible, for example, in the case of 16S rRNA extracted from a cell culture, since this molecule is abundant in cells12,16. Binary sensors with a 10-23 DNAzyme core can also be adapted for non-nucleic acid detection, such as for lead ions17. Nevertheless, low sensitivity is still considered to be one of the major drawbacks of binary 10-23 DNAzyme sensors, and&#160;various approaches, including cascades18 or alternative signal-enhancing methods19, have been developed to address this issue. Unfortunately, the above techniques drastically increase the cost and instability of the sensor components, and so they have not come into practice.
The experiment described in this work uses 10-23 DNAzyme-based DNA-nanosensors referred to as DNA-nanomachines (DNM)20,21. These structures include binary sensors and also&#160;(1) DNA facilitators flanking the binary probe,&#160;unwinding the structured regions and&#160;invading into double-stranded DNAs, and (2) a DNA tile that holds all the DNM parts together in close proximity and increases the chances of signal formation (Figure 1). Altogether, the 10-23 DNAzyme-based DNMs decrease the limit of detection (LOD) down to the picomolar range21; they can be used to detect 16rRNA in cell lysates22 or report the presence of viral RNA without amplification23,24. At the same time, the DNMs remain sensitive to the SNV and can even be used to genotype alleles in heterozygous organisms25. The DNM method can be used as a complementary technique to any amplification type for product visualization or identification of the product in a complex mixture with high selectivity. The DNMs, unlike conventional TaqMan and beacon probes, do not require heating of the sample and so can be used in end-point detection protocols, making the overall detection cost-effective.
This article describes the in silico development of a DNM and demonstrates procedures for assembly and functional characterization of DNM. The work was performed using a synthetic fragment of Epstein-Barr virus (EBV) corresponding to the positions 13972-14154 of the viral DNA (OR652423.1) (see Table of materials).

<table><tbody><tr><td>1.5 mL tube</td><td>Biofil</td><td>CFT011015</td><td></td></tr><tr><td>100 bp+ DNA Ladder</td><td>Evrogen</td><td>NL002</td><td></td></tr><tr><td>100-1000 &amp;micro;L pipette</td><td>Kirgen</td><td>KG-Pro1000</td><td></td></tr><tr><td>10-100 &amp;micro;L pipette</td><td>Kirgen</td><td>KG-Pro100</td><td></td></tr><tr><td>1-10 &amp;micro;L pipette</td><td>Kirgen</td><td>KG-Pro10</td><td></td></tr><tr><td>20-200 &amp;micro;L pipette</td><td>Kirgen</td><td>KG-Pro200</td><td></td></tr><tr><td>2-20 &amp;micro;L pipette</td><td>Kirgen</td><td>KG-Pro20</td><td></td></tr><tr><td>4x Gel Loading Dye</td><td>Evrogen</td><td>PB020</td><td></td></tr><tr><td>Acrylamide 4K</td><td>AppliChem</td><td>A1090,0500</td><td></td></tr><tr><td>Ammonium persulfate</td><td>Carl Roth</td><td>2809447</td><td></td></tr><tr><td>Biorender</td><td>Biorender</td><td></td><td>https://www.biorender.com</td></tr><tr><td>Bisacrylamide</td><td>Molekula</td><td>22797959</td><td></td></tr><tr><td>Boric Acid</td><td>TechSnab</td><td>H-0202</td><td></td></tr><tr><td>ChemiDoc imaging system</td><td>BioRad</td><td>12003153</td><td></td></tr><tr><td>Costar 96-Well Black Polystyrene Plate</td><td>Corning</td><td>COS3915</td><td></td></tr><tr><td>DinaMelt</td><td>RNA Institute</td><td></td><td>http://www.unafold.org/Dinamelt/applications/two-state-melting-hybridization.php</td></tr><tr><td>EDTA</td><td>Amresco</td><td>Am-O105</td><td></td></tr><tr><td>Ethidium bromide</td><td>BioLabMix</td><td>EtBr-10</td><td></td></tr><tr><td>HEPES</td><td>Amresco</td><td>Am-O485</td><td></td></tr><tr><td>Magnesium chloride</td><td>AppliChem</td><td>131396</td><td></td></tr><tr><td>Mini Protean Tetra Cell</td><td>BioRad</td><td>1658001EDU</td><td></td></tr><tr><td>pipette 10 &amp;micro;L tips</td><td>Kirgen</td><td>KG1111-L</td><td></td></tr><tr><td>pipette 1000 &amp;micro;L tips</td><td>Kirgen</td><td>KG1636</td><td></td></tr><tr><td>pipette 200 &amp;micro;L tips</td><td>Kirgen</td><td>KG1212-L</td><td></td></tr><tr><td>Pixelmator Pro</td><td>Pixelmator Team</td><td></td><td>https://www.pixelmator.com/pro/</td></tr><tr><td>Potassium chloride</td><td>Carl Roth</td><td>1782751</td><td></td></tr><tr><td>PowerPac Basic Power Supply</td><td>BioRad</td><td>1645050</td><td></td></tr><tr><td>RNAse/DNAse free water</td><td>Invitrogen</td><td>10977049</td><td></td></tr><tr><td>Sealing film for PCR plates</td><td>Sovtech</td><td>P-502</td><td></td></tr><tr><td>Sodium chloride</td><td>Vekton</td><td>HCh (0,1)</td><td></td></tr><tr><td>Spark multimode microplate reader</td><td>Tecan</td><td>Spark- 10M</td><td></td></tr><tr><td>T100 amplificator</td><td>BioRad</td><td>10014822</td><td></td></tr><tr><td>TEMED</td><td>Molekula</td><td>68604730</td><td></td></tr><tr><td>Tris(hydroxymethyl)aminomethane</td><td>Amresco</td><td>Am-O497</td><td></td></tr><tr><td>UNAFold</td><td>RNA Institute</td><td></td><td>http://www.unafold.org/mfold/applications/dna-folding-form.php</td></tr><tr><td>Water bath</td><td>LOIP</td><td>LB-140</td><td></td></tr><tr><td>&lt;strong&gt;Oligos used&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Analyte:&lt;/strong&gt;</td><td>Evrogen</td><td></td><td>direct order, standard desalting purification</td></tr><tr><td>GAGCACTTGGTCAGGCACACGG&lt;br/&gt; ACAGGGTCAGCGGAGGACGCG&lt;br/&gt; TGGCACAGCAGCCCGGGGTAG&lt;br/&gt; GTCCCCTGGACCTGCCGCTGG&lt;br/&gt; CGGACTACGCCTTCGTTGC</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Tile-Arm3:&lt;/strong&gt;</td><td>Evrogen</td><td></td><td>direct order, standard desalting purification</td></tr><tr><td>CCG GGCTGCTGTGCCATTTT&lt;br/&gt; TTGCTGACTACTGTCACCTCT&lt;br/&gt; CTGCTAGTCT</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Dzb-Tile:&lt;/strong&gt; AGACTAGCAGAGAGGTGACAG&lt;br/&gt; TAGTCAGCTTTTTTCGCGTCCTC&lt;br/&gt; CGCTGACCACAACGAGAGGAA&lt;br/&gt; ACCTT</td><td>Evrogen</td><td></td><td>direct order, standard desalting purification</td></tr><tr><td>&lt;strong&gt;Dza:&lt;/strong&gt; TGCCCAGGGAGGCTAGCTCT&lt;br/&gt; GTCCGTGTGCCTGACCA</td><td>Evrogen</td><td></td><td>direct order, standard desalting purification</td></tr><tr><td>&lt;strong&gt;F-sub oligonucleotide:&lt;/strong&gt; AAGGTT(FAM)TCCTCrGrU&lt;br/&gt; CCCTGGGCA-BHQ1</td><td>DNA-Syntez</td><td></td><td>direct order, HPLC purification</td></tr></tbody></table>

dnazyme 10-23 - based nanomachines for nucleic acid recognition

DNAzyme-based nanomachines (DNM) for the detection of DNA and RNA sequences (analytes) are multifunctional structures made of oligonucleotides. Their functions include tight analyte binding, highly selective analyte recognition, fluorescent signal amplification by multiple catalytic cleavages of a fluorogenic reporter substrate, and fluorogenic substrate attraction for an increase in sensor response. Functional units are attached to a common DNA scaffold for their cooperative action. The RNA-cleaving 10-23 DNMs feature&#160;improved sensitivity in comparison with non-catalytic hybridization probes. The stability of the DNM and the increased chances of substrate recognition are provided&#160;by a double-stranded DNA fragment,&#160;a tile. DNM can differentiate two analytes with a single nucleotide difference in a folded RNA and a double-stranded DNA and detect analytes at concentrations ~1000 times lower than other protein-free hybridization probes. This article presents the concept behind the diagnostic potential of DNA-nanomachine activity and overviews DNM design, assembly, and application&#160;in nucleic acid detection assays.

The aim of the first experiment was to show the assembly of the DNM before&#160;the synthetic fragment of the analyte. All the constituent DNM strands were added to the reaction buffer and assembled in the beaker. The assembled DNM complex was assessed for its correct size and homogeneity by native PAGE. Native PAGE shows the assembled DNM with the analyte in lane 1 and two DNM strands in lanes 2 and 4. If the DNA nanomachine were&#160;not assembled, 2 or 3 separate bands would be visible instead of a single low-mobility...

Read this Scientific Article Protocol about DNAzyme 10-23 - Based Nanomachines for Nucleic Acid Recognition at JoVE.com

Author Spotlight: Advancements in DNA Nanosensors &#8211; Addressing Sensitivity and Selectivity Challenges in Molecular Detection

The DNAzyme-based nanomachines can be used for highly selective and sensitive detection of nucleic acids. This article describes a detailed protocol for the design of DNAzyme-based nanomachines with a 10-23 core using free software and their application in the detection of an Epstein-Barr virus fragment as an example.

DNAzyme 10-23 - Based Nanomachines for Nucleic Acid Recognition

DNAzyme-based nanomachines (DNM) for the detection of DNA and RNA sequences (analytes) are multifunctional structures made of oligonucleotides. Their ...

dnazyme-10-23-based-nanomachines-for-nucleic-acid-recognition

Research

JoVE Journal

Biochemistry

880 Views.  ITMO University. De grootste doorbraak die ons laboratorium maakte op het gebied van hybridisatiesonde werd in 2007 gemaakt door Dmitry Kolpashchikov, die een ADL-splitsing van hybridisatiesondes in tweeën voorstelde, waarbij elk van de helften zijn eigen functie beoordeelde, bijvoorbeeld het verhogen van de selectiviteit voor mismatches en variaties met enkele nucleotides samen met het afwikkelen van complexe sondes. De tweede doorbraak werd tien jaar later bereikt toen wer...

Video: Auteur in de schijnwerpers: Vooruitgang in DNA-nanosensoren - Uitdagingen op het gebied van gevoeligheid en selectiviteit aanpakken bij moleculaire detectie

Folding and Characterization of a Bio-responsive Robot from DNA Origami

The DNA nanorobot is a hollow hexagonal nanometric device, designed to open in response to specific stimuli and present cargo sequestered inside. Both stimuli and cargo can be tailored according to specific needs. Here we describe the DNA nanorobot fabrication protocol, with the use of the DNA origami technique. The procedure initiates by mixing short single-strand DNA staples into a stock mixture which is then added to a long, circular, single-strand DNA scaffold in presence of a folding buffer. A standard thermo cycler is programmed to gradually lower the mixing reaction temperature to facilitate the staples-to-scaffold annealing, which is the guiding force behind the folding of the nanorobot. Once the 60 hr folding reaction is complete, excess staples are discarded using a centrifugal filter, followed by visualization via agarose-gel electrophoresis (AGE). Finally, successful fabrication of the nanorobot is verified by transmission electron microscopy (TEM), with the use of uranyl-formate as negative stain.

DNA origami is a powerful method for fabricating precise nanoscale objects by programming the self-assembly of DNA molecules. Here we describe a protocol for the folding of a bio-responsive robot from DNA origami, its purification and negative staining for transmission electron microscopic imaging (TEM).

The DNA nanorobot is a hollow hexagonal nanometric device, designed to open in response to specific stimuli and present cargo sequestered inside. Both ...

Chemistry

Nucleoside Triphosphates - From Synthesis to Biochemical Characterization

The traditional strategy for the introduction of chemical functionalities is the use of solid-phase synthesis by appending suitably modified phosphoramidite precursors to the nascent chain. However, the conditions used during the synthesis and the restriction to rather short sequences hamper the applicability of this methodology. On the other hand, modified nucleoside triphosphates are activated building blocks that have been employed for the mild introduction of numerous functional groups into nucleic acids, a strategy that paves the way for the use of modified nucleic acids in a wide-ranging palette of practical applications such as functional tagging and generation of ribozymes and DNAzymes. One of the major challenges resides in the intricacy of the methodology leading to the isolation and characterization of these nucleoside analogues.
	
	In this video article, we present a detailed protocol for the synthesis of these modified analogues using phosphorous(III)-based reagents. In addition, the procedure for their biochemical characterization is divulged, with a special emphasis on primer extension reactions and TdT tailing polymerization. This detailed protocol will be of use for the crafting of modified dNTPs and their further use in chemical biology.

The protocol described herein aims to explain and abridge the numerous obstacles in the way of the intricate route leading to modified nucleoside triphosphates. Consequently, this protocol facilitates both the synthesis of these activated building-blocks and their availability for practical applications.

The  traditional strategy for the introduction of chemical functionalities is the  use of solid-phase synthesis by appending suitably modified ...

Sequence-specific and Selective Recognition of Double-stranded RNAs over Single-stranded RNAs by Chemically Modified Peptide Nucleic Acids

RNAs are emerging as important biomarkers and therapeutic targets. Thus, there is great potential in developing chemical probes and therapeutic ligands for the recognition of RNA sequence and structure. Chemically modified Peptide Nucleic Acid (PNA) oligomers have been recently developed that can recognize RNA duplexes in a sequence-specific manner. PNAs are chemically stable with a neutral peptide-like backbone. PNAs can be synthesized relatively easily by the manual Boc-chemistry solid-phase peptide synthesis method. PNAs are purified by reverse-phase HPLC, followed by molecular weight characterization by matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF). Non-denaturing polyacrylamide gel electrophoresis (PAGE) technique facilitates the imaging of the triplex formation, because carefully designed free RNA duplex constructs and PNA bound triplexes often show different migration rates. Non-denaturing PAGE with ethidium bromide post staining is often an easy and informative technique for characterizing the binding affinities and specificities of PNA oligomers. Typically, multiple RNA hairpins or duplexes with single base pair mutations can be used to characterize PNA binding properties, such as binding affinities and specificities. 2-Aminopurine is an isomer of adenine (6-aminopurine); the 2-aminopurine fluorescence intensity is sensitive to local structural environment changes, and is suitable for the monitoring of triplex formation with the 2-aminopurine residue incorporated near the PNA binding site. 2-Aminopurine fluorescence titration can also be used to confirm the binding selectivity of modified PNAs towards targeted double-stranded RNAs (dsRNAs) over single-stranded RNAs (ssRNAs). UV-absorbance-detected thermal melting experiments allow the measurement of the thermal stability of PNA-RNA duplexes and PNA&#183;RNA2 triplexes. Here, we describe the synthesis and purification of PNA oligomers incorporating modified residues, and describe biochemical and biophysical methods for characterization of the recognition of RNA duplexes by the modified PNAs.

We report the protocols for the synthesis and purification of Peptide Nucleic Acid (PNA) oligomers incorporating modified residues. The biochemical and biophysical methods for the characterization of the recognition of RNA duplexes by the modified PNAs are described.

RNAs are emerging as important biomarkers and therapeutic targets. Thus, there is great potential in developing chemical probes and therapeutic ligands ...

Genetics

In vitro Assembly of Semi-artificial Molecular Machine and its Use for Detection of DNA Damage

Naturally occurring bio-molecular machines work in every living cell and display a variety of designs 1-6. Yet the development of artificial molecular machines centers on devices capable of directional motion, i.e. molecular motors, and on their scaled-down mechanical parts (wheels, axels, pendants etc) 7-9. This imitates the macro-machines, even though the physical properties essential for these devices, such as inertia and momentum conservation, are not usable in the nanoworld environments 10. Alternative designs, which do not follow the mechanical macromachines schemes and use mechanisms developed in the evolution of biological molecules, can take advantage of the specific conditions of the nanoworld. Besides, adapting actual biological molecules for the purposes of nano-design reduces potential dangers the nanotechnology products may pose. Here we demonstrate the assembly and application of one such bio-enabled construct, a semi-artificial molecular device which combines a naturally-occurring molecular machine with artificial components. From the enzymology point of view, our construct is a designer fluorescent enzyme-substrate complex put together to perform a specific useful function. This assembly is by definition a molecular machine, as it contains one 12. Yet, its integration with the engineered part - fluorescent dual hairpin - re-directs it to a new task of labeling DNA damage12.
Our construct assembles out of a 32-mer DNA and an enzyme vaccinia topoisomerase I (VACC TOPO). The machine then uses its own material to fabricate two fluorescently labeled detector units (Figure 1). One of the units (green fluorescence) carries VACC TOPO covalently attached to its 3'end and another unit (red fluorescence) is a free hairpin with a terminal 3'OH. The units are short-lived and quickly reassemble back into the original construct, which subsequently recleaves. In the absence of DNA breaks these two units continuously separate and religate in a cyclic manner. In tissue sections with DNA damage, the topoisomerase-carrying detector unit selectively attaches to blunt-ended DNA breaks with 5'OH (DNase II-type breaks)11,12, fluorescently labeling them. The second, enzyme-free hairpin formed after oligonucleotide cleavage, will ligate to a 5'PO4 blunt-ended break (DNase I-type breaks)11,12, if T4 DNA ligase is present in the solution 13,14 . When T4 DNA ligase is added to a tissue section or a solution containing DNA with 5'PO4 blunt-ended breaks, the ligase reacts with 5'PO4 DNA ends, forming semi-stable enzyme-DNA complexes. The blunt ended hairpins will interact with these complexes releasing ligase and covalently linking hairpins to DNA, thus labeling 5'PO4 blunt-ended DNA breaks.
This development exemplifies a new practical approach to the design of molecular machines and provides a useful sensor for detection of apoptosis and DNA damage in fixed cells and tissues.

In vitro Assembly of Semi-artificial Molecular Machine and its Use for Detection of DNA Damage

We demonstrate the assembly and application of a molecular-scale device powered by a topoisomerase protein. The construct is a bio-molecular sensor which labels two major types of DNA breaks in tissue sections by attaching two different fluorophores to their ends.

Naturally occurring bio-molecular machines work in every living cell and display a variety of designs 1-6. Yet the development of artificial molecular ...

Bioengineering

Detection of Bacteria Using Fluorogenic DNAzymes

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses each and every year. Prevention of such outbreaks and minimization of the impact of an ongoing epidemic place an ever-increasing demand for analytical methods that can accurately identify culprit pathogens at the earliest stage. Although there is a large array of effective methods for pathogen detection, none of them can satisfy all the following five premier requirements embodied for an ideal detection method: high specificity (detecting only the bacterium of interest), high sensitivity (capable of detecting as low as a single live bacterial cell), short time-to-results (minutes to hours), great operational simplicity (no need for lengthy sampling procedures and the use of specialized equipment), and cost effectiveness. For example, classical microbiological methods are highly specific but require a long time (days to weeks) to acquire a definitive result.1 PCR- and antibody-based techniques offer shorter waiting times (hours to days), but they require the use of expensive reagents and/or sophisticated equipment.2-4 Consequently, there is still a great demand for scientific research towards developing innovative bacterial detection methods that offer improved characteristics in one or more of the aforementioned requirements. Our laboratory is interested in examining the potential of DNAzymes as a novel class of molecular probes for biosensing applications including bacterial detection.5
DNAzymes (also known as deoxyribozymes or DNA enzymes) are man-made single-stranded DNA molecules with the capability of catalyzing chemical reactions.6-8 These molecules can be isolated from a vast random-sequence DNA pool (which contains as many as 1016 individual sequences) by a process known as "in vitro selection" or "SELEX" (systematic evolution of ligands by exponential enrichment).9-16 These special DNA molecules have been widely examined in recent years as molecular tools for biosensing applications.6-8
Our laboratory has established in vitro selection procedures for isolating RNA-cleaving fluorescent DNAzymes (RFDs; Fig. 1) and investigated the use of RFDs as analytical tools.17-29 RFDs catalyze the cleavage of a DNA-RNA chimeric substrate at a single ribonucleotide junction (R) that is flanked by a fluorophore (F) and a quencher (Q). The close proximity of F and Q renders the uncleaved substrate minimal fluorescence. However, the cleavage event leads to the separation of F and Q, which is accompanied by significant increase of fluorescence intensity.
More recently, we developed a method of isolating RFDs for bacterial detection.5 These special RFDs were isolated to "light up" in the presence of the crude extracellular mixture (CEM) left behind by a specific type of bacteria in their environment or in the media they are cultured (Fig. 1). The use of crude mixture circumvents the tedious process of purifying and identifying a suitable target from the microbe of interest for biosensor development (which could take months or years to complete). The use of extracellular targets means the assaying procedure is simple because there is no need for steps to obtain intracellular targets.
Using the above approach, we derived an RFD that cleaves its substrate (FS1; Fig. 2A) only in the presence of the CEM produced by E. coli (CEM-EC).5 This E. coli-sensing RFD, named RFD-EC1 (Fig. 2A), was found to be strictly responsive to CEM-EC but nonresponsive to CEMs from a host of other bacteria (Fig. 3).
Here we present the key experimental procedures for setting up E. coli detection assays using RFD-EC1 and representative results.

We have recently reported a novel approach for generating fluorogenic DNAzyme probes that can be applied to set up a simple, "mix-and-read" fluorescent assay for bacterial detection. These special DNA probes catalyze the cleavage of a chromophore-modified DNA-RNA chimeric substrate in the presence of crude extracellular mixture (CEM) produced by a specific bacterium, thereby translating bacterial detection into fluorescence signal generation. In this report we will describe key experimental procedures where a specific DNAzyme probe denoted "RFD-EC1" is employed for the detection of the model bacterium, Escherichia coli (E. coli).

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses ...

Immunology and Infection

Nanomanipulation of Single RNA Molecules by Optical Tweezers

A large portion of the human genome is transcribed but not translated. In this post genomic era, regulatory functions of RNA have been shown to be increasingly important. As RNA function often depends on its ability to adopt alternative structures, it is difficult to predict RNA three-dimensional structures directly from sequence. Single-molecule approaches show potentials to solve the problem of RNA structural polymorphism by monitoring molecular structures one molecule at a time. This work presents a method to precisely manipulate the folding and structure of single RNA molecules using optical tweezers. First, methods to synthesize molecules suitable for single-molecule mechanical work are described. Next, various calibration procedures to ensure the proper operations of the optical tweezers are discussed. Next, various experiments are explained. To demonstrate the utility of the technique, results of mechanically unfolding RNA hairpins and a single RNA kissing complex are used as evidence. In these examples, the nanomanipulation technique was used to study folding of each structural domain, including secondary and tertiary, independently. Lastly, the limitations and future applications of the method are discussed.

Optical tweezers have been used to study RNA folding by stretching individual molecules from their 5&#8217; and 3&#8217; ends. Here common procedures are described to synthesize RNA molecules for tweezing, calibration of the instrument, and methods to manipulate single molecules.

A large portion of the human genome is transcribed but not translated. In this post genomic era, regulatory functions of RNA have been shown to be ...

DNA Origami-Mediated Substrate Nanopatterning of Inorganic Structures for Sensing Applications

Structural DNA nanotechnology provides a viable route for building from the bottom-up using DNA as construction material. The most common DNA nanofabrication technique is called DNA origami, and it allows high-throughput synthesis of accurate and highly versatile structures with nanometer-level precision. Here, it is shown how the spatial information of DNA origami can be transferred to metallic nanostructures by combining the bottom-up DNA origami with the conventionally used top-down lithography approaches. This allows fabrication of billions of tiny nanostructures in one step onto selected substrates. The method is demonstrated using bowtie DNA origami to create metallic bowtie-shaped antenna structures on silicon nitride or sapphire substrates. The method relies on the selective growth of a silicon oxide layer on top of the origami deposition substrate, thus resulting in a patterning mask for following lithographic steps. These nanostructure-equipped surfaces can be further used as molecular sensors (e.g., surface-enhanced Raman spectroscopy (SERS)) and in various other optical applications at the visible wavelength range owing to the small feature sizes (sub-10 nm). The technique can be extended to other materials through methodological modifications; therefore, the resulting optically active surfaces may find use in development of metamaterials and metasurfaces.

Here, we describe a protocol to create discrete and accurate inorganic nanostructures on substrates using DNA origami shapes as guiding templates. The method is demonstrated by creating plasmonic gold bowtie-shaped antennas on a transparent substrate (sapphire).

Structural DNA nanotechnology provides a viable route for building from the bottom-up using DNA as construction material. The most common DNA ...

DNAzyme-dependent Analysis of rRNA 2&#8217;-O-Methylation

Guide box C/D small nucleolar RNAs (snoRNAs) catalyze 2&#8217;-O-methylation of ribosomal and small nuclear RNA. However, a large number of snoRNA in higher eukaryotes may promiscuously recognize other RNA species and 2&#8217;-O-methylate multiple targets. Here, we provide step-by-step guide for the fast and non-expensive analysis of the site-specific 2&#8217;-O-methylation using a well-established method employing short DNA oligonucleotides called DNAzymes. These DNA fragments contain catalytic sequences which cleave RNA at specific consensus positions, as well as variable homology arms directing DNAzyme to its RNA targets. DNAzyme activity is inhibited by 2-&#8217;O-methylation of the nucleotide adjacent to the cleavage site in the RNA. Thus, DNAzymes, limited only by the consensus of the cleaved sequence, are perfect tools for the quick analysis of snoRNA-mediated RNA 2&#8217;-O-methylation. We analyzed snoRNA snR13- and snR47-guided 2&#8217;-O-methylation of 25S ribosomal RNA in Saccharomyces cerevisiae to demonstrate the simplicity of the technique and to provide a detailed protocol for the DNAzyme-dependent assay.

Here we present a protocol for DNAzyme-dependent cleavage of RNA. This enables fast and site-dependent analysis of RNA 2&#8217;-O-methylation. This approach can be used for the preliminary or major assessment of snoRNA activity.

Guide box C/D small nucleolar RNAs (snoRNAs) catalyze 2&#8217;-O-methylation of ribosomal and small nuclear RNA. However, a large number of snoRNA in ...

Developmental Biology

DNA Nanotubes as a Versatile Tool to Study Semiflexible Polymers

Mechanical properties of complex, polymer-based soft matter, such as cells or biopolymer networks, can be understood in neither the classical frame of flexible polymers nor of rigid rods. Underlying filaments remain outstretched due to their non-vanishing backbone stiffness, which is quantified via the persistence length (lp), but they are also subject to strong thermal fluctuations. Their finite bending stiffness leads to unique, non-trivial collective mechanics of bulk networks, enabling the formation of stable scaffolds at low volume fractions while providing large mesh sizes. This underlying principle is prevalent in nature (e.g., in cells or tissues), minimizing the high molecular content and thereby facilitating diffusive or active transport. Due to their biological implications and potential technological applications in biocompatible hydrogels, semiflexible polymers have been subject to considerable study. However, comprehensible investigations remained challenging since they relied on natural polymers, such as actin filaments, which are not freely tunable. Despite these limitations and due to the lack of synthetic, mechanically tunable, and semiflexible polymers, actin filaments were established as the common model system. A major limitation is that the central quantity lp cannot be freely tuned to study its impact on macroscopic bulk structures. This limitation was resolved by employing structurally programmable DNA nanotubes, enabling controlled alteration of the filament stiffness. They are formed through tile-based designs, where a discrete set of partially complementary strands hybridize in a ring structure with a discrete circumference. These rings feature sticky ends, enabling the effective polymerization into filaments several microns in length, and display similar polymerization kinetics as natural biopolymers. Due to their programmable mechanics, these tubes are versatile, novel tools to study the impact of lp on the single-molecule as well as the bulk scale. In contrast to actin filaments, they remain stable over weeks, without notable degeneration, and their handling is comparably straightforward.

Semiflexible polymers display unique mechanical properties that are extensively applied by living systems. However, systematic studies on biopolymers are limited since properties such as polymer rigidity are inaccessible. This manuscript describes how this limitation is circumvented by programmable DNA nanotubes, enabling experimental studies on the impact of filament rigidity.

Mechanical properties of complex, polymer-based soft matter, such as cells or biopolymer networks, can be understood in neither the classical frame of ...

Assays for DNA Enzymes Using Synthetic Oligonucleotides

Using Modified Synthetic Oligonucleotides to Assay Nucleic Acid-Metabolizing Enzymes

The availability of a range of modified synthetic oligonucleotides from commercial vendors has allowed the development of sophisticated assays to characterize diverse properties of nucleic acid metabolizing enzymes that can be run in any standard molecular biology lab. The use of fluorescent labels has made these methods accessible to researchers with standard PAGE electrophoresis equipment and a fluorescent-enabled imager, without using radioactive materials or requiring a lab designed for the storage and preparation of radioactive materials, i.e., a Hot Lab. The optional addition of standard modifications such as phosphorylation can simplify assay setup, while the specific incorporation of modified nucleotides that mimic DNA damages or intermediates can be used to probe specific aspects of enzyme behavior. Here, the design and execution of assays to interrogate several aspects of DNA processing by enzymes using commercially available synthetic oligonucleotides are demonstrated. These include the ability of ligases to join or nucleases to degrade different DNA and RNA hybrid structures, differential cofactor usage by the DNA ligase, and evaluation of the DNA-binding capacity of enzymes. Factors to consider when designing synthetic nucleotide substrates are discussed, and a basic set of oligonucleotides that can be used for a range of nucleic acid ligase, polymerase, and nuclease enzyme assays are provided.

Author Spotlight: Characterizing Novel Enzymes from Extremophiles and Common Pathogens to Understand DNA Repair and Replication

Here, a protocol for assaying nucleic acid metabolizing enzymes is presented, using examples of ligase, nuclease, and polymerase enzymes. The assay utilizes fluorescently labeled and unlabeled oligonucleotides that can be combined to form duplexes mimicking RNA and/or DNA damages or pathway intermediates, allowing for the characterization of enzyme behavior.

DNAzyme 10-23 - Based Nanomachines for Nucleic Acid Recognition

Samenvatting

Meer video's verkennen