This work was supported by grants from the Mexican Council for Science and Technology (Conacyt, 207268 and 233395 to Michael Schnoor). KFCO is a recipient of a Conacyt stipend (396260) to obtain an MSc degree.

All animal experiments have been approved by the Institutional Animal Care and Use Committee of Cinvestav.
1. Preparation of DSS Drinking Water and the Induction of Colitis
<ol>
	<li>Prepare a 3.5% w/v dextran sulfate sodium (DSS) solution in autoclaved drinking water. DSS dissolves easily and it is not required to filter the final solution. 
	NOTE: 7 days of DSS treatment induces severe colitis. If inducing mild colitis, 3 - 4 days of treatment are recommended. As long as the DSS drinking water stays clear, it is not necessary to change the water. However, if it turns turbid, it must be replaced.</li>
	<li>Record the baseline weight of male mice. Ensure that they are 8 - 12 weeks of age and within a range of 21 - 25 g bodyweight. 
	NOTE: The appropriate DSS concentration must be optimized in each laboratory. Results can greatly vary, depending upon the housing conditions. Concentrations between 2.5 - 5% are usually reported to induce strong colitis in C57Bl/6J WT mice10. DSS from different companies and different lots should be tested, as results may also vary with different sources of DSS.</li>
	<li>Provide water ad libitum and replace it with fresh 3.5% DSS water if necessary.</li>
</ol>
2. Application of Nutritional Supplements by Gavage
<ol>
	<li>Prepare a &#34;feedable&#34; solution of the desired nutritional supplements in an appropriate solvent. For this study, we used a mixture containing 200 mg/kg L-arginine, 83 mg/kg vitamin C, 46 mg/kg vitamin E, 77 mg/kg eicosapentaenoic acid (EPA), and 115 mg/kg docosahexaenoic acid (DHA) in a 1:1 solution of water and safflower oil.</li>
	<li>Fill a 1-mL syringe connected to a gavage needle (15 G x 50 mm) with the nutritional supplement mixture. Wipe the outside of the gavage needle to remove any compound outside of the needle and to ensure proper dose application.</li>
	<li>Restrain the mouse by grasping the base of the tail with one hand and by firmly gripping a skin fold at the back of the neck with the thumb and forefinger of the other hand. Place the tail between the third finger and the base of the thumb of the same hand that holds the neck.</li>
	<li>While maintaining the mouse in an upright position, insert the needle into the left side of the animal&#39;s mouth and carefully follow the roof of the mouth to locate the esophagus. If no resistance is encountered, advance the needle towards the stomach. 
	NOTE: Verify that the animal is breathing properly before proceeding.</li>
	<li>Administer the mixture slowly, remove the tube by slowly pulling out the syringe, and release the mouse. Apply nutritional supplements once daily by gavage during the course of the colitis experiment.</li>
</ol>
3. Determination of the Disease Activity Index
NOTE: The disease activity index is the combination of the scores for weight loss, perianal bleeding, and stool consistency, which are obtained daily13.
<ol>
	<li>Measure the bodyweight daily and assign a score of 0 to 4 according to the weight loss percentage (0: 0%, 1: 1 - 5%, 2: 5 - 10%, 3: 10 - 20%, and 4: &#62; 20%). 
	NOTE: Bodyweight loss is determined by calculating the difference in percent between the basal weight before the induction of DSS-colitis and the actual weight.</li>
	<li>To determine the level of perianal bleeding, collect a fresh stool sample and use the provided applicators to apply a thin smear on a slide from a guaiac fecal occult blood test kit. Use a fresh applicator for each sample.
	<ol>
		<li>Close the cover on the front and open the window on the back of the slide. Apply two drops of the developer solution to the back at the sample location.</li>
		<li>Read the results after 30 s. Any trace of blue color is positive for occult blood. Assign a score of 0 to 4 (0: none, 0.5 - 2.5: positive guaiac fecal occult blood test (depending upon the signal strength), and 3 - 4: gross bleeding). 
		NOTE: If blood in the stool is visible, the guaiac fecal occult blood test does not have to be performed, and a score of 3, 3.5, or 4 is assigned, depending upon the amount of visible blood.</li>
	</ol>
	</li>
	<li>Determine stool consistency by observing a fresh stool sample. Assign a score of 0 to 4 (0: normal/solid, 0.5 - 2.5: pasty stool, and 3 - 4: diarrhea).</li>
</ol>
4. Determining Intestinal Epithelial Permeability In Vivo by Evans Blue Assay
<ol>
	<li>Anesthetize the animals by injecting them intraperitoneally with a mixture of ketamine (100 mg/kg of bodyweight) and xylazine (13 mg/kg of bodyweight) diluted in saline solution (0.9% NaCl), and assess the depth of anesthesia by monitoring the pinch withdrawal reflex.</li>
	<li>Place the anesthetized animals in a supine position and perform a laparotomy to expose the intestines.</li>
	<li>Locate the cecum and make a small incision in the proximal segment of the colon ascendens (ideally, immediately adjacent to the cecum).</li>
	<li>Insert a feeding needle (G22) and secure it with a ligature using a common silk thread. Carefully flush abundant PBS through the tube to rinse out all feces from the colon. Instill Evans blue solution (1.5% w/v in PBS) into the colon until it reaches the anus.</li>
	<li>Incubate the Evans blue for 15 min. Wash out the dye by flushing the tube with abundant PBS until the perianal washout is clear.</li>
	<li>Euthanize the animals by cervical dislocation.</li>
	<li>Excise the colon and rinse it again with abundant PBS. Rinse once with 1 mL of 6 mM N-acetylcysteine in PBS to eliminate any dye sticking to the colonic mucus.</li>
	<li>Cut the colon longitudinally and rinse it once more with PBS and 1 mL of 6 mM N-acetylcysteine.</li>
	<li>Record the weight and length. To extract the Evans blue dye, place the colon in 2 mL of N,N-dimethylformamide overnight at room temperature with gentle agitation. Measure the dye concentration spectrophotometrically at 610 nm.</li>
</ol>
5. Tissue Collection
<ol>
	<li>Anesthetize the animals by injecting them intraperitoneally with a mixture of ketamine (100 mg/kg of bodyweight) and xylazine (13 mg/kg of bodyweight) diluted in saline solution (0.9% NaCl), and assess the depth of anesthesia by monitoring the pinch withdrawal reflex.</li>
	<li>Euthanize the animals by cervical dislocation.</li>
	<li>Place the animals in a supine position and perform a laparotomy to expose the abdominal cavity.</li>
	<li>Using scissors, dissect the entire colon and record its length.</li>
	<li>Flush the colon carefully several times with chilled PBS to remove the feces. Record the tissue weight and prepare for the following experiments, as described in steps 5.6 - 5.8.</li>
	<li>For RNA isolation and myeloperoxidase (MPO) assays, cut off an appropriately-sized tissue sample (100 mg is usually sufficient), place it inside a tube, and snap-freeze it in liquid nitrogen. Store the tissues at -80 &#176;C for future use.</li>
	<li>For immunofluorescence staining and oxidative stress determination (see below), cut a small colon sample (0.5 - 1 cm) and submerse it in small aluminum cups filled with optimal cutting temperature (OCT) compound. Place the cups on dry ice and let them freeze slowly, in order to avoid bubble formation. Frozen tissue samples can be stored at -80 &#176;C for future use.</li>
	<li>For Swiss rolls14, open the colon longitudinally and carefully remove feces using forceps. Roll it up, with the mucosa facing inwards, using fine-tipped forceps or a thin, round wooden stick. Carefully place it inside an embedding cassette and continue with step 6.1. 
	NOTE: DSS induces damage in the colon. However, damage distribution varies from the proximal to the distal colon, with most damage usually seen in the distal colon and rectum. Thus, we recommend analyzing the histology either in the distal colon or in Swiss roles of the entire colon.</li>
</ol>
6. Analysis of Colon Histology by Hematoxylin-eosin Staining
<ol>
	<li>Tissue Preparation
	<ol>
		<li>For the histological analysis, submerge either the Swiss rolls or the small tissue pieces from certain colon regions of control and treated mice in 5 mL of 10% formaldehyde for 48 h at room temperature (RT) to achieve proper fixation. 
		NOTE: All further steps in step 6 are carried out at RT, unless otherwise indicated.</li>
		<li>Wash them with tap water for 18 h.</li>
		<li>Dehydrate them with 15 mL of 70% ethanol for 1 h, 96% for 1 h, and absolute ethanol for 1 h. Repeat each step with fresh alcohol before proceeding to the next concentration.</li>
		<li>Continue the dehydration in a mixture of 7.5 mL of absolute ethanol and 7.5 mL of absolute xylene for 1 h. Repeat once before passing the samples to 15 mL of absolute xylene for 1 h. Repeat this step once with fresh xylene.</li>
	</ol>
	</li>
	<li>Embedding Colon Tissue Samples in Paraffin
	<ol>
		<li>Immerse the samples in 50 mL of liquid paraffin for 17 h. Repeat this step once but for only 3 h.</li>
		<li>Immerse the samples in cubes (plastic, square mold, size: 22 x 22 x 22 mm) in 810 mL of liquid paraffin.</li>
		<li>Allow the paraffin with the colon tissue samples to solidify for 24 h at RT.</li>
	</ol>
	</li>
	<li>Cutting Tissue Cross-sections using a Microtome
	<ol>
		<li>Cut colon samples using a microtome, according to the manufacturer&#39;s instructions, at a thickness of 5 &#181;m.</li>
		<li>Collect the cuts in a water bath (1 L) containing 0.3% gelatin. This prevents the folding of tissue cross-sections. Recover the tissue sections and mount them on glass slides.</li>
	</ol>
	</li>
	<li>Hematoxylin and Eosin Staining of Tissue Cross-sections
	<ol>
		<li>Deparaffinize the samples for 18 h at 60 &#176;C in an incubator. For this purpose, use a glass slide rack with a handle.</li>
		<li>After deparaffinization, immerse the slides in 70 mL of absolute xylene for 5 min. Repeat this step once with fresh xylene.</li>
		<li>Transfer the samples into 70 mL of absolute alcohol for 1 min. Repeat this step once with fresh alcohol.</li>
		<li>Incubate the colon tissue samples in 70 mL of ethanol 96% for 1 min. Repeat this step once with fresh alcohol.</li>
		<li>Wash the samples in tap water twice for 2 s.</li>
		<li>Incubate the tissues in Harris hematoxylin for 7 min.</li>
		<li>Wash the samples in tap water twice for 2 s.</li>
		<li>Incubate the samples in acidic alcohol (70 mL of ethanol 70% and 700 &#181;L of 1 M hydrochloric acid) for 7 s.</li>
		<li>Wash the samples in tap water twice for 2 s.</li>
		<li>Incubate the tissue samples in 70 mL of lithium carbonate (1 g of lithium carbonate in 100 mL of distillated water) for 7 s.</li>
		<li>Wash the samples in tap water twice for 2 s.</li>
		<li>Incubate the samples in 70 mL of ethanol 80% for 1 min.</li>
		<li>Transfer the samples into 70 mL of Eosin-Y for 15 s.</li>
		<li>Incubate them in 70 mL of 96% ethanol for 1 min. Repeat this step once with fresh alcohol.</li>
		<li>Incubate the tissue samples in 70 mL of absolute ethanol (ethyl alcohol absolute anhydrous) for 1 min. Repeat this step once with fresh alcohol.</li>
		<li>Incubate the samples in 70 mL of a mixture of 35 mL of absolute alcohol and 35 mL of absolute xylene for 1 min.</li>
		<li>Transfer the samples into 70 mL of absolute xylene for 1 min. Repeat this step for 5 min in 70 mL of fresh absolute xylene.</li>
		<li>Add 80 &#181;L of synthetic resin to the colon tissue samples, cover them with coverslips, and let them dry for 24 h at RT. Finally, analyze the samples using bright-field microscopy8.</li>
	</ol>
	</li>
</ol>
7. Analyzing Junction Composition by Immunofluorescence
<ol>
	<li>Prepare the tissue as described in step 5.7 and cut 8 &#181;m-thick cross-sections using a cryostat.</li>
	<li>Fix and permeabilize colon cross-sections with 96% ethanol at -20 &#176;C for 20 min. 
	NOTE: All subsequent incubations should be carried out at RT, unless otherwise stated, in a humid dark box to prevent drying and fluorochrome fading.</li>
	<li>Air-dry samples, and then rinse them 3 times for 5 min each with 1x PBS</li>
	<li>Incubate the samples with blocking solution (PBS containing 0.01% Tween and 2% BSA) for 2 h.</li>
	<li>Remove the blocking solution and rinse it with PBS-0.01% Tween for 10 min.</li>
	<li>During this time, dilute the primary antibodies to the desired concentrations in PBS-0.01% Tween.</li>
	<li>Remove the washing solution, apply the antibody solution from the previous step, and incubate overnight at 4 &#176;C in a humidified box.</li>
	<li>Remove the antibody solution and wash 3 times with PBS-0.01% Tween for 5 min each and once with deionized water for 10 min, with very gentle agitation.</li>
	<li>While washing, centrifuge fluorochrome&#173;conjugated, species-specific secondary antibodies at 14,000 x g for 20 min at 4 &#176;C.</li>
	<li>Dilute the secondary antibodies without precipitates as indicated by the provider in PBS-0.01% Tween, apply them, and incubate for 1 h at RT.</li>
	<li>Repeat step 7.8 and remove the washing solution as completely as possible.</li>
	<li>Pipette 4 &#181;L of anti-fading agent over each sample on the slide.</li>
	<li>Cover the samples with a coverslip.</li>
	<li>Air dry for 1 h.</li>
	<li>Seal slide with nail polish. Slides can be stored at -20 &#176;C until further analysis.</li>
	<li>Analyze on a confocal laser microscope8.</li>
</ol>
8. Determination of Oxidative Stress by Oxidation of Ethidium
<ol>
	<li>After 7 days of DSS colitis, prepare tissue as described in step 5.7 and cut colon sections in a cryostat at a thickness of 5 &#181;m. Mount cross-sections onto glass slides treated with poly-L-lysine solution and incubate the samples with 5 &#181;M of dihydroethidium (DHE) in water at 37 &#176;C for 30 min in the dark.</li>
	<li>Wash the samples with PBS (pH 7.6) three times for 15 min each with gentle agitation at RT. Air dry the samples and add a drop of mounting medium to protect the fluorescence. Observe the fluorescence of oxidized ethidium on a laser-scanning confocal microscope (40X magnification, 568 nm wavelength).</li>
</ol>
9. Analysis of Leukocyte Recruitment by MPO Assay
<ol>
	<li>After 7 days of DSS colitis, collect colon tissue and homogenize the samples (200 - 400 mg) with 1 mL of hexadecyltrimethylammonium (HTAB) buffer (0.5% HTAB in 50 mM phosphate buffer, pH 6.0) using a homogenizer on ice.</li>
	<li>Rinse the tip of the homogenizer twice with 1 mL of HTAB buffer to include all tissue in the lysate and sonicate it five times at 40% amplitude for 10 s each. Freeze-thaw in liquid nitrogen three times.</li>
	<li>Centrifuge at 14,000 x g for 15 min and collect the supernatant. Prepare 2,2&#39;-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) solution by mixing ABTS, 5 mL of sodium citrate (1 M in water), 0.1 mL of hydrogen peroxide, and 45 mL of bi-distilled water.</li>
	<li>Mix 0.1 mL of each supernatant with 0.1 mL of ABTS solution in a 96-well flat-bottomed plate. After 10 min, measure the absorbance at 460 nm using a spectrophotometer.</li>
</ol>
10. Evaluating the Expression of Pro-inflammatory Cytokines by PCR
<ol>
	<li>Tissue Homogenization
	<ol>
		<li>Homogenize 50 to 100 mg of colon tissue samples in 1 mL of an acid guanidinium thiocyanate-phenol-chloroform mixture using a power homogenizer.</li>
		<li>Incubate it at room temperature for 15 min.</li>
	</ol>
	</li>
	<li>Phase Separation
	<ol>
		<li>Add 0.2 mL of chloroform and shake vigorously for 30 s.</li>
		<li>Incubate at 4 &#176;C for 30 min.</li>
		<li>Centrifuge at 12,000 x g for 60 min at 4 &#176;C.</li>
		<li>Transfer the upper aqueous phase into a fresh tube (~500 &#181;L).</li>
	</ol>
	</li>
	<li>RNA Precipitation and Resuspension
	<ol>
		<li>Add 0.5 mL of isopropyl alcohol and incubate the samples at 4 &#176;C for 60 min.</li>
		<li>Centrifuge at 12,000 x g for 30 min at 4 &#176;C.</li>
		<li>Remove the supernatant completely.</li>
		<li>Add 1 mL of ethanol 75% and vortex.</li>
		<li>Centrifuge at 12,000 x g for 30 min at 4 &#176;C.</li>
		<li>Remove the supernatant.</li>
		<li>Allow the remaining ethanol to air-dry for 3-5 min. 
		NOTE: It is important not to let the RNA pellet dry completely, as this will greatly decrease its solubility.</li>
		<li>Re-dissolve the pellet in 0.3 mL of diethylpyrocarbonate (DEPC)-treated water. Immediately transcribe the RNA samples into cDNA (more stable, see step 10.5) or store at -80 &#176;C.</li>
	</ol>
	</li>
	<li>RNA Quantification
	<ol>
		<li>Dilute 1 &#181;L of RNA with 99 &#181;L of DEPC-treated water.</li>
		<li>Read the OD at 260 nm and 280 nm using a UV/VIS spectrophotometer to determine sample concentration and purity.</li>
	</ol>
	</li>
	<li>cDNA Synthesis
	<ol>
		<li>Mix RNA samples (1-5 &#181;g) with 1 &#181;L of Oligo(dT)12-18 (0.5 &#181;g/&#181;L) and DEPC-treated water (total volume of 12 &#181;L) in RNase-free sterile tubes.</li>
		<li>Incubate at 70 &#176;C for 10 min.</li>
		<li>Add 2 &#181;L of 10x PCR Buffer, 1 &#181;L of 50 mM MgCl2, 1 &#181;L of 10 mM dNTP mix, and 2 &#181;L of 0.1 M dithiothreitol (DTT).</li>
		<li>Incubate at 4 &#176;C for 5 min.</li>
		<li>Add 1 &#181;L of reverse transcriptase and incubate at 42 &#176;C for 5 min.</li>
		<li>Incubate at 70 &#176;C for 15 min.</li>
		<li>Incubate at 4 &#176;C for 15 min. cDNA can be stored at -20 &#176;C until further use.</li>
	</ol>
	</li>
	<li>PCR
	<ol>
		<li>Mix 2.5 &#181;L of 10x PCR Buffer, 1.5 &#181;L of 25 mM MgCl2, 0.5 &#181;L of 10 mM dNTP mix, 0.25 &#181;L of Taq DNA polymerase, 0.25 &#181;L of each primer (10 &#181;M) and cDNA (100 ng), and sterile water to a total volume of 25 &#181;L.</li>
		<li>Run the samples on a 96-well thermal cycler. To prevent amplification of genomic DNA, forward and reverse primers should be located in different exons: IL1&#946;-FW: GCAACTGTTCCTGAACTCAACT and IL1&#946;-RE: TCTTTTGGGGTCCGTCAACT; IL6-FW: CCTTCCTACCCCAATTTCCAA and IL6-RE: AGATGAATTGGATGGTCTTGGTC; KC-FW: TGTCAGTGCCTGCAGACCAT and KC-RE: CCTGAGGGCAACACCTTCA; and Actin-FW: TATCCACCTTCCAGCAGATGT and Actin-RE: AGCTCAGTAACAGTCCGCCTA. Use the following PCR conditions: 95 &#176;C for 5 min followed by 30 cycles at 95 &#176;C for 15 s, 58 &#176;C for 30 s, and 72 &#176;C for 30 s, plus a final extension for 10 min at 72 &#176;C.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Souza, H. S., Fiocchi, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunopathogenesis+of+IBD:+current+state+of+the+art.">Immunopathogenesis of IBD: current state of the art.</a> Nat Rev Gastroenterol Hepatol. 13, 13-27 (2016).</li><li>Xavier, R. J., Podolsky, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unravelling+the+pathogenesis+of+inflammatory+bowel+disease.">Unravelling the pathogenesis of inflammatory bowel disease.</a> Nature. 448, 427-434 (2007).</li><li>Neuman, M. G., Nanau, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+bowel+disease:+role+of+diet,+microbiota,+life+style.">Inflammatory bowel disease: role of diet, microbiota, life style.</a> Transl Res. 160, 29-44 (2011).</li><li>Lowenberg, M., D'Haens, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-Generation+Therapeutics+for+IBD.">Next-Generation Therapeutics for IBD.</a> Current Gastroenterol Rep. 17, 21 (2015).</li><li>Bernstein, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Does+everyone+with+inflammatory+bowel+disease+need+to+be+treated+with+combination+therapy.">Does everyone with inflammatory bowel disease need to be treated with combination therapy.</a> Curr Opin Gastroenterol. , (2016).</li><li>Nanau, R. M., Neuman, M. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nutritional+and+probiotic+supplementation+in+colitis+models.">Nutritional and probiotic supplementation in colitis models.</a> Dig Dis Sci. 57, 2786-2810 (2012).</li><li>Yamamoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nutrition+and+diet+in+inflammatory+bowel+disease.">Nutrition and diet in inflammatory bowel disease.</a> Curr Opin Gastroenterol. 29, 216-221 (2013).</li><li>Vargas Robles, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+Colitis+Is+Attenuated+by+Cardioprotective+Diet+Supplementation+That+Reduces+Oxidative+Stress,+Inflammation,+and+Mucosal+Damage.">Experimental Colitis Is Attenuated by Cardioprotective Diet Supplementation That Reduces Oxidative Stress, Inflammation, and Mucosal Damage.</a> Ox Med Cell Longev. , 8473242 (2016).</li><li>Vargas-Robles, H., Rios, A., Arellano-Mendoza, M., Escalante, B. A., Schnoor, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antioxidative+diet+supplementation+reverses+high-fat+diet-induced+increases+of+cardiovascular+risk+factors+in+mice.">Antioxidative diet supplementation reverses high-fat diet-induced increases of cardiovascular risk factors in mice.</a> Ox Med Cell Longev. 2015, 467471 (2015).</li><li>Perse, M., Cerar, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dextran+sodium+sulphate+colitis+mouse+model:+traps+and+tricks.">Dextran sodium sulphate colitis mouse model: traps and tricks.</a> J Biomed Biotechnol. 2012, 718617 (2012).</li><li>Chassaing, B., Aitken, J. D., Malleshappa, M., Vijay-Kumar, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dextran+sulfate+sodium+(DSS)-induced+colitis+in+mice.">Dextran sulfate sodium (DSS)-induced colitis in mice.</a> Curr. Protoc. Immunol. 104, 25 (2014).</li><li>Laroui, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dextran+sodium+sulfate+(DSS)+induces+colitis+in+mice+by+forming+nano-lipocomplexes+with+medium-chain-length+fatty+acids+in+the+colon.">Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon.</a> PLoS One. 7, 32084 (2009).</li><li>Mennigen, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probiotic+mixture+VSL#3+protects+the+epithelial+barrier+by+maintaining+tight+junction+protein+expression+and+preventing+apoptosis+in+a+murine+model+of+colitis.">Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis.</a> Am J Physiol Gastrointest Liver Physiol. 296, 1140-1149 (2009).</li><li>Park, C. M., Reid, P. E., Walker, D. C., MacPherson, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple,+practical+'swiss+roll'+method+of+preparing+tissues+for+paraffin+or+methacrylate+embedding.">A simple, practical 'swiss roll' method of preparing tissues for paraffin or methacrylate embedding.</a> J Microsc. 145, 115-120 (1987).</li><li>Shen, W., Gaskins, H. R., McIntosh, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+dietary+fat+on+intestinal+microbes,+inflammation,+barrier+function+and+metabolic+outcomes.">Influence of dietary fat on intestinal microbes, inflammation, barrier function and metabolic outcomes.</a> J Nutr Biochem. , (2013).</li><li>Bruewer, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interferon-gamma+induces+internalization+of+epithelial+tight+junction+proteins+via+a+macropinocytosis-like+process.">Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process.</a> FASEB J. 19, 923-933 (2005).</li><li>Fournier, B. M., Parkos, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+neutrophils+during+intestinal+inflammation.">The role of neutrophils during intestinal inflammation.</a> Muc Immunol. 5, 354-366 (2012).</li><li>Yan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+and+spatial+analysis+of+clinical+and+molecular+parameters+in+dextran+sodium+sulfate+induced+colitis.">Temporal and spatial analysis of clinical and molecular parameters in dextran sodium sulfate induced colitis.</a> PLoS One. 4, 6073 (2009).</li><li>Maxwell, J. R., Viney, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overview+of+mouse+models+of+inflammatory+bowel+disease+and+their+use+in+drug+discovery.">Overview of mouse models of inflammatory bowel disease and their use in drug discovery.</a> Curr Prot Pharmacol, S.J. Enna. , (2009).</li><li>Ostanin, D. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell+transfer+model+of+chronic+colitis:+concepts,+considerations,+and+tricks+of+the+trade.">T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade.</a> Am J Physiol Gastrointest Liver Physiol. 296, 135-146 (2009).</li><li>Randhawa, P. K., Singh, K., Singh, N., Jaggi, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+on+chemical-induced+inflammatory+bowel+disease+models+in+rodents.">A review on chemical-induced inflammatory bowel disease models in rodents.</a> Kor J Physiol Pharmacol. 18, 279-288 (2014).</li><li>Whittem, C. G., Williams, A. D., Williams, C. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+Colitis+modeling+using+Dextran+Sulfate+Sodium+(DSS).">Murine Colitis modeling using Dextran Sulfate Sodium (DSS).</a> JoVE. , (2010).</li><li>Wirtz, S., Neufert, C., Weigmann, B., Neurath, M. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemically+induced+mouse+models+of+intestinal+inflammation.">Chemically induced mouse models of intestinal inflammation.</a> Nat Prot. 2, 541-546 (2007).</li><li>Naydenov, N. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonmuscle+Myosin+IIA+Regulates+Intestinal+Epithelial+Barrier+in+vivo+and+Plays+a+Protective+Role+During+Experimental+Colitis.">Nonmuscle Myosin IIA Regulates Intestinal Epithelial Barrier in vivo and Plays a Protective Role During Experimental Colitis.</a> Sci Rep. 6, 24161 (2016).</li><li>Sumagin, R., Robin, A. Z., Nusrat, A., Parkos, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transmigrated+neutrophils+in+the+intestinal+lumen+engage+ICAM-1+to+regulate+the+epithelial+barrier+and+neutrophil+recruitment.">Transmigrated neutrophils in the intestinal lumen engage ICAM-1 to regulate the epithelial barrier and neutrophil recruitment.</a> Muc Immunol. 7, 905-915 (2014).</li><li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo.">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li><li>Viennois, E., Chen, F., Laroui, H., Baker, M. T., Merlin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dextran+sodium+sulfate+inhibits+the+activities+of+both+polymerase+and+reverse+transcriptase:+lithium+chloride+purification,+a+rapid+and+efficient+technique+to+purify+RNA.">Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA.</a> BMC Res Notes. 6, 360 (2013).</li></ol>

The authors have nothing to disclose.

In order to use nutritional supplements in clinical studies, the benefits and safety of such supplements must be carefully evaluated in vivo in animal studies. In the case of colitis, several appropriate animal models that resemble the clinical signs of IBD have been established, including chemical models using DSS, TNBS, or acetic acid; knock-out (KO) models such as IL10-KO; and immune-cell-mediated colitis using adoptive T-cell transfer19-21. The DSS model of colitis is a rapid and reliable method o...

Colitis is an inflammatory condition of the colon that can cause diarrhea and abdominal pain. Colitis can be acute, in response to infection or to stress, or it can develop as a chronic disease, such as in ulcerative colitis (UC), which belongs to the group of inflammatory bowel diseases (IBD). Although the clinical signs of UC have been well described, the pathogenesis is still poorly understood1. It is accepted among experts that UC is a multifactorial disease, with genetic mutations and aberrant immune responses playing a major role2. However, environmental factors, such as style of living and nutrition, also contribute to disease development and progression3.
Unfortunately, IBD is not curable, but there are many treatment options that aim to alleviate clinical symptoms. Current treatments include anti-inflammatory drugs, such as sulfasalazine and corticosteroids; immunosuppressants, such as azathioprine; monoclonal antibodies that capture pro-inflammatory cytokines, such as tumor necrosis factor-&#945; (TNF-&#945;), or block adhesion molecules, such as integrins, to reduce excessive leukocyte recruitment; and inhibitors that target kinases that trigger pro-inflammatory pathways, such as Janus kinase (JAK)4. Not all patients respond to all treatments, so therapeutic strategies must be individualized5. Furthermore, most of these therapeutic drugs interfere with the metabolism and immune responses, often causing severe side effects. For this reason, alternative treatment options have been investigated.
Alternative treatments include probiotics and nutritional supplements, which have been applied in animal models and clinical trials with varying levels of success6,7. We recently found that the application of different single nutritional supplements, such as anti-oxidative vitamins or &#969;3-poly-unsaturated fatty acids (PUFAs), is inferior to the application of a combination of such supplements in alleviating colitis and cardiovascular disease symptoms8,9. These studies were performed in mice, so clinical studies must be performed in humans to determine whether these findings will also be applicable to humans. Before clinical studies are initiated, the effectiveness and safety of new treatment options must be evaluated in animal models.
For IBD, the dextran sulfate sodium (DSS) model has been widely used to study the mechanisms of disease development and the beneficial effects of drugs and nutritional supplements6,10. In most studies, only an acute disease over a time period of seven days is induced; nevertheless, the clinical signs observed in these animals closely resemble those observed in IBD patients (i.e., bloody diarrhea, weight loss, epithelial dysfunction, and immune cell infiltration)10. DSS induces erosions in the mucosa, resulting in barrier dysfunction and in increased intestinal epithelial permeability11. The exact mechanism remains unknown. However, a study suggests that DSS interacts with medium chain-length fatty acids to form nano-lipocomplexes that are able to enter epithelial cells and to induce inflammatory signaling pathways12. In this article, we describe in detail how colitis is induced and analyzed in mice, how nutritional supplements are applied by gavage to ensure a constant dosage in each animal, and how the effects of such supplements on various colitis symptoms are examined.

<table border="0" cellpadding="0" cellspacing="0" width="953">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">0.3% of gelatin&#160;</td>
			<td style="width:184px;">Bioxon</td>
			<td style="width:139px;">158</td>
			<td style="width:191px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">10% formaldehyde</td>
			<td style="width:184px;">J.T. Baker</td>
			<td style="width:139px;">2106-03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">96-well plate with flat bottom</td>
			<td style="width:184px;">Corning</td>
			<td style="width:139px;">3368</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Absolute ethanol&#160;</td>
			<td style="width:184px;">J.T. Baker</td>
			<td style="width:139px;">9000-03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Absolute xylene</td>
			<td style="width:184px;">J.T. Baker</td>
			<td style="width:139px;">9490-03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">ABTS</td>
			<td style="width:184px;">Sigma Aldrich</td>
			<td style="width:139px;">H5882</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Bovine Serum Albumin</td>
			<td style="width:184px;">Sigma-Aldrich</td>
			<td style="width:139px;">9048-46-8</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">ColoScreen</td>
			<td style="width:184px;">Helena Laboratories</td>
			<td style="width:139px;">5072</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Corabion (Kindly provided by Merck, Naucalpan, Mexico)</td>
			<td style="width:184px;">Merck</td>
			<td style="width:139px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Dextran Sulfate Sodium Salt</td>
			<td style="width:184px;">Affymetrix</td>
			<td style="width:139px;">9011-18-1</td>
			<td style="width:191px;">(M.W. 40,000-50,000)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Dihydroethidium</td>
			<td style="width:184px;">Life Technology</td>
			<td style="width:139px;">D11347</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Eosin-Y&#160;</td>
			<td style="width:184px;">J.T. Baker</td>
			<td style="width:139px;">L087-03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Evans blue</td>
			<td style="width:184px;">Sigma-Aldrich</td>
			<td style="width:139px;">314-13-6</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Feeding&#160; needle</td>
			<td style="width:184px;">Cadence Science Inc.</td>
			<td style="width:139px;">9921</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Glass slide rack with handle</td>
			<td style="width:184px;">Electron Microscopy</td>
			<td style="width:139px;">70312-16</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Glass Slides</td>
			<td style="width:184px;">Corning</td>
			<td style="width:139px;">2947</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Harris hematoxylin&#160;</td>
			<td style="width:184px;">Sigma-Aldrich</td>
			<td style="width:139px;">H3136</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Hexadecyltrimethyammonium (HTAB)</td>
			<td style="width:184px;">Sigma Aldrich</td>
			<td style="width:139px;">H6269</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Histosette (Embedding cassette)</td>
			<td style="width:184px;">Simport</td>
			<td style="width:139px;">M498.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Hydrochloric acid 1 M</td>
			<td style="width:184px;">J.T. Baker</td>
			<td style="width:139px;">9535-62</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Hydrogen peroxide</td>
			<td style="width:184px;">Sigma Aldrich</td>
			<td style="width:139px;">H3410</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Ketamine</td>
			<td style="width:184px;">PiSA Agropecuaria</td>
			<td style="width:139px;">Q-7833-028</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Liquid paraffin&#160;</td>
			<td style="width:184px;">Paraplast</td>
			<td style="width:139px;">39501-006</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Lithium carbonate&#160;</td>
			<td style="width:184px;">Sigma-Aldrich</td>
			<td style="width:139px;">2362</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">N,N-dimethylformamide</td>
			<td style="width:184px;">J.T. Baker</td>
			<td style="width:139px;">68-12-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">N-acetylcysteine</td>
			<td style="width:184px;">Sigma-Aldrich</td>
			<td style="width:139px;">A9165</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Plastic cubes</td>
			<td style="width:184px;">Electron Microscopy</td>
			<td style="width:139px;">70181</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Poly-L-Lysine Solution</td>
			<td style="width:184px;">Sigma-Aldrich</td>
			<td style="width:139px;">25988-63-0</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Prism 5 statistical software</td>
			<td style="width:184px;">GraphPad Software</td>
			<td style="width:139px;">Prism 5</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Saline Solution 0.9% NaCl</td>
			<td style="width:184px;">CS PiSA</td>
			<td style="width:139px;">Q-7833-009</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Sodium citrate</td>
			<td style="width:184px;">Sigma-Aldrich</td>
			<td style="width:139px;">W302600</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Synthetic resin&#160;</td>
			<td style="width:184px;">Poly Mont</td>
			<td style="width:139px;">7987</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Taq DNA polymerase</td>
			<td style="width:184px;">Invitrogen</td>
			<td style="width:139px;">11615-010</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Tissue-tek. O.C.T Compound</td>
			<td style="width:184px;">Sakura Finetek</td>
			<td style="width:139px;">4583</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Tuberculine Syringe</td>
			<td style="width:184px;">BD Plastipak</td>
			<td style="width:139px;">305945</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Tween 20</td>
			<td style="width:184px;">Sigma-Aldrich</td>
			<td style="width:139px;">9005-64-5</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">VECTASHIELD Antifade Mounting Medium with DAPI</td>
			<td style="width:184px;">Vector Laboratories</td>
			<td style="width:139px;">H-1200</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Xylazine</td>
			<td style="width:184px;">PiSA Agropecuaria</td>
			<td style="width:139px;">Q-7833-099</td>
			<td></td>
		</tr>
	</tbody>
</table>

analyzing beneficial effects of nutritional supplements on intestinal epithelial barrier functions during experimental colitis

Inflammatory bowel diseases (IBD), including Crohn&#39;s disease and ulcerative colitis, are chronic relapsing disorders of the intestines. They cause severe problems, such as abdominal cramping, bloody diarrhea, and weight loss, in affected individuals. Unfortunately, there is no cure yet, and treatments only aim to alleviate symptoms. Current treatments include anti-inflammatory and immunosuppressive drugs that may cause severe side effects. This warrants the search for alternative treatment options, such as nutritional supplements, that do not cause side effects. Before their application in clinical studies, such compounds must be rigorously tested for effectiveness and security in animal models. A reliable experimental model is the dextran sulfate sodium (DSS) colitis model in mice, which reproduces many of the clinical signs of ulcerative colitis in humans. We recently applied this model to test the beneficial effects of a nutritional supplement containing vitamins C and E, L-arginine, and &#969;3-polyunsaturated fatty acids (PUFA). We analyzed various disease parameters and found that this supplement was able to ameliorate edema formation, tissue damage, leukocyte infiltration, oxidative stress, and the production of pro-inflammatory cytokines, leading to an overall improvement in the disease activity index. In this article, we explain in detail the correct application of nutritional supplements using the DSS colitis model in C57Bl/6 mice, as well as how disease parameters such as histology, oxidative stress, and inflammation are assessed. Analyzing the beneficial effects of different diet supplements may then eventually open new avenues for the development of alternative treatment strategies that alleviate IBD symptoms and/or that prolong the phases of remission without causing severe side effects.

Diet Supplements Can Protect from DSS Colitis
Anti-inflammatory and anti-oxidative diet supplements, such as vitamin C, vitamin E, the nitric oxide (NO)-source L-arginine, and &#969;3-polyunsaturated fatty acids (&#969;3-PUFAs), have been used with varying success in animal models to alleviate signs of inflammatory diseases3,6,15. Malnutrition, oxidative stress, and the production of pro-inflammatory cytokines can trigge...

Watch this Scientific Journal Video about Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis at JoVE.com

Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis

Current treatments of inflammatory bowel diseases (IBD) aim at alleviating disease symptoms but may cause severe side effects. Thus, alternative strategies are being investigated in animal colitis models. Here, we explain how the beneficial effects of diet supplements on clinical IBD signs are analyzed in such a colitis model.

Inflammatory bowel diseases (IBD), including Crohn&#39;s disease and ulcerative colitis, are chronic relapsing disorders of the intestines. They cause ...

analyzing-beneficial-effects-nutritional-supplements-on-intestinal

Research

Education

JoVE Core

JoVE Journal

Pharmacology

Medicine

Unit 1

Drugs for Chronic Bowel Disorders

SCIENTISTS IN ACTION

12.1K Views.  Center for Research and Advanced Studies of the National Polytechnic Institute. Current treatments of inflammatory bowel diseases (IBD) aim at alleviating disease symptoms but may cause severe side effects. Thus, alternative strategies are being investigated in animal colitis models. Here, we explain how the beneficial effects of diet supplements on clinical IBD signs are analyzed in such a colitis model.

Video: Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis

DNBS/TNBS Colitis Models: Providing Insights Into Inflammatory Bowel Disease and Effects of Dietary Fat

Inflammatory Bowel Diseases (IBD), including Crohn&#39;s Disease and Ulcerative Colitis, have long been associated with a genetic basis, and more recently host immune responses to microbial and environmental agents. Dinitrobenzene sulfonic acid (DNBS)-induced colitis allows one to study the pathogenesis of IBD associated environmental triggers such as stress and diet, the effects of potential therapies, and the mechanisms underlying intestinal inflammation and mucosal injury. In this paper, we investigated the effects of dietary n-3 and n-6 fatty acids on the colonic mucosal inflammatory response to DNBS-induced colitis in rats. All rats were fed identical diets with the exception of different types of fatty acids [safflower oil (SO), canola oil (CO), or fish oil (FO)] for three&#160;weeks prior to exposure to intrarectal DNBS. Control rats given intrarectal ethanol continued gaining weight over the 5 day study, whereas, DNBS-treated rats fed lipid diets all lost weight with FO and CO fed rats demonstrating significant weight loss by 48&#160;hr and rats fed SO by 72&#160;hr. Weight gain resumed after 72&#160;hr post DNBS, and by 5 days post DNBS, the FO group had a higher body weight than SO or CO groups. Colonic sections collected 5&#160;days post DNBS-treatment showed focal ulceration, crypt destruction, goblet cell depletion, and mucosal infiltration of both acute and chronic inflammatory cells that differed in severity among diet groups. The SO fed group showed the most severe damage followed by the CO, and FO fed groups that showed the mildest degree of tissue injury. Similarly, colonic myeloperoxidase (MPO) activity, a marker of neutrophil activity was significantly higher in SO followed by CO fed rats, with FO fed rats having significantly lower MPO activity. These results demonstrate the use of DNBS-induced colitis, as outlined in this protocol, to determine the impact of diet in the pathogenesis of IBD.

DNBS/TNBS induced colitis offers an alternative and inexpensive method to study the pathobiology of inflammatory bowel disease. The protocol discussed in this paper outlines the successful application of DNBS to induce colitis in mice and rats and allows one to thoroughly study host-mediated intestinal responses.

Inflammatory Bowel Diseases (IBD), including Crohn&#39;s Disease and Ulcerative Colitis, have long been associated with a genetic basis, and more recently ...

Long-Term Catheterization of the Intestinal Lymph Trunk and Collection of Lymph in Neonatal Pigs

Catheterization of the intestinal lymph trunk in neonatal pigs is a technique allowing for the long-term collection of large quantities of intestinal (central) efferent lymph. Importantly, the collection of central lymph from the intestine enables researchers to study both the mechanisms and lipid constitutes associated with lipid metabolism, intestinal inflammation and cancer metastasis, as well as cells involved in immune function and immunosurveillance. A ventral mid-line surgical approach permits excellent surgical exposure to the cranial abdomen and relatively easy access to the intestinal lymph trunk vessel that lies near the pancreas and the right ventral segment of the portal vein underneath the visceral aspect of the right liver lobe. The vessel is meticulously dissected and released from the surrounding fascia and then dilated with sutures allowing for insertion and subsequent securing of the catheter into the vessel. The catheter is exteriorized and approximately 1 L/24 hr of lymph is collected over a 7 day period. While this technique enables the collection of large quantities of central lymph over an extended period of time, the success depends on careful surgical dissection, tissue handling and close attention to proper surgical technique. This is particularly important with surgeries in young animals as the lymph vessels can easily tear, potentially leading to surgical and experimental failure. The video demonstrates an excellent surgical technique for the collection of intestinal lymph.

We present a surgical procedure to catheterize the intestinal lymph trunk in neonatal pigs to collect large quantities of lipid metabolism components from efferent lymph.

Catheterization of the intestinal lymph trunk in neonatal pigs is a technique allowing for the long-term collection of large quantities of intestinal ...

A Step by Step Protocol for Subretinal Surgery in Rabbits

Age related macular degeneration (AMD), retinitis pigmentosa, and other RPE related diseases are the most common causes for irreversible loss of vision in adults in industrially developed countries. RPE transplantation appears to be a promising therapy, as it may replace dysfunctional RPE, restore its function, and thereby vision.
Here we describe a method for transplanting a cultured RPE monolayer on a scaffold into the subretinal space (SRS) of rabbits. After vitrectomy xenotransplants were delivered into the SRS using a custom made shooter consisting of a 20-gauge metallic nozzle with a polytetrafluoroethylene (PTFE) coated plunger. The current technique evolved in over 150 rabbit surgeries over 6 years. Post-operative follow-up can be obtained using non-invasive and repetitive in vivo imaging such as spectral domain optical coherence tomography (SD-OCT) followed by perfusion-fixed histology.
The method has well-defined steps for easy learning and high success rate. Rabbits are considered a large eye animal model useful in preclinical studies for clinical translation. In this context rabbits are a cost-efficient and perhaps convenient alternative to other large eye animal models.

Retinal pigment epithelium (RPE) replacement strategies and gene-based therapy are considered for several retinal degenerative conditions. For clinical translation, large eye animal models are required to study surgical techniques applicable in patients. Here we present a rabbit model for subretinal surgery geared towards RPE transplantation, which is versatile and cost-efficient.

Age related macular degeneration (AMD), retinitis pigmentosa, and other RPE related diseases are the most common causes for irreversible loss of vision in ...

Effects of Allogeneic Platelet-Rich Plasma (PRP) on the Healing Process of Sectioned Achilles Tendons of Rats: A Methodological Description

This article describes the experimental procedures used to observe if PRP can positively affect tendon healing. There are 4 main steps to follow: induce a lesion in the Achilles tendon; prepare PRP and inject it (or the saline solution); remove the tendon; and perform biomechanical, molecular, and histological evaluations. At each step, all the procedures and methods are described in detail, so they can be reproduced easily.
Achilles tendons have been surgically sectioned (removal of a 5-mm long section). Afterwards, PRP or saline solution was injected to study whether PRP has a positive effect on the healing of the tendon. Three groups of 40 animals (a total of 120 rats were used in this study) were subdivided into 2 subgroups: PRP injection group and a saline injection control group. Rats were sacrificed at increasing time points (Group A: 5 days; Group B: 15 days; Group C: 30 days) and tendons were removed. 90 tendons underwent biomechanical testing before performing transcriptomic analysis and the 30 remaining tendons were submitted to histological analysis.

Effects of Allogeneic Platelet-Rich Plasma PRP on the Healing Process of Sectioned Achilles Tendons of Rats: A Methodological Description

This protocol describes the evaluation process of healing tendons in rats that have been injected with allogeneic platelet rich plasma (PRP) or saline solution after removing part of the Achilles tendon. The progress of tendon healing is evaluated at several time points using different types of analyses.

This article describes the experimental procedures used to observe if PRP can positively affect tendon healing. There are 4 main steps to follow: induce a ...

Ultrasonography in Experimental Reproductive Investigations on Rats

With the development of assisted reproductive technology and the ethical limitations of research on humans, rat animal models have been widely used in reproductive medicine. In the past, the study of reproductive system development in rodents has been based on one-time histological examination of excised tissues. Recently, with the development of high-resolution transabdominal ultrasound, high-quality sonography can now be performed to evaluate the reproductive organs of rats, allowing a new method for studying the reproductive system. Images were obtained using a high-resolution ultrasonographic system. Gynecological ultrasonography was performed on 28 eight-week-old non-pregnant rats and 5 pregnant Sprague-Dawley rats. We describe how to recognize organs of the reproductive system and associated structures in typical views during different phases of the estrus cycle. Color flow Doppler was used to measure uterine artery blood flow and evaluate uterine blood flow pattern changes during different stages of pregnancy. We have demonstrated that ultrasound exploration is a useful method for evaluating changes in internal reproductive organs. Its use raises the possibility of conducting additional experiments, including medical or surgical procedures, and provides the ability to monitor sonographic changes to internal organs without sacrificing animals.

This manuscript describes the utility of ultrasound performed on female rats to design experimental models for reproductive and gynecological investigation. A step-by-step explanation of how to perform ultrasonographic evaluation is shown.

With the development of assisted reproductive technology and the ethical limitations of research on humans, rat animal models have been widely used in ...

Improved Method for the Establishment of an In Vitro Blood-Brain Barrier Model Based on Porcine Brain Endothelial Cells

The aim of this protocol presents an optimized procedure for the purification and cultivation of pBECs and to establish in vitro blood-brain barrier (BBB) models based on pBECs in mono-culture (MC), MC with astrocyte-conditioned medium (ACM), and non-contact co-culture (NCC) with astrocytes of porcine or rat origin. pBECs were isolated and cultured from fragments of capillaries from the brain cortices of domestic pigs 5-6 months old. These fragments were purified by careful removal of meninges, isolation and homogenization of grey matter, filtration, enzymatic digestion, and centrifugation. To further eliminate contaminating cells, the capillary fragments were cultured with puromycin-containing medium. When 60-95% confluent, pBECs growing from the capillary fragments were passaged to permeable membrane filter inserts and established in the models. To increase barrier tightness and BBB characteristic phenotype of pBECs, the cells were treated with the following differentiation factors: membrane permeant 8-CPT-cAMP (here abbreviated cAMP), hydrocortisone, and a phosphodiesterase inhibitor, RO-20-1724 (RO). The procedure was carried out over a period of 9-11 days, and when establishing the NCC model, the astrocytes were cultured 2-8 weeks in advance. Adherence to the described procedures in the protocol has allowed the establishment of endothelial layers with highly restricted paracellular permeability, with the NCC model showing an average transendothelial electrical resistance (TEER) of 1249 &#177; 80 &#937; cm2, and paracellular permeability (Papp) for Lucifer Yellow of 0.90 10-6 &#177; 0.13 10-6 cm sec-1 (mean &#177; SEM, n=55). Further evaluation of this pBEC phenotype showed good expression of the tight junctional proteins claudin 5, ZO-1, occludin and adherens junction protein p120 catenin. The model presented can be used for a range of studies of the BBB in health and disease and, with the highly restrictive paracellular permeability, this model is suitable for studies of transport and intracellular trafficking.

Improved Method for the Establishment of an In Vitro Blood-Brain Barrier Model Based on Porcine Brain Endothelial Cells

The aim of the protocol is to present an optimized procedure for the establishment of an in vitro blood-brain barrier (BBB) model based on primary porcine brain endothelial cells (pBECs). The model shows high reproducibility, high tightness, and is suitable for studies of transport and intracellular trafficking in drug discovery.

The aim of this protocol presents an optimized procedure for the purification and cultivation of pBECs and to establish in vitro blood-brain barrier (BBB) ...

Microscopy Based Methods for the Assessment of Epithelial Cell Migration During In Vitro Wound Healing

Cell migration is a mandatory aspect for wound healing. Creating artificial wounds on research animal models often results in costly and complicated experimental procedures, while potentially lacking in precision. In vitro culture of epithelial cell lines provides a suitable platform for researching the cell migratory behavior in wound healing and the impact of treatments on these cells. The physiology of epithelial cells is often studied in non-confluent conditions; however, this approach may not resemble natural wound healing conditions. Disrupting the epithelium integrity by mechanical means generates a realistic model, but may impede the application of molecular techniques. Consequently, microscopy based techniques are optimal for studying epithelial cell migration in vitro. Here we detail two specific methods, the artificial wound scratch assay and the artificial migration front assay, that can obtain quantitative and qualitative data, respectively, on the migratory performance of epithelial cells.

Microscopy Based Methods for the Assessment of Epithelial Cell Migration During  In Vitro Wound Healing

This manuscript describes how incision-like lesions made on cultured epithelial cell monolayers conveniently model wound healing in vitro, allowing for imaging by confocal or laser scanning microscopy, and which can provide high-quality quantitative and qualitative data for studying both cell behavior and the mechanisms involved in migration.

Cell migration is a mandatory aspect for wound healing. Creating artificial wounds on research animal models often results in costly and complicated ...

Measuring the Effects of Bacteria and Chemicals on the Intestinal Permeability of Caenorhabditis elegans

In living organisms, intestinal hyperpermeability is a serious symptom that leads to many inflammatory bowel diseases (IBDs). Caenorhabditis elegans is a nonmammalian animal model that is widely used as an assay system due to its short lifespan, transparency, cost-effectiveness, and lack of animal ethics issues. In this study, a method was developed to investigate the effects of different bacteria and 3,3'-diindolylmethane (DIM) on the intestinal permeability of C. elegans with a high-throughput image analysis system. The worms were infected with different gut bacteria or cotreated with DIM for 48 h and fed with fluorescein isothiocyanate (FITC)-dextran overnight. Then, the intestinal permeability was examined by comparing the fluorescence images and the fluorescence intensity inside the worm bodies. This method may also have the potential to identify probiotic and pathogenic intestinal bacteria that affect intestinal permeability in the animal model and is effective for examining the effects of harmful or health-promoting chemicals on intestinal permeability and intestinal health. However, this protocol also has some considerable limitations at the genetic level, especially for determining which genes are altered to control illness, because this method is mostly used for phenotypic determination. In addition, this method is limited to determining exactly which pathogenic substrates cause inflammation or increase the permeability of the worms' intestines during infection. Therefore, further in-depth studies, including investigation of the molecular genetic mechanism using mutant bacteria and nematodes as well as chemical component analysis of bacteria, are required to fully evaluate the function of bacteria and chemicals in determining intestinal permeability.

Measuring the Effects of Bacteria and Chemicals on the Intestinal Permeability of Caenorhabditis elegans

This protocol describes how to measure intestinal permeability of Caenorhabditis elegans. This method is helpful for basic biological research on intestinal health related to the interaction between intestinal bacteria and their host and for screening to identify probiotic and chemical agents to cure leaky gut syndrome and inflammatory bowel diseases.

In living organisms, intestinal hyperpermeability is a serious symptom that leads to many inflammatory bowel diseases (IBDs). Caenorhabditis elegans is a ...

Investigating Intestinal Barrier Breakdown in Living Organoids

Organoids and three-dimensional (3D) cell cultures allow the investigation of complex biological mechanisms and regulations in vitro, which previously was not possible in classical cell culture monolayers. Moreover, monolayer cell cultures are good in vitro model systems but do not represent the complex cellular differentiation processes and functions that rely on 3D structure. This has so far only been possible in animal experiments, which are laborious, time consuming, and hard to assess by optical techniques. Here we describe an assay to quantitatively determine the barrier integrity over time in living small intestinal mouse organoids. To validate our model, we applied interferon gamma (IFN-&#947;) as a positive control for barrier destruction and organoids derived from IFN-&#947; receptor 2 knock out mice as a negative control. The assay allowed us to determine the impact of IFN-&#947; on the intestinal barrier integrity and the IFN-&#947; induced degradation of the tight junction proteins claudin-2, -7, and -15. This assay could also be used to investigate the impact of chemical compounds, proteins, toxins, bacteria, or patient-derived probes on the intestinal barrier integrity.

Here we describe a technique to quantify the barrier integrity of small intestinal organoids. The fact that the method is based on living organoids enables the sequential investigation of different barrier integrity modulating substances or combinations thereof in a time-resolved manner.

Organoids and three-dimensional (3D) cell cultures allow the investigation of complex biological mechanisms and regulations in vitro, which previously was ...

A Murine Model of Fetal Exposure to Maternal Inflammation to Study the Effects of Acute Chorioamnionitis on Newborn Intestinal Development

Chorioamnionitis is a common precipitant of preterm birth and is associated with many of the morbidities of prematurity, including necrotizing enterocolitis (NEC). However, a mechanistic link between these two conditions remains yet to be discovered. We have adopted a murine model of chorioamnionitis involving lipopolysaccharide (LPS)-induced fetal exposure to maternal inflammation (FEMI). This model of FEMI induces a sterile maternal, placental, and fetal inflammatory cascade, which is also present in many cases of clinical chorioamnionitis. Although models exist that utilize live bacteria and more accurately mimic the pathophysiology of an ascending infection resulting in chorioamnionitis, these methods may cause indirect effects on development of the immature intestinal tract and the associated developing microbiome. Using this protocol, we have demonstrated that LPS-induced FEMI results in a dose-dependent increase in pregnancy loss and preterm birth, as well as disruption of normal intestinal development in offspring. Further, we have demonstrated that FEMI significantly increases intestinal injury and serum cytokines in offspring, while simultaneously decreasing goblet and Paneth cells, both of which provide a first line of innate immunity against intestinal inflammation. Although a similar model of LPS-induced FEMI has been used to model the association between chorioamnionitis and subsequent abnormalities of the central nervous system, to our knowledge, this protocol is the first to attempt to elucidate a mechanistic link between chorioamnionitis and later perturbations in intestinal development as a potential link between chorioamnionitis and NEC.

We developed a model of chorioamnionitis to simulate fetal exposure to maternal inflammation (FEMI) without complications of live organisms to examine the effects of FEMI on development of the offspring&#8217;s intestinal tract. This allows for study of mechanistic causes for development of intestinal injury following chorioamnionitis.