Aby wyświetlić tę treść, wymagana jest subskrypcja JoVE. Zaloguj się lub rozpocznij bezpłatny okres próbny.
This video describes DNA isolation protocol from stool samples of colon tumor-bearing mice. The extracted DNA is amplified using PCR, and the product is further cleaned using a magnetic beads-based approach. This method can be used to determine the effect of environmental enrichment on colon microbiota and animal mortality.
All procedures involving animals have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.
1. Genomic DNA Isolation from Stool
NOTE: Utilize a commercial kit to isolate microbial DNA from stool following a stool pathogen detection protocol. Remove samples directly from the -80 ˚C freezer and store on dry ice while weighing.
2. DNA Concentration Determination and Sample Preparation for PCR
NOTE: Utilize a fluorometer and a commercially available dsDNA fluorescent assay to determine genomic DNA concentration in each sample (see Table of Materials). The fluorescent dye must bind double-stranded DNA specifically.
3. Design Primers to the 16S Desired V Regions
4. Amplicon PCR to Amplify the V Region(s) with Overhang Adapter Sequences Attached
5. PCR Cleanup Using Magnetic Beads
Amplicon PCR Primers | |
Forward | 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagagtttgatcMtggctcag-3' |
Reverse | 5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCGCGGCTGCTGGCAC -3' |
Locus specific sequences are shown in bold and the non-bold is the overhang adapter sequence. |
Table 1: Amplicon PCR Primers.
Amplicon PCR reaction set up | |
Volume | |
Microbial DNA (5ng/μl) | 2.5 μl |
Forward Primer (1 μM; from step 3.1) | 5.0 μl |
Reverse Primer (1 μM; from step 3.1) | 5.0 μl |
2X HotStart Ready Mix | 12.5 μl |
Total | 25.0 μl |
Table 2: Amplicon PCR Primers.
Amplicon PCR set up | |
95 °C for 3 minutes | |
25 Cycles of: | |
95 °C for 30 seconds | |
55 °C for 30 seconds | |
72 °C for 60 seconds | |
72 °C for 3 minutes | |
Hold at 4 °C |
Table 3: Amplicon PCR Program Set Up.
Figure 1: EE and NE housing conditions and stool homogenates (as described in the protocol)
Figure 2: 16S Microbiome Library Preparation. (A) Unpurified PCR amplicon products derived from stool genomic DNA.(B) Index...
Name | Company | Catalog Number | Comments |
1.5 mL Microfuge Tube- RNAse and DNAse free | Any supplier | ||
QIAamp DNA Stool MiniKit | Qiagen | 51504 | This kit supplies reagents for 50 DNA preparations. Stool Lysis Buffer=ASL; Guanidinium Chloride Lysis Buffer= AL; Wash Buffer 1 with Guanidinium Chloride= AW1; Wash Buffer 2= AW2; Elution Buffer with EDTA=AE |
Waterbath (capable of heating to 95) | Any supplier | For 94 degree incubation of stool samples to lyse cells. | |
Waterbath (capable of heating to 70 degrees) | Any supplier | For 70 degree incubation of stool samples | |
Ethanol (200 proof) | Sigma Aldrich | E7023 | |
Qubit dsDNA broad Range Assay Kit | ThermoFisher Scientific | Q32850 | |
EB Buffer or 10 mM Tris pH 8.5 | Qiagen | 19086 | |
Experiment specific primers | Any Supplier | ||
PCR grade water | Any supplier | ||
2X KAPA HiFi HotStart Ready Mix | Kapa Biosystems | KK2601 | For Amplicon Amplification (1.25 mL allows 100 rxns). |
Agarose for running diagnostic gels | Any supplier | ||
Proteinase K (600 mAU/ml) | Qiagen | 19131 | Equivalent to 20 mg/ml of proteinase K. Supplied with QiaAmp kit |
Agencourt AMPure XP Magnetic Beads | Beckman Coulter | A63880 | Magentic beads For PCR cleanup5 mL will clean 250 PCR reactions |
Magnetic stand | Life Technologies | AM10027 | |
Fluorometer: Qubit | ThermoFisher Scientific | Q33216 | |
Library Preparation Guide | Illumina | Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. https://support.illumina.com/ content/dam/illumina-support/ documents/documentation/ chemistry_documentation/16s/16s/metagenomic-library-prep guide-15044223-b.pdf. | |
MicroAmp Optical 96-well reaction plate | Applied Biosystems/ThermoFisher | ||
Adhesive clear plate seal | Applied Biosystems /ThermoFisher | 4360954 | Applied Biosystems/ThermoFisher Microamp adhesive film |
This article has been published
Video Coming Soon
Source: Fuller, A. K, et al. A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model. J. Vis. Exp. (2018).
Copyright © 2025 MyJoVE Corporation. Wszelkie prawa zastrzeżone