We gratefully acknowledge the J-base funding (J-001757, J-001842) provided through Agriculture and Agri-Food Canada, which made this project possible. We thank Brett van Heyningen for filming the video content for this protocol. We would also like to thank Ron Matters for collecting soil samples used in the experiments described in this publication.

1. Media preparation and sterilization
<ol>
	<li>Prepare and sterilize succinate minimal salts media (SMS), which consists of 0.1 g of potato starch, 1 g of casamino acids, 0.125 g of casein digest, and 15 g of bacteriological or technical agar in 1 L of water.</li>
	<li>Autoclave-sterilize the media and 100 mL of molecular grade water using a 20 min, 121 &#176;C, liquid cycle. 
	NOTE: Ensure all other items that will come in contact with the agar-cell mixture are purchased sterile, including pipette tips and centrifuge tubes, else, autoclave them as well.</li>
</ol>
2. Modified iChip construction
<ol>
	<li>Remove the bottoms of wells in four 96-well plates using a 5 mm agar punch tool.</li>
	<li>Cut 0.05 &#181;m polycarbonate membranes into 7.6 cm x 11 cm rectangles, or equal to the dimensions of the bottom of the 96-well plate.</li>
	<li>Using a silicone sealant, adhere 0.05 &#181;m polycarbonate membranes to the bottom of the 96-well plates, ensuring that the adhesive seals the wells, but does not entirely cover the openings of the wells. Let dry for at least 24 h or following the instructions on the adhesive. 
	NOTE: Sealant must be waterproof, non-toxic, and 100% silicone. Most aquarium sealants will work well.</li>
</ol>
3. Preparation of cell suspensions
<ol>
	<li>Label four 15 mL centrifuge tubes A-D and four 50 mL centrifuge tubes E-H and add 4.5 mL sterile water to each.</li>
	<li>Measure 1 g of soil into a 50 mL centrifuge tube, add 10 mL of sterile water, and vortex for 10 min.</li>
	<li>Let the soil suspension settle for 10 min.</li>
	<li>Pipette 0.5 mL of the supernatant containing cells from the soil into tube A and mix thoroughly.</li>
	<li>Add 0.5 mL of the cell suspension in tube A to tube B and mix thoroughly. Transfer 0.5 mL of solution B to tube C and mix thoroughly. Repeat this for all remaining centrifuge tubes, completing a series of 10-fold dilutions across the eight centrifuge tubes.</li>
	<li>Remove 0.5 mL from tube H to have equal volume in all tubes. 
	NOTE: These concentrations are optimized for local soils. When attempting this procedure for the first time, carry out a larger range of dilutions to find the appropriate sample concentration.</li>
</ol>
4. Modified iChip inoculation
<ol>
	<li>Completely submerge the iChips in 95% ethanol for at least 15 min.</li>
	<li>Remove the plates from the ethanol and place them on sterile paper towel. While allowing the ethanol to evaporate, turn the UV sterilizer on in the laminar flow hood for 15 min to further sterilize them.</li>
	<li>Pipette 360 &#181;L of sterile SMS media into the first column of the plate to act as control wells.</li>
	<li>Add 45 mL of SMS cooled to 50 &#176;C to the cell suspension in tube E and mix thoroughly to combine the cell suspension and agar.</li>
	<li>Pipette 360 &#181;L of the agar-cell mixture from step 4.4 into all other wells of the 96-well plate. 
	NOTE: A multichannel pipette is recommended as agar solidifies quickly. It is unadvised to reheat the agar-cell mixture once mixed due to the risk of killing the microorganisms.</li>
	<li>Once the media is set, seal the top of the plates with a PCR plate cover.</li>
	<li>Repeat steps 3.3 to 3.6 with tubes F-H to fill a total of four iChips with ten-fold differences in concentrations. 
	NOTE: Media can be microwaved for 30 s with a loosened cap when needed or kept in a 60 &#176;C hot water bath between the plates to ensure it remains molten for each.</li>
</ol>
5. Incubation
<ol>
	<li>Place the plates in a box containing approximately one inch of the soil used in step 3.2, membrane side down and place the cover.</li>
	<li>Incubate the plates in the covered container, in a dark place at 25 &#176;C. 
	NOTE: After one week, examine the contents of the modified iChips to ensure that contamination during the setup did not occur. Contamination is indicated by the overgrowth of a single or few microorganisms in all wells of a plate.</li>
	<li>After 6 weeks, examine the iChips. Use the plates containing growth in less than 25% of wells for colony isolation.</li>
</ol>
6. Colony isolation
<ol>
	<li>Rinse the modified iChips 3x with sterile water to remove all soil particulates.</li>
	<li>Wipe the top and sides of the plate with 95% ethanol, avoiding the side with the semi-permeable membrane.</li>
	<li>Using a sterile blade, cut through the plate cover around one well containing a colony.</li>
	<li>Using a sterile streaking tool, pierce the colony and streak onto SMS agar in 100 x 15 mm plates using the four-quadrant method.</li>
	<li>Repeat for all other colonies in the iChips that are growing one colony per well. 
	NOTE: For colonies that are minuscule, the plate can be placed back onto the soil and incubated until large enough to subculture as long as the plate cover was not removed around the well.</li>
	<li>Incubate the SMS plates at 25 &#176;C and monitor growth.</li>
	<li>Examine colonies to ensure axenic cultures have been isolated.</li>
</ol>
7. Identification of microorganisms
<ol>
	<li>Sequence the genomes of the isolates recovered20.</li>
	<li>Evaluate the genomes using JSpeciesWS or another genome-based identification platform to determine the degree of similarity of each isolate to known microorganisms in GenomesDB.</li>
	<li>Categorize isolates below the community accepted thresholds for species identification as putatively new.</li>
</ol>

Advancing iChip Method for Culturing Novel Microorganisms

<ol>
	<li>Newman, D. J., Cragg, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+products+as+sources+of+new+drugs+over+the+nearly+four+decades+from+01/1981+to+09/2019.">Natural products as sources of new drugs over the nearly four decades from 01/1981 to 09/2019.</a> J Nat Prod. 83 (3), 770-803 (2020).</li><li>Fouillaud, M., Dufosse, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+secondary+metabolism+and+biotechnology.">Microbial secondary metabolism and biotechnology.</a> Microorganisms. 10 (1), 123 (2022).</li><li>Rizzetto, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+daptomycin+in+cutaneous+wound+healing:+A+narrative+review.">Role of daptomycin in cutaneous wound healing: A narrative review.</a> Antibiotics. 11 (7), 944 (2022).</li><li>Miethke, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+the+sustainable+discovery+and+development+of+new+antibiotics.">Towards the sustainable discovery and development of new antibiotics.</a> Nat Rev Chem. 5 (10), 726-749 (2021).</li><li>Gunjal, V., Thakare, R., Chopra, S., Reddy, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Teixobactin:+A+paving+stone+toward+a+new+class+of+antibiotics.">Teixobactin: A paving stone toward a new class of antibiotics.</a> J Med Chem. 63, 12171-12195 (2020).</li><li>Atanasov, A. G., Zotchev, S. B., Dirsch, V. M., Supuran, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+products+in+drug+discovery:+Advances+and+opportunities.">Natural products in drug discovery: Advances and opportunities.</a> Nat Rev Drug Discov. 20 (3), 200-216 (2021).</li><li>Epstein, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+phenomenon+of+microbial+uncultivability.">The phenomenon of microbial uncultivability.</a> Curr Opin Microbiol. 16 (5), 636-642 (2013).</li><li>Wright, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+irresistible+newcomer.">An irresistible newcomer.</a> Nature. 517, 422-444 (2015).</li><li>Berdy, B., Spoering, A., Ling, L., Epstein, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+cultivation+of+previously+uncultivable+microorganisms+using+the+ichip.">In situ cultivation of previously uncultivable microorganisms using the ichip.</a> Nat Protoc. 12 (10), 2232-2242 (2017).</li><li>Jung, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Triggering+growth+via+growth+initiation+factors+in+nature:+A+putative+mechanism+for+in+situ+cultivation+of+previously+uncultivated+microorganisms.">Triggering growth via growth initiation factors in nature: A putative mechanism for in situ cultivation of previously uncultivated microorganisms.</a> Front Microbiol. 12, 537194 (2021).</li><li>Nichols, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+ichip+for+high-throughput+in+situ+cultivation+of+&amp;#34;uncultivable&amp;#34;+microbial+species.">Use of ichip for high-throughput in situ cultivation of &amp;#34;uncultivable&amp;#34; microbial species.</a> Appl Environ Microbiol. 76 (8), 2445-2450 (2010).</li><li>Megaw, J., Kelly, S. A., Thompson, T. P., Skvortsov, T., Gilmore, B. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+the+microbial+community+of+a+triassic+halite+deposit+in+Northern+Ireland:+An+environment+with+significant+potential+for+biodiscovery.">Profiling the microbial community of a triassic halite deposit in Northern Ireland: An environment with significant potential for biodiscovery.</a> FEMS Microbiol Lett. 366 (22), fnz242 (2019).</li><li>Vitorino, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+and+conventional+isolation+techniques+to+obtain+planctomycetes+from+marine+environments.">Novel and conventional isolation techniques to obtain planctomycetes from marine environments.</a> Microorganisms. 9 (10), 2078 (2021).</li><li>Moote, P., Polo, R. O., Uwiera, R. R. E., Inglis, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+strategies+for+isolation+anaerobic+bacteria+from+the+porcine+intestine.">Comparison of strategies for isolation anaerobic bacteria from the porcine intestine.</a> Appl Environ Microbiol. 87 (9), e00088-e00121 (2021).</li><li>Vitorino, I. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rhodopirellula+aestuarii+sp.+Nov.,+a+novel+member+of+the+genus+rhodopirellula+isolated+from+brackish+sediments+collected+in+the+tagus+river+estuary,+Portugal.">Rhodopirellula aestuarii sp. Nov., a novel member of the genus rhodopirellula isolated from brackish sediments collected in the tagus river estuary, Portugal.</a> Syst Appl Microbiol. 45 (6), 126360 (2022).</li><li>Ding, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hanstruepera+marina+sp.+Nov.+and+Hanstruepera+flava+sp.+Nov.,+two+novel+species+in+the+family+flavobacteriaceae+isolated+by+a+modified+in+situ+cultivation+technique+from+marine+sediment.">Hanstruepera marina sp. Nov. and Hanstruepera flava sp. Nov., two novel species in the family flavobacteriaceae isolated by a modified in situ cultivation technique from marine sediment.</a> Front Microbiol. 13, 957397 (2022).</li><li>Ling, L. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+antibiotic+kills+pathogens+without+detectable+resistance.">A new antibiotic kills pathogens without detectable resistance.</a> Nature. 517 (7535), 455-459 (2015).</li><li>Qi, Y. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery,+synthesis,+and+optimization+of+teixobactin,+a+novel+antibiotic+without+detectable+bacterial+resistance.">Discovery, synthesis, and optimization of teixobactin, a novel antibiotic without detectable bacterial resistance.</a> J Pept Sci. 28 (11), e3428 (2022).</li><li>Piddock, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Teixobactin,+the+first+of+a+new+class+of+antibiotics+discovered+by+ichip+technology.">Teixobactin, the first of a new class of antibiotics discovered by ichip technology.</a> J of Antimicrob Chemother. 70 (10), 2679-2680 (2015).</li><li>Gong, L., Wong, C. H., Idol, J., Ngan, C. Y., Wei, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultra-long+read+sequencing+for+whole+genomic+DNA+analysis.">Ultra-long read sequencing for whole genomic DNA analysis.</a> J Vis Exp. (145), e58954 (2019).</li><li>Covington, B. C., Xu, F., Seyedsayamdost, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+natural+product+chemist's+guide+to+unlocking+silent+biosynthetic+gene+clusters.">A natural product chemist's guide to unlocking silent biosynthetic gene clusters.</a> Annu Rev Biochem. 90, 763-788 (2021).</li><li>Lee, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mini+review:+Genome+mining+approaches+for+the+identification+of+secondary+metabolite+biosynthetic+gene+clusters+in+Streptomyces.">Mini review: Genome mining approaches for the identification of secondary metabolite biosynthetic gene clusters in Streptomyces.</a> Comput Mol Biol. 18, 1548-1556 (2020).</li><li>Kaeverlein, T., Lewis, K., Epstein, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolating+&amp;#34;uncultivable&amp;#34;+microorganisms+in+pure+culture+in+a+simulated+natural+environment.">Isolating &amp;#34;uncultivable&amp;#34; microorganisms in pure culture in a simulated natural environment.</a> Science. 296 (5570), 1127-1129 (2002).</li><li>Trcek, J., Mira, N. P., Jarboe, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adaptation+and+tolerance+of+bacteria+against+acetic+acid.">Adaptation and tolerance of bacteria against acetic acid.</a> Appl Microbiol Biotechnol. 99 (15), 6215-6229 (2015).</li><li>Kurm, V., Van Der Putten, W. H., Hol, W. H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cultivation-success+of+rare+soil+bacteria+is+not+influenced+by+incubation+time+and+growth+medium.">Cultivation-success of rare soil bacteria is not influenced by incubation time and growth medium.</a> PLOS One. 14 (1), e0210073 (2019).</li><li>Buerger, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+scout+hypothesis+and+microbial+discovery.">Microbial scout hypothesis and microbial discovery.</a> Appl Environ Microbiol. 78 (9), 3229-3233 (2012).</li><li>Lodhi, A. F., Zhang, Y., Adil, M., Deng, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibiotic+discovery:+Combining+isolation+chip+(ichip)+technology+and+co-culture+technique.">Antibiotic discovery: Combining isolation chip (ichip) technology and co-culture technique.</a> Appl Microbiol Biotechnol. 102 (17), 7333-7341 (2018).</li></ol>

The authors have declared to have no conflicts of interest.

Numerous methods, such as genome mining and examining silent biosynthetic pathways, have facilitated the discovery of novel bioactive chemicals in recent years21,22. However, NPs discovered using such methods often exhibit high structural similarity to known compounds. Gaining access to previously uncultured microorganisms will unlock greater chemical diversity and NPs with novel modes of action that can better aid in combatting microbial resistance. The iChip isolation technique has been shown to increase the cultivability of novel microorganisms, which can be used to build libraries of microorganisms for the discovery of novel NPs.
The earliest conceptualization of an iChip was published in 2002, which consisted of single metal rings containing an agar cell mixture sealed with semi-permeable membranes and incubated in situ23. It was later iterated upon in 2010 to contain a small chip with many wells11, followed by the development of an inexpensive iChip constructed from common lab materials in an influential Nature Protocols publication in 20179. Several modifications were made to the Nature protocol in this publication to improve its practicality and ease of use. The Nature protocol involves gluing a semi-permeable membrane to both&#160;sides of a chip compared to this method, which uses an adhesive plate cover on one side. Issues may arise when using silicone glue to attach the membrane after the iChip is loaded. To our knowledge, all non-toxic silicone adhesives emit acetic acid as they set, which may impact cell viability24. The protocol outlined in this video also significantly reduces the amount of handling required after inoculation by using the PCR plate cover to seal the filled plate, further ensuring sterility and reducing the set-up time. Based on the identification of multiple novel isolates from this experiment, the use of only a single semi-permeable membrane does inhibit the increase in rates of novel organism discovery that has been reported for iChips constructed with two semipermeable membranes. However, further experiments with a greater sample size would be required to quantify the impact.
Another method modification is to only subculture from the modified iChips that contain growth in less than 25% of the wells. If colonies grow in the majority of the wells of a plate, there are likely some wells that contain multiple microorganisms, even if not easily visible. During method development it was found that it was largely impossible to obtain axenic cultures when subculturing from wells containing more than one colony. The isolation of non-axenic cultures presents significant issues downstream in terms of bioactivity assays and identification. Thus, for simplicity, only modified iChips with colonies growing in a portion of the wells are recommended to be subcultured from.
The most significant issue that can arise with iChip methods is the contamination of wells or entire iChips with other microorganisms. Contamination is indicated by colonies growing in the control wells, or the same microorganism growing across several wells or an entire area of the modified iChip. The source of contamination could be due to inadequate sterilization of materials during the set-up, or improper aseptic technique. In such cases, ensure all materials used are autoclave or ethanol sterilized as indicated in the method, and ensure no contact occurs between any non-sterile items and the modified iChip other than the agar-cell mixture. If an overgrowth of a single microorganisms is observed at the bottom or top of multiple modified iChip wells it is most likely the result of an incomplete seal between the wells and membrane. In this case, ensure that the adhesive used is 100% silicone, which does not degrade in ethanol, and ensure the semipermeable membrane and PCR plate cover are completely sealed around each well during construction.
The dilution series used in the current protocol should provide adequate dilution for most soil types with a storage period of less than one week as it includes a thousand-fold range of dilutions. However, there can be significant variation in microorganism counts between soil types. If the control wells contain no growth but multiple colonies are growing in each well of all four modified iChips, the cell concentrations used were not low enough. The dilution series should be modified to reach lower cell concentrations in the cell-media mixtures used to set up the modified iChips. Similarly, if no growth is observed in any of these plates, the concentrations used in the cell-media mixtures should be increased. Alternatively, it is possible that the temperature of the media used was too high for the survival of microorganisms. In such a case, the media should be allowed to cool as much as possible without solidifying before being added to the diluted cell suspension.
The technology is an important advance toward overcoming the great plate count anomaly. However, it is still limited by the unsuitability of conventional culturing techniques, as indicated by the number of microorganisms that do not survive the transfer from the modified iChip to conventional agar plates. Previous publications have reported that multiple rounds of subculture and incubation in iChips further increase the cultivability of the microorganisms. The extended domestication time and exposure to soil growth factors while on agar in the iChip increases the chances of a colony growing on agar alone. However, this approach has not been reported to yield a higher likelihood of novel microorganisms than a single iChip incubation25,26.
Many other tactics are being explored and modified to increase the cultivability of novel microorganisms. For example, making an entire iChip device out of a semi-permeable material has been proposed to facilitate the co-culture of microorganisms in neighboring wells27. That being said, an advantage of construction outlined in this publication is its low cost with the cost of building one plate equating to approximately $12 ($4 per 96-well plate, $8 per membrane, $2 per PCR cover). Furthermore, its simple construction makes it an uncomplicated tool when used as described and provides many possibilities for customization. Though this protocol uses a medium selective for bacteria, the experimental set-up can theoretically be tuned to target a desired microbial population by modifying the medium used, such as using bacteria-suppressing media to target fungi, or low nutrient agar for sporulating microorganisms.

Environmental bacteria are a rich source of natural products (NPs)1. These metabolites are not vital to the survival of the microorganisms but instead are produced to facilitate their colonization by outcompeting other microorganisms in their surroundings2. Evolution has fine-tuned the chemical structures and activities of NPs, making them effective antimicrobial agents. Such an example is daptomycin, an antibiotic approved by the FDA in 20033. In recent years, microbial resistance has increased in occurrence and severity, and novel drugs like daptomycin stand as last-line treatments against infections that have developed resistance to older antibiotics4. The development of new antibiotics and other drugs is essential to keeping common infections and diseases treatable.
Although NPs often make good drug leads, the pharmaceutical industry turned to synthetic methods for drug discovery after the golden age of antibiotics in the 1950s to 1960s5. By the 1970s, the same microorganisms and antimicrobial metabolites continued to be reisolated repeatedly, with fewer and fewer novel drug candidates being discovered1,6. The soil microbiome contains great microbial diversity, but only a small number of microorganisms can be isolated under conventional laboratory conditions. The vast majority of soil microorganisms of microorganisms detected by genomics are not observed when cultured using conventional culturing methods, leading to the issue being coined &#34;the great plate count anomaly&#34;7. These unculturable microbes have been called microbial dark matter as they are known to exist but cannot be studied in vitro until they can be isolated as pure cultures. These unculturable microorganisms can likely produce a wealth of drug candidates, which is of great importance in the age of microbial resistance.
The iChip technique is one method that can be used to increase the recovery of novel microorganisms from the environment8,9. This technology aids in simulating the natural environment of bacteria during incubation, thereby increasing the cultivability of microorganisms that otherwise cannot survive conventional laboratory conditions10. Modified iChips have already been developed and used to isolate microorganisms from many different sources, such as soil, sediment, marine environments, and animal intestines11,12,13,14,15,16. Perhaps the most impactful case of the use of this technology has been by NovoBiotic Pharmaceuticals, where a novel bacterium, Eleftheria terrae, was discovered17. This microorganism was found to produce Teixobactin, an antibiotic of a new class, which inhibits several resistant bacterial species pertinent to human health without detected resistance development5,18. This was an impactful discovery as Teixobactin is the first new class of antibiotics discovered in decades and is a sign that this technique is a promising route for novel drug discoveries and overcoming the great plate count anomaly19. Herein, a modified iChip based on a previous publication by Berdy et al. is presented which was optimized for ease of use and contamination prevention9.

<table><tbody><tr><td>0.1-20 &amp;micro;L pipette tips</td><td>VWR</td><td>76322-158</td><td>Pack of 768</td></tr><tr><td>0.2 mL PCR tubes</td><td>ThermoFisher Scientific</td><td>AB0337</td><td>Case of 1000</td></tr><tr><td>0.5-5 mL single channel pipette</td><td>VWR</td><td>CA11020-004</td><td></td></tr><tr><td>1 L glass bottle</td><td>Millipore Sigma</td><td>CLS13951L</td><td>Must be autoclaveable.&amp;nbsp;</td></tr><tr><td>100 x 15 mm Petri plates</td><td>VWR</td><td>25384-342</td><td>Case of 500</td></tr><tr><td>100% Silicone sealant</td><td>Marineland</td><td>31003</td><td></td></tr><tr><td>1000 &amp;micro;L multichannel pipette tips</td><td>ThermoFisher Scientific</td><td>9401113</td><td>Case of 960</td></tr><tr><td>100-1000 &amp;micro;L pipette tips</td><td>VWR</td><td>76322-164</td><td>Pack of 768</td></tr><tr><td>100-1000 &amp;micro;L single channel pipette</td><td>VWR</td><td>76169-240</td><td></td></tr><tr><td>100-1200 &amp;micro;L multichannel pippette</td><td>ThermoFisher Scientific</td><td>46300800</td><td>Must have 360 &amp;micro;L volume capacity.&amp;nbsp;</td></tr><tr><td>1-10 &amp;micro;L single channel pipette</td><td>VWR</td><td>76169-232</td><td></td></tr><tr><td>1-5 mL pipette tips</td><td>VWR</td><td>CA11020-008</td><td>Pack of 500</td></tr><tr><td>15 mL sterile centrifuge tubes</td><td>VWR</td><td>CA21008-918</td><td>Case of 500</td></tr><tr><td>16s rRNA-F primer (AGAGTTTGATCCTGGCTCAG) &amp;ndash; 10mM</td><td>Integrated DNA Technologies</td><td>51-01-19-06</td><td>10 &amp;micro;g</td></tr><tr><td>16s rRNA-R primer (ACGGCTACCTTGTTACGACTT) &amp;ndash; 10mM</td><td>Integrated DNA Technologies</td><td>51-01-19-07</td><td>10 &amp;micro;g</td></tr><tr><td>4 mm cork borer</td><td>VWR</td><td>470121-860</td><td></td></tr><tr><td>50 mL sterile centrifuge tubes</td><td>VWR</td><td>CA21008-940</td><td>Case of 500</td></tr><tr><td>95% ethanol</td><td>Thermo Fisher Scientific</td><td>A412-500</td><td>500 mL</td></tr><tr><td>96-well plate</td><td>VWR</td><td>10062-900</td><td>Case of 100</td></tr><tr><td>Autoclave</td><td>Cole-Parmer</td><td>UZ-01850-34</td><td>8 L, 115 VAC</td></tr><tr><td>Bacteriological agar</td><td>ThermoFisher Scientific</td><td>443570010</td><td>1 kg</td></tr><tr><td>bin</td><td>Thomas Scientific</td><td>1216H91</td><td>5 bins per pack</td></tr><tr><td>Casamino acids</td><td>ThermoFisher Scientific</td><td>223120</td><td>500 g</td></tr><tr><td>Casein digest</td><td>ThermoFisher Scientific</td><td>211610</td><td>500 g</td></tr><tr><td>Electrofluoresis grade agarose</td><td>Thermo Fisher Scientific</td><td>J66501.30</td><td>250 g</td></tr><tr><td>iBright FL1500 Imaging System</td><td>ThermoFisher Scientific</td><td>A44115</td><td></td></tr><tr><td>Laminar flow hood</td><td>CleanTech</td><td>1000-6-A</td><td></td></tr><tr><td>Minion Nanopore Sequencer&amp;nbsp;</td><td>Oxford Nanopore Technologies</td><td>MinIon Mk1C</td><td></td></tr><tr><td>NanoDrop One/One Microvolume UV-Vis Spectrophotometer</td><td>ThermoFisher Scientific</td><td>ND-ONE-W</td><td></td></tr><tr><td>Nuclease Free Water</td><td>Thermo Fisher Scientific</td><td>AM9937</td><td>10 x 50 mL</td></tr><tr><td>Nucleobond HMW DNA kit</td><td>Takara</td><td>740160.2</td><td></td></tr><tr><td>Paper towel</td><td>VWR</td><td>89402-824</td><td></td></tr><tr><td>Phusion Green Hot Start II High-Fidelity PCR Master Mix</td><td>Thermo Fisher Scientific</td><td>F566L</td><td>500 Reactions</td></tr><tr><td>Potato starch</td><td>ThermoFisher Scientific</td><td>419690025</td><td>2.5 kg</td></tr><tr><td>QIAGEN CLC Genomics Workbench Software or similar</td><td>Qiagen</td><td></td><td></td></tr><tr><td>Rapid Barcoding 24 Kit</td><td>Oxford Nanopore Technologies</td><td>SQK-RBK114.24</td><td></td></tr><tr><td>SimpliAmp thermal cycler</td><td>Applied Biosystems</td><td>A24811</td><td></td></tr><tr><td>Sterile Inoculation loops with needle</td><td>VVWR</td><td>76534-512</td><td>Case of 1000</td></tr><tr><td>Sterile surgical blade</td><td>VWR</td><td>76457-444</td><td></td></tr><tr><td>SYBR Safe, or simmilar&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>S33101</td><td></td></tr><tr><td>UltraPure Agarose&amp;nbsp;</td><td>ThermoFisher Scientific</td><td>16500-500</td><td></td></tr><tr><td>Vortex</td><td>VWR</td><td>76549-928</td><td>Must accomadate 15 and 50 mL centrifuge tubes</td></tr><tr><td>VWR Stereo Zoom Trinocular Microscope</td><td>VWR</td><td>89404-476</td><td></td></tr><tr><td>Whatman&amp;nbsp;Nuclepore&amp;nbsp;Track-Etched Membranes</td><td>Millipore Sigma</td><td>WHA113502</td><td>L x W 8&amp;nbsp;in. x 10&amp;nbsp;in., pore size 0.03&amp;nbsp;&amp;mu;m</td></tr></tbody></table>

isolation of soil microorganisms using ichip technology

The iChip isolation technique uses an in-situ isolation device that increases the cultivability of previously unculturable microorganisms. Microorganisms are an important source of novel chemistries and potentially bioactive molecules. However, only 1% of environmental microorganisms can be cultured using conventional laboratory methods. With the rise in antimicrobial resistance, finding new drugs to combat infections and diseases is of foremost importance, and a critical method to finding new molecules is the discovery of new microorganisms. By incubating colonies of soil microorganisms in the wells of a 96-well plate, sealed with a semipermeable membrane and incubated on top of soil, the microbes are in contact with water and growth factors from the soil, allowing for the isolation of novel microbes in a laboratory setting. After a period of domestication in an iChip, microorganisms can potentially be subcultured onto conventional media and used for further study. This device is valuable to bioactive molecule discovery and soil microbiome research and has been used previously in both applications.

A visual overview of the protocol is shown in Figure 1. A successful modified iChip experiment results in at least one plate containing growth in less than 25% of the wells, with no growth occurring in the control wells. This number of wells with growth generally ensures that single colonies are isolated in wells. Additionally, the number of colonies, or the number of wells containing colonies, should decrease tenfold with each subsequent plate prepared from the series of dilutions. Representative results are shown in Figure 2. where plates 7 and 8 are successful iChips as they contain growth in less than 25% of wells, and the percentage of wells containing colonies decreases with each plate, as shown in Table 1. If all plates in a trial contain more than one colony per well or no colonies in any wells, that constitutes a negative outcome.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/67426/67426fig01.jpg"> 
Figure 1: Schematic overview for using a modified iChip to culture soil microbes. (A,B) Construction of the plate (Step 2). (C) Preparation of inoculum (Step 3). (D,E) iChip setup (Step 4). (F) Incubation of the iChip (Step 5). (G-I) Transfer of the isolates to conventional media (Step 6). <a href="https://www.jove.com/files/ftp_upload/67426/67426fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Ichip</td>
			<td>Concentration of soil in agar suspension</td>
			<td>Wells with colonies</td>
			<td>Colony-forming Units</td>
		</tr>
		<tr>
			<td>E</td>
			<td>5.0 x 10-6 g/mL</td>
			<td>All</td>
			<td>Too many to count</td>
		</tr>
		<tr>
			<td>F</td>
			<td>5.0 x 10-7 g/mL</td>
			<td>All</td>
			<td>Too many to count</td>
		</tr>
		<tr>
			<td>G</td>
			<td>5.0 x 10-8 g/mL</td>
			<td>22</td>
			<td>22</td>
		</tr>
		<tr>
			<td>H</td>
			<td>5.0 x 10-9 g/mL</td>
			<td>6</td>
			<td>6</td>
		</tr>
	</tbody>
</table>
Table 1: Representative data from a successful iChip experiment where the number of wells containing colonies decreases with each dilution in series.
<img alt="ELISA assay diagram: 96-well plate layout comparison, antibody binding pattern analysis." class="xfigimg" src="/files/ftp_upload/67426/67426fig02.jpg" data-altupdatedat="1747911167000" data-alt="Figure 2"> 
Figure 2: Exemplary results of two successful modified iChips. The iChips were from the same experiment in which (A) the plate prepared from cell-agar mixture G contains 22 colonies, and (B) the plate prepared from cell-agar mixture H contains six colonies, consistent with the 10-fold dilution difference between mixtures. <a href="https://www.jove.com/files/ftp_upload/67426/67426fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
One can visualize colonies with the naked eye or microscopy, as shown in Figure 3A-G. Colonies may be growing on the surface of the agar, as seen in Figure 3B or embedded in the agar, such as the colony in Figure 3F. There may be cases in which there are two colonies in the same well in a successful modified iChip, such as in Figure 3G. In some cases, the colonies are far enough apart that they can be pierced with a needle separately and subcultured; however, it is unlikely those in Figure 3G could be easily cultured as axenic microorganisms. Examples of colonies transferred from the iChip onto conventional SMS media are shown in Figure 4.
<img alt="Bacterial growth experiment on agar plates; microscopy images showing colony formation." class="xfigimg" src="/files/ftp_upload/67426/67426fig03.jpg" data-altupdatedat="1747911167000" data-alt="Figure 3"> 
Figure 3: Representative microscopic view of colonies growing in an iChip after 6 weeks of incubation. (A-F) Single colonies are observed, which should be subcultured from, and in (G) two colonies are observed in close proximity, which are difficult to obtain as axenic cultures. <a href="https://www.jove.com/files/ftp_upload/67426/67426fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Bacterial culture on agar plate, colony growth pattern analysis in petri dish experiment." class="xfigimg" src="/files/ftp_upload/67426/67426fig04.jpg" data-altupdatedat="1747911167000" data-alt="Figure 4"> 
Figure 4: Representative result of a bacterium isolated from the modified iChip once growing on an SMS agar plate. <a href="https://www.jove.com/files/ftp_upload/67426/67426fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
The ability to isolate colonies from the modified iChip onto conventional agar plates also determines the experiment's success. Not all colonies growing in the modified iChip will survive the transfer to conventional plates. In an iChip, colonies are exposed to growth factors and soil nutrients, increasing their cultivability. For some microorganisms, a period of domestication is not enough to make them culturable in conventional conditions. The recovery rate of colonies from an iChip to plates will vary from experiment to experiment, but some should grow in plates as this method will also culture easily culturable microorganisms. For example, the modified iChips in Figure 2 contained 28 colonies in total, and the number of colonies that grew on agar plates after subculture was 16, while 12 did not survive the transfer. Isolates can be identified and used for further study once cultured on full-sized agar plates, as shown in Figure 4.
A successful modified iChip experiment should result in the isolation of microorganisms that differ from known microorganisms at the species level. The degree of similarity of each isolate to known microorganisms is found by comparing the isolated DNA to the genomes of known microorganisms. The tetra Z scores of the closest related microorganisms to each isolate describe the percent similarity. Figure 5 shows that of the twelve bacteria isolated, four were new species or higher, two were likely new strains, and six were known microorganisms. The recovery of several novel species or strains is consistent with previously published iChip experiments, indicating that this modified iChip construction does not impede the increase in the recovery of novel species11.
<img alt="Taxonomic novelty pie chart; 6 known species, 2 possible, 4 new; species percentage similarity." class="xfigimg" src="/files/ftp_upload/67426/67426fig05.jpg" data-altupdatedat="1747911167000" data-alt="Figure 5"> 
Figure 5: The taxonomic classification level of isolates recovered from an iChip experiment. Percent similarity was determined based on the tetra Z scores, which describe the isolates similarity to known bacteria where &gt;99.9% similarity indicates a species match, 98.9%-99.9% similarity indicates a possible new species, and &lt;98.9% similarity indicates a new species or higher. <a href="https://www.jove.com/files/ftp_upload/67426/67426fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Isolation of Soil Microorganisms Using iChip Technology

The iChip technique makes use of an inexpensive and simple in-situ isolation device that increases the rates of novel microorganism discovery from the soil. Novel microorganisms can be used for further study pertaining to the soil microbiome or natural product discovery, amongst other applications.

The iChip isolation technique uses an in-situ isolation device that increases the cultivability of previously unculturable microorganisms. Microorganisms ...

isolation-of-soil-microorganisms-using-ichip-technology

Research

JoVE Journal

Biochemistry

728 Views.  Charlottetown Research and Development Center, Agriculture and Agri-Food Canada. We proberen nieuwe soorten chemie te ontdekken om landbouwpathogenen te bestrijden. Met behulp van iChip-technologie hebben we nieuwe organismen geïsoleerd, waarvan we hopen dat ze tot nieuwe chemie zullen leiden. Het testen van deze organismen en/of hun natuurlijke producten tegen landbouwpathogenen kan leiden tot het vinden van nieuwe biopesticide kandidaat-organismen en/of verbindingen.De iChip-methode stelt ons in staat om micro-organismen te isol...

Video: Isolatie van bodemmicro-organismen met behulp van iChip-technologie

Isolation of Cognate RNA-protein Complexes from Cells Using Oligonucleotide-directed Elution

Ribonucleoprotein particles direct the biogenesis and post-transcriptional regulation of all mRNAs through distinct combinations of RNA binding proteins. They are composed of position-dependent, cis-acting RNA elements and unique combinations of RNA binding proteins. Defining the composition of a specific RNP is essential to achieving a fundamental understanding of gene regulation. The isolation of a select RNP is akin to finding a needle in a haystack. Here, we demonstrate an approach to isolate RNPs associated at the 5' untranslated region of a select mRNA in asynchronous, transfected cells. This cognate RNP has been demonstrated to be necessary for the translation of select viruses and cellular stress-response genes.
The demonstrated RNA-protein co-precipitation protocol is suitable for the downstream analysis of protein components through proteomic analyses, immunoblots, or suitable biochemical identification assays. This experimental protocol demonstrates that DHX9/RNA helicase A is enriched at the 5' terminus of cognate retroviral RNA and provides preliminary information for the identification of its association with cell stress-associated huR and junD cognate mRNAs.

This manuscript describes an approach to isolate select cognate RNPs formed in eukaryotic cells via a specific oligonucleotide-directed enrichment. We demonstrate the applicability of this approach by isolating a cognate RNP bound to the retroviral 5' untranslated region that is composed of DHX9/RNA helicase A.

Ribonucleoprotein particles direct the biogenesis and post-transcriptional regulation of all mRNAs through distinct combinations of RNA binding proteins. ...

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from the oxidation of reduced compounds such as nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FADH2). The complete annotation of the Arabidopsis thaliana genome has established it as the most widely used plant model system, and thus the need to purify mitochondria from a variety of organs (leaf, root, or flower) is necessary to fully utilize the tools that are now available for Arabidopsis to study mitochondrial biology. Mitochondria are isolated by homogenization of the tissue using a variety of approaches, followed by a series of differential centrifugation steps producing a crude mitochondrial pellet that is further purified using continuous colloidal density gradient centrifugation. The colloidal density material is subsequently removed by multiple centrifugation steps. Starting from 100 g of fresh leaf tissue, 2 - 3 mg of mitochondria can be routinely obtained. Respiratory experiments on these mitochondria display typical rates of 100 - 250 nmol O2 min-1 mg total mitochondrial protein-1 (NADH-dependent rate) with the ability to use various substrates and inhibitors to determine which substrates are being oxidized and the capacity of the alternative and cytochrome terminal oxidases. This protocol describes an isolation method of mitochondria from Arabidopsis thaliana leaves using continuous colloidal density gradients and an efficient respiratory measurements of purified plant mitochondria.

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

As mitochondria are only a small percentage of the plant cell, they need to be purified for a range of studies. Mitochondria can be isolated from a variety of plant organs by homogenization, followed by differential and density gradient centrifugation to obtain a highly purified mitochondrial fraction.

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from ...

Using Three-color Single-molecule FRET to Study the Correlation of Protein Interactions

Single-molecule F&#246;rster resonance energy transfer (smFRET) has become a widely used biophysical technique to study the dynamics of biomolecules. For many molecular machines in a cell proteins have to act together&#160;with interaction partners in a functional cycle to fulfill their task. The extension of two-color to multi-color smFRET makes it possible to simultaneously probe more than one interaction or conformational change. This not only adds a new dimension to smFRET experiments but it also offers the unique possibility to directly study the sequence of events and to detect correlated interactions when using an immobilized sample and a total internal reflection fluorescence microscope (TIRFM). Therefore, multi-color smFRET is a versatile tool for studying biomolecular complexes in a quantitative manner and in a previously unachievable detail.
Here, we demonstrate how to overcome the special challenges of multi-color smFRET experiments on proteins. We present detailed protocols for obtaining the data and for extracting kinetic information. This includes trace selection criteria, state separation, and the recovery of state trajectories from the noisy data using a 3D ensemble Hidden Markov Model (HMM). Compared to other methods, the kinetic information is not recovered from dwell time histograms but directly from the HMM. The maximum likelihood framework allows us to critically evaluate the kinetic model and to provide meaningful uncertainties for the rates.
By applying our method to the heat shock protein 90 (Hsp90), we are able to disentangle the nucleotide binding and the global conformational changes of the protein. This allows us to directly observe the cooperativity between the two nucleotide binding pockets of the Hsp90 dimer.

Here, we present a protocol to obtain three-color smFRET data and its analysis with a 3D ensemble Hidden Markov Model. With this approach, scientists can extract kinetic information from complex protein systems, including cooperativity or correlated interactions.

Single-molecule F&#246;rster resonance energy transfer (smFRET) has become a widely used biophysical technique to study the dynamics of biomolecules. For ...

Studying Protein Import into Chloroplasts Using Protoplasts

The chloroplast is an essential organelle that is responsible for various cellular processes in plants, such as photosynthesis and the production of many secondary metabolites and lipids. Chloroplasts require a large number of proteins for these various physiological processes. Over 95% of chloroplast proteins are nucleus-encoded and imported into chloroplasts from the cytosol after translation on cytosolic ribosomes. Thus, the proper import or targeting of these nucleus-encoded chloroplast proteins to chloroplasts is essential for the proper functioning of chloroplasts as well as the plant cell. Nucleus-encoded chloroplast proteins contain signal sequences for specific targeting to chloroplasts. Molecular machinery localized to the chloroplast or cytosol recognize these signals and carry out the import process. To investigate the mechanisms of protein import or targeting to chloroplasts in vivo, we developed a rapid, efficient protoplast-based method to analyze protein import into chloroplasts of Arabidopsis. In this method, we use protoplasts isolated from leaf tissues of Arabidopsis. Here, we provide a detailed protocol for using protoplasts to investigate the mechanism by which proteins are imported into chloroplasts.

Here we describe a protocol to express proteins into protoplasts by using PEG-mediated transformation method. The method provides easy expression of proteins of interest, and efficient investigation of protein localization and the import process for various experimental conditions in vivo.

The chloroplast is an essential organelle that is responsible for various cellular processes in plants, such as photosynthesis and the production of many ...

Extracellular Protein Microarray Technology for High Throughput Detection of Low Affinity Receptor-Ligand Interactions

Secreted factors, membrane-tethered receptors, and their interacting partners are main regulators of cellular communication and initiation of signaling cascades during homeostasis and disease, and as such represent prime therapeutic targets. Despite their relevance, these interaction networks remain significantly underrepresented in current databases; therefore, most extracellular proteins have no documented binding partner. This discrepancy is primarily due to the challenges associated with the study of the extracellular proteins, including expression of functional proteins, and the weak, low affinity, protein interactions often established between cell surface receptors. The purpose of this method is to describe the printing of a library of extracellular proteins in a microarray format for screening of protein-protein interactions. To enable detection of weak interactions, a method based on multimerization of the query protein under study is described. Coupled to this microbead-based multimerization approach for increased multivalency, the protein microarray allows robust detection of transient protein-protein interactions in high throughput. This method offers a rapid and low sample consuming-approach for identification of new interactions applicable to any extracellular protein. Protein microarray printing and screening protocol are described. This technology will be useful for investigators seeking a robust method for discovery of protein interactions in the extracellular space.

Here, we present a protocol to screen extracellular protein microarrays for identification of novel receptor-ligand interactions in high throughput. We also describe a method to enhance detection of transient protein-protein interactions by using protein-microbead complexes.

Secreted factors, membrane-tethered receptors, and their interacting partners are main regulators of cellular communication and initiation of signaling ...

Identifying Amino Acid Overproducers Using Rare-Codon-Rich Markers

To satisfy the ever-growing market for amino acids, high-performance production strains are needed. The amino acid overproducers are conventionally identified by harnessing the competitions between amino acids and their analogs. However, this analog-based method is of low accuracy, and proper analogs for specific amino acids are limited. Here, we present an alternative strategy that enables an accurate, sensitive, and high-throughput screening of amino acid overproducers using rare-codon-rich markers. This strategy is inspired by the phenomenon of codon usage bias in protein translation, for which codons are categorized into common or rare ones based on their frequencies of occurrence in the coding DNA. The translation of rare codons depends on their corresponding rare transfer RNAs (tRNAs), which cannot be fully charged by the cognate amino acids under starvation. Theoretically, the rare tRNAs can be charged if there is a surplus of the amino acids after charging the synonymous common isoacceptors. Therefore, retarded translations caused by rare codons could be restored by feeding or intracellular overproductions of the corresponding amino acids. Under this assumption, a selection or screening system for identifying amino acid overproducers is established by replacing the common codons of the targeted amino acids with their synonymous rare alternatives in the antibiotic resistance genes or the genes encoding fluorescent or chromogenic proteins. We show that the protein expressions can be greatly hindered by the incorporation of rare codons and that the levels of proteins correlate positively with the amino acid concentrations. Using this system, overproducers of multiple amino acids can be readily screened out from mutation libraries. This rare-codon-based strategy only requires a single modified gene, and the host is less likely to escape the selection than in other methods. It offers an alternative approach for obtaining amino acid overproducers.

This study presents an alternative strategy to the conventional toxic analog-based method in identifying amino acid overproducers by using rare-codon-rich markers to achieve accuracy, sensitivity, and high-throughput simultaneously.

To satisfy the ever-growing market for amino acids, high-performance production strains are needed. The amino acid overproducers are conventionally ...

Medium Preparation for the Cultivation of Microorganisms under Strictly Anaerobic/Anoxic Conditions

In contrast to aerobic organisms, strictly anaerobic microorganisms require the absence of oxygen and usually a low redox potential to initiate growth. As oxygen is ubiquitous in air, retaining O2-free conditions during all steps of cultivation is challenging but a prerequisite for anaerobic culturing. The protocol presented here demonstrates the successful cultivation of an anaerobic mixed culture derived from a biogas plant using a simple and inexpensive method. A precise description of the entire anoxic culturing process is given including media preparation, filling of cultivation flasks, supplementation with redox indicator and reducing agents to provide low redox potentials as well as exchanging the headspace to keep media free from oxygen. Furthermore, a detailed overview of aseptically inoculating gas tight serum flasks (by using sterile syringes and needles) and suitable incubation conditions is provided. The present protocol further deals with gas and liquid sampling for subsequent analyses regarding gas composition and volatile fatty acid concentrations using gas chromatography (GC) and high performance liquid chromatography (HPLC), respectively, and the calculation of biogas and methane yield considering the ideal gas law.

As obligate anaerobic organisms are unable to grow upon oxygen exposure, the use of anaerobic culturing techniques is indispensable. Here, we demonstrate a simple and effective method to cultivate a mixed culture derived from a biogas plant from media preparation to gas and volatile fatty acid quantification.

In contrast to aerobic organisms, strictly anaerobic microorganisms require the absence of oxygen and usually a low redox potential to initiate growth. As ...

Paper-Based Preconcentration and Isolation of Microvesicles and Exosomes

Microvesicles and exosomes are small membranous vesicles released to the extracellular environment and circulated throughout the body. Because they contain various parental cell-derived biomolecules such as DNA, mRNA, miRNA, proteins, and lipids, their enrichment and isolation are critical steps for their exploitation as potential biomarkers for clinical applications. However, conventional isolation methods (e.g., ultracentrifugation) cause significant loss and damage to microvesicles and exosomes. These methods also require multiple repetitive steps &#160;of ultracentrifugation, loading, and wasting of reagents. This article describes a detailed method to fabricate an origami-paper-based device (Exo-PAD) designed for the effective enrichment and isolation of microvesicles and exosomes in a simple manner. The unique design of the Exo-PAD, consisting of accordion-like multifolded layers with convergent sample areas, is integrated with the ion concentration polarization technique, thereby enabling fivefold enrichment of the microvesicles and exosomes on specific layers. In addition, the enriched microvesicles and exosomes are isolated by simply unfolding the Exo-PAD.

Presented is a protocol to fabricate a paper-based device for the effective enrichment and isolation of microvesicles and exosomes.

Microvesicles and exosomes are small membranous vesicles released to the extracellular environment and circulated throughout the body. Because they ...

Ultra-High-Speed Western Blot using Immunoreaction Enhancing Technology

A western blot (also known as an immunoblot) is a canonical method for biomedical research. It is commonly used to determine the relative size and abundance of specific proteins as well as post-translational protein modifications. This technique has a rich history and remains in widespread use due to its simplicity. However, the western blotting procedure famously takes hours, even days, to complete, with a critical bottleneck being the long incubation times that limit its throughput. These incubation steps are required due to the slow diffusion of antibodies from the bulk solution to the immobilized antigens on the membrane: the antibody concentration near the membrane is much lower than the bulk concentration. Here, we present an innovation that dramatically reduces these incubation intervals by improving antigen binding via cyclic draining and replenishing (CDR) of the antibody solution. We also utilized an immunoreaction enhancing technology to preserve the sensitivity of the assay. A combination of the CDR method with a commercial immunoreaction enhancing agent boosted the output signal and substantially reduced the antibody incubation time. The resulting ultra-high-speed western blot can be accomplished in 20 minutes without any loss in sensitivity. This method can be applied to western blots using both chemiluminescent and fluorescent detection. This simple protocol allows researchers to better explore the analysis of protein expression in many samples.

An ultra-high-speed western blotting technique is developed by improving the kinetics of antigen-antibody binding through cyclic draining and replenishing (CDR) technology in conjunction with an immunoreaction enhancing agent.

A western blot (also known as an immunoblot) is a canonical method for biomedical research. It is commonly used to determine the relative size and ...

Estimation of Plant Biomass Lignin Content using Thioglycolic Acid (TGA)

Lignin is a natural polymer that is the second most abundant polymer on Earth after cellulose. Lignin is mainly deposited in plant secondary cell walls and is an aromatic heteropolymer primarily composed of three monolignols with significant industrial importance. Lignin plays an important role in plant growth and development, protects&#160;from biotic and abiotic stresses, and in the quality of animal fodder, the wood, and industrial lignin products. Accurate estimation of lignin content is essential for both fundamental understanding of the lignin biosynthesis and industrial applications of biomass. The thioglycolic acid (TGA) method is a highly reliable method of estimating the total lignin content in the plant biomass. This method estimates the lignin content by forming thioethers with the benzyl alcohol groups of lignin, which are soluble in alkaline conditions and insoluble in acidic conditions. The total lignin content is estimated using a standard curve generated from commercial bamboo lignin.

Estimation of Plant Biomass Lignin Content using Thioglycolic Acid TGA

Here, we present a modified TGA method for estimation of lignin content in herbaceous plant biomass. This method estimates the lignin content by forming specific thioether bonds with lignin and presents an advantage over the Klason method, as it requires a relatively small sample for lignin content estimation.

Lignin is a natural polymer that is the second most abundant polymer on Earth after cellulose. Lignin is mainly deposited in plant secondary cell walls ...

Isolation of Soil Microorganisms Using iChip Technology

Samenvatting

Meer video's verkennen