The authors are grateful to Lisa Hansen and Kirsten Vestergaard for excellent technical assistance, and P. Scherer, N. Joffin, and C. Crewe for critical reading of the manuscript. The authors thank the UTSW Flow Cytometry Core for excellent guidance and assistance in developing the protocols described here. R.K.G. is supported by NIH NIDDK R01 DK104789, NIDDK RC2 DK118620, and NIDDK R01 DK119163. J.P. is sponsored by a pre-doctoral award from Innovation Fund Denmark.

All animal protocols and procedures have been approved by the University of Texas Southwestern Medical Center Institutional Animal Use and Care Committee.
1. Isolation of stromal vascular fraction (SVF) from gonadal white adipose tissue
<ol>
	<li>Dissect the gonadal white adipose tissue from 6-8-week-old mice and place fat pads in 1x PBS solution.</li>
	<li>Combine up to 4 fat depots (2-4 depots from 1-2 mice recommended) and mince the tissue in a 10 mL beaker containing 200 &#181;L of digestion buffer (1x HBSS, 1.5% BSA and 1 mg/mL collagenase D).</li>
	<li>Transfer the minced tissue to a 50 mL centrifuge tube containing 10 mL digestion buffer.</li>
	<li>Incubate mixture at 37 &#176;C in a water bath for 1 h while shaking.</li>
	<li>Filter the digested tissue through a 100 &#181;m cell strainer to remove undigested tissue.</li>
	<li>Dilute filtered sample to 30 mL with PBS containing 2% FBS, and centrifuge at 600 x g for 5 min at 4 &#176;C. Aspirate the supernatant, which contains mature adipocytes.</li>
	<li>Proceed immediately to preferred cell isolation method.</li>
</ol>
2. Isolation of APCs and FIPs using FACS
<ol>
	<li>Dissolve the pellet in 1 mL of 1x RBC lysis buffer by shaking the tube gently.</li>
	<li>Incubate at RT for 1-2 min.</li>
	<li>Add 10 mL of 2% FBS/PBS and pass through a 40 &#181;m cell strainer into a clean 50 mL centrifuge tube.</li>
	<li>Centrifuge at 600 x g for 5 min at 4 &#176;C.</li>
	<li>Aspirate media and resuspend the pellet in 400-800 &#181;L of 2% FBS/PBS containing Fc block (1:200).</li>
	<li>Incubate at 4 &#176;C for 10 min.</li>
	<li>Transfer 400 &#181;L-800 &#181;L of cell suspensions containing &#8804;106 cells per mL to 1.5 mL tubes and add antibodies. Antibody concentrations are listed in the Table of Materials section.
	<ol>
		<li>Prepare separate control tubes for 1) unstained cells, 2) single color controls, and 3) FMO (fluorescence minus one) controls.</li>
		<li>Stain the samples with PDGFR&#946;, CD45, CD31, CD9, LY6C antibodies.</li>
	</ol>
	</li>
	<li>Incubate at 4 &#176;C for 15 min protected from light.</li>
	<li>Centrifuge at 600 x g for 5 min at 4 &#176;C.</li>
	<li>Aspirate media and resuspend cells in 400 &#181;L of 2% FBS/PBS.</li>
	<li>Centrifuge at 600 x g for 5 min at 4 &#176;C.</li>
	<li>Aspirate media and resuspend cells in 400-800 &#181;L of 2% FBS/PBS. Then pass through 40 &#181;m filter caps into 5 mL polystyrene round-bottom tubes for FACS.</li>
	<li>Follow the following steps for gating.
	<ol>
		<li>Use unstained and single-color controls for compensation.</li>
		<li>Use FMO controls to set experimental gates.</li>
		<li>Use the gating strategy shown in Figure 1 to obtain APCs and FIPs. Gate APCs as CD45- CD31- PDGFR&#946;+ LY6C- CD9- and FIPs as CD45- CD31- PDGFR&#946;+ LY6C+ cells.</li>
	</ol>
	</li>
	<li>Collect sorted cells in tubes containing 500 &#181;L of 100% serum and maintain the cells on ice.</li>
	<li>Centrifuge cells at 600 x g for 5 min at 4 &#176;C. Add 2% FBS/PBS to wash the cells by centrifuging again at 600 x g for 5 min at 4 &#176;C. Discard the supernatant use the pelleted cells.</li>
	<li>Resuspend the pelleted cells in the appropriate volume of gonadal APC culture media (for cell culture) or appropriate buffer for subsequent analysis.</li>
</ol>
3. Immunomagnetic separation of adipogenic and non-adipogenic fractions
<ol>
	<li>Isolate SVF from gonadal white adipose tissue following steps 1.1-1.7.</li>
	<li>Aspirate the supernatant and resuspend the SVF pellet in 10 mL of 1x commercially available MS Buffer.</li>
	<li>Filter the cell suspension through a 40 &#181;m cell strainer.</li>
	<li>Centrifuge at 600 x g for 5 min at 4 &#176;C.</li>
	<li>Aspirate the supernatant and resuspend pelleted cells in 100 &#181;L of 1x MS Buffer.</li>
	<li>Perform CD31+ and CD45+ cell depletion as discussed below (Figure 2A, Step 1). This is done to remove endothelial and hematopoietic lineage cells.
	<ol>
		<li>Count cells using a cell counter and adjust the concentration to &#8804; 1 x 108 cells/mL.</li>
		<li>Add the biotin conjugated CD31 and CD45 antibodies to the cell suspension, each at a concentration of &#8804; 0.25 &#181;g per 106 cells and incubate on ice for 15 min.</li>
		<li>Wash cells by adding 4 mL of 1x MS Buffer.</li>
		<li>Centrifuge at 600 x g for 5 min at 4 &#176;C.</li>
		<li>Aspirate the supernatant and resuspend the pellet with 100 &#181;L of 1x MS buffer.</li>
		<li>Add 10 &#181;L of streptavidin nanobeads and incubate cells on ice for 15 min.</li>
		<li>Wash cells by adding 4 mL of 1x MS buffer.</li>
		<li>Centrifuge at 600 x g for 5 min at 4 &#176;C, then aspirate the supernatant.</li>
		<li>Resuspend cells in 2.5 mL of 1x MS buffer and transfer to a 5 mL polypropylene tube.</li>
		<li>Place the tube in the magnet rack for 5 min.</li>
		<li>Collect unlabeled cells by pouring the cell suspension into a clean 15 mL centrifuge tube. 
		NOTE: Avoid shaking or blotting off hanging droplets as this leads to contamination from unwanted cell fraction.</li>
		<li>Remove the tube from magnet and repeat steps 3.6.9. to 3.6.11. two more times for a total of 3 washes.</li>
	</ol>
	</li>
	<li>Separation of adipogenic and non-adipogenic fractions (Figure 2A, Step 2)
	<ol>
		<li>Continue working with unlabeled fraction (i.e., CD45- CD31- fraction).</li>
		<li>Centrifuge the 15 mL tube containing unlabeled cells at 600 x g for 5 min at 4 &#176;C.</li>
		<li>Aspirate the supernatant and resuspend the pellet in 100 &#181;L of 1x MS buffer.</li>
		<li>Add biotin conjugated LY6C and CD9 antibodies, respectively, at a concentration of &#8804; 0.25 &#181;g per 106 cells and incubate on ice for 15 min.</li>
		<li>Follow steps 3.6.3. to 3.6.12. to complete the second separation.</li>
		<li>Collect unbound fractions. Unlabeled cells (LY6C- CD9-) represents adipogenic fraction containing APCs (Figure 2A, Step 3).</li>
		<li>Remove tube from the magnet, resuspend and elute bound cells in 1x MS buffer. Eluates or labeled fraction (LY6C+ CD9+), represents non-adipogenic fraction containing FIPs (Figure 2A, Step 3).</li>
		<li>Centrifuge labeled and unlabeled fractions at 600 x g for 5 min to pellet cells at 4 &#176;C.</li>
	</ol>
	</li>
	<li>Proceed immediately to cell culture (step 6) or use undifferentiated precursors for preferred analyses (step 4 and/or step 5).</li>
</ol>
4. Assess purity of adipogenic and non-adipogenic fractions by flow cytometry
<ol>
	<li>Resuspend bead-isolated cell fractions in 200-400 &#181;L of 2% FBS/PBS containing Fc block (1:200).</li>
	<li>Incubate at 4 &#176;C for 10 min.</li>
	<li>Transfer the cell suspension to 1.5 mL tubes and add antibodies. Antibody concentrations are listed in the Table of Materials.
	<ol>
		<li>Prepare separate control tubes for 1) unstained cells, 2) single color controls, and 3) FMO controls.</li>
		<li>To the samples, add CD45, CD31, CD9, and LY6C antibodies.</li>
	</ol>
	</li>
	<li>Incubate at 4 &#176;C for 15 min protected from light.</li>
	<li>Centrifuge at 600 x g for 5 minutes at 4 &#176;C.</li>
	<li>Aspirate supernatant and resuspend cells in 400 &#181;L of 2% FBS/PBS.</li>
	<li>Centrifuge the suspension at 600 x g for 5 min at 4 &#176;C.</li>
	<li>Aspirate the supernatant and resuspend cells in 400-800 &#181;L of 2% FBS/PBS. Filter through 40 &#181;m filter caps into 5 mL polystyrene round-bottom tubes for analysis by flow cytometry.</li>
	<li>Flow cytometry analysis to assess purity
	<ol>
		<li>Use unstained and single-color controls for compensation.</li>
		<li>Use FMO controls to set experimental gates.</li>
		<li>Use the gating strategy for live and single cells as shown in Figure 2B.</li>
		<li>Perform the gating as shown in Figure 2B for CD45, CD31, LY6C, and CD9.</li>
		<li>Use flow cytometry software to evaluate the frequencies of CD45- CD31- LY6C- CD9- cells (APCs) and CD45- CD31- LY6C+ cells (FIPs) within isolated fractions.</li>
	</ol>
	</li>
</ol>
5. Gene expression analysis using quantitative PCR to assess purity of FIPs and APCs
<ol>
	<li>Extract mRNA from magnetically or FACS isolated cells using commercially available extraction kit (see Table of Materials) following the manufacturer&#8217;s instructions.</li>
	<li>Use 1 &#181;g of RNA to synthetize cDNA using a cDNA Reverse Transcriptase kit (see Table of Materials) by following the manufacturer&#8217;s instructions.</li>
	<li>Determine relative mRNA levels of APC and FIPs-selective genes (Table 1) by quantitative PCR using SYBR green PCR master mix.
	<ol>
		<li>Set up the sample reaction for PCR as follows: 5 &#181;L of 2x SYBR green dye, 1 &#181;L of cDNA (~50 ng/ &#181;L), 0.5 &#181;L of each forward and reverse primer (10 &#181;M) and 3 &#181;L of water.</li>
		<li>Use the following standard PCR conditions for the quantitative PCR run: hold stage: 50 &#176;C for 2 min, 95&#176;C for 10 min; PCR stage (40 cycles): 95 &#176;C for 15 s, 60 &#176;C for 1 min.</li>
	</ol>
	</li>
	<li>Normalize values to house-keeping gene (Rps18) levels by calculating &#916;&#916;-Ct.</li>
	<li>To evaluate statistical significance, perform unpaired Student&#8217;s t-test.</li>
</ol>
6. Cell culture and differentiation
<ol>
	<li>Centrifuge magnetically- or FACS- isolated cells at 600 x g for 5 min at 4 &#176;C.</li>
	<li>Resuspend the pellet in 500 &#181;L of gonadal APC culture media and plate 40K cells/well from each fraction in a 48 well culture plate.</li>
	<li>Replace media every 1-2 days. APCs will begin to undergo differentiation into adipocytes as they approach confluence. FIPs maintained in the same media are resistant to undergoing adipogenesis.</li>
</ol>

<ol>
	<li>Ouchi, N., Parker, J. L., Lugus, J. J., Walsh, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adipokines+in+inflammation+and+metabolic+disease.">Adipokines in inflammation and metabolic disease.</a> Nature Reviews Immunology. 11 (2), 85-97 (2011).</li><li>Rosen, E. D., Spiegelman, B. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+we+talk+about+when+we+talk+about+fat.">What we talk about when we talk about fat.</a> Cell. 156 (1-2), 20-44 (2014).</li><li>Funcke, J. B., Scherer, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beyond+adiponectin+and+leptin:+adipose+tissue-derived+mediators+of+inter-organ+communication.">Beyond adiponectin and leptin: adipose tissue-derived mediators of inter-organ communication.</a> Journal of Lipid Research. 60 (10), 1648-1684 (2019).</li><li>Eto, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+structure+and+cellular+components+of+aspirated+and+excised+adipose+tissue.">Characterization of structure and cellular components of aspirated and excised adipose tissue.</a> Plastic and Reconstructive Surgery. 124 (4), 1087-1097 (2009).</li><li>Hirsch, J., Batchelor, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adipose+tissue+cellularity+in+human+obesity.">Adipose tissue cellularity in human obesity.</a> Clinics in Endocrinology and Metabolism. 5 (2), 299-311 (1976).</li><li>Ghaben, A. L., Scherer, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adipogenesis+and+metabolic+health.">Adipogenesis and metabolic health.</a> Nature Reviews Molecular Cell Biology. 20 (4), 242-258 (2019).</li><li>Hepler, C., Gupta, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expanding+problem+of+adipose+depot+remodeling+and+postnatal+adipocyte+progenitor+recruitment.">The expanding problem of adipose depot remodeling and postnatal adipocyte progenitor recruitment.</a> Molecular Cell Endocrinology. 445, 95-108 (2017).</li><li>Jo, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypertrophy+and/or+Hyperplasia:+Dynamics+of+Adipose+Tissue+Growth.">Hypertrophy and/or Hyperplasia: Dynamics of Adipose Tissue Growth.</a> PLoS Computational Biology. 5 (3), 1000324 (2009).</li><li>Sun, K., Kusminski, C. M., Scherer, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adipose+tissue+remodeling+and+obesity.">Adipose tissue remodeling and obesity.</a> Journal of Clinical Investigation. 121 (6), 2094-2101 (2011).</li><li>Kloting, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin-sensitive+obesity.">Insulin-sensitive obesity.</a> American Journal of Physiology-Endocrinology and Metabolism. 299 (3), 506-515 (2010).</li><li>Vishvanath, L., Gupta, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contribution+of+adipogenesis+to+healthy+adipose+tissue+expansion+in+obesity.">Contribution of adipogenesis to healthy adipose tissue expansion in obesity.</a> Journal of Clinical Investigation. 129 (10), 4022-4031 (2019).</li><li>Choe, S. S., Huh, J. Y., Hwang, I. J., Kim, J. I., Kim, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adipose+Tissue+Remodeling:+Its+Role+in+Energy+Metabolism+and+Metabolic+Disorders.">Adipose Tissue Remodeling: Its Role in Energy Metabolism and Metabolic Disorders.</a> Frontiers in Endocrinology (Lausanne). 7, 30 (2016).</li><li>Hepler, C., Vishvanath, L., Gupta, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sorting+out+adipocyte+precursors+and+their+role+in+physiology+and+disease.">Sorting out adipocyte precursors and their role in physiology and disease.</a> Genes and Development. 31 (2), 127-140 (2017).</li><li>Burl, R. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deconstructing+Adipogenesis+Induced+by+beta3-Adrenergic+Receptor+Activation+with+Single-Cell+Expression+Profiling.">Deconstructing Adipogenesis Induced by beta3-Adrenergic Receptor Activation with Single-Cell Expression Profiling.</a> Cell Metabolism. 28 (2), 300-309 (2018).</li><li>Hepler, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+functionally+distinct+fibro-inflammatory+and+adipogenic+stromal+subpopulations+in+visceral+adipose+tissue+of+adult+mice.">Identification of functionally distinct fibro-inflammatory and adipogenic stromal subpopulations in visceral adipose tissue of adult mice.</a> Elife. 7, 39636 (2018).</li><li>Merrick, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+mesenchymal+progenitor+cell+hierarchy+in+adipose+tissue.">Identification of a mesenchymal progenitor cell hierarchy in adipose tissue.</a> Science. 364 (6438), 2501 (2019).</li><li>Schwalie, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stromal+cell+population+that+inhibits+adipogenesis+in+mammalian+fat+depots.">A stromal cell population that inhibits adipogenesis in mammalian fat depots.</a> Nature. 559 (7712), 103-108 (2018).</li><li>Bagchi, D. P., MacDougald, O. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+Dissection+of+Diverse+Mouse+Adipose+Depots.">Identification and Dissection of Diverse Mouse Adipose Depots.</a> Journal of Visualized Experiments. (149), e59499 (2019).</li><li>Jeffery, E., Church, C. D., Holtrup, B., Colman, L., Rodeheffer, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+depot-specific+activation+of+adipocyte+precursor+cells+at+the+onset+of+obesity.">Rapid depot-specific activation of adipocyte precursor cells at the onset of obesity.</a> Nature Cell Biology. 17 (4), 376-385 (2015).</li><li>Kim, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+white+adipose+hyperplastic+potential+is+associated+with+enhanced+susceptibility+to+insulin+resistance.">Loss of white adipose hyperplastic potential is associated with enhanced susceptibility to insulin resistance.</a> Cell Metabolism. 20 (6), 1049-1058 (2014).</li><li>Vishvanath, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pdgfrbeta++Mural+Preadipocytes+Contribute+to+Adipocyte+Hyperplasia+Induced+by+High-Fat-Diet+Feeding+and+Prolonged+Cold+Exposure+in+Adult+Mice.">Pdgfrbeta+ Mural Preadipocytes Contribute to Adipocyte Hyperplasia Induced by High-Fat-Diet Feeding and Prolonged Cold Exposure in Adult Mice.</a> Cell Metabolism. 23 (2), 350-359 (2016).</li><li>Wang, Q. A., Tao, C., Gupta, R. K., Scherer, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+adipogenesis+during+white+adipose+tissue+development,+expansion+and+regeneration.">Tracking adipogenesis during white adipose tissue development, expansion and regeneration.</a> Nature Medicine. 19 (10), 1338-1344 (2013).</li><li>Gao, Z., Daquinag, A. C., Su, F., Snyder, B., Kolonin, M. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PDGFRalpha/PDGFRbeta+signaling+balance+modulates+progenitor+cell+differentiation+into+white+and+beige+adipocytes.">PDGFRalpha/PDGFRbeta signaling balance modulates progenitor cell differentiation into white and beige adipocytes.</a> Development. 145 (1), 155861 (2018).</li><li>Rodeheffer, M. S., Birsoy, K., Friedman, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+white+adipocyte+progenitor+cells+in+vivo.">Identification of white adipocyte progenitor cells in vivo.</a> Cell. 135 (2), 240-249 (2008).</li><li>Church, C. D., Berry, R., Rodeheffer, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+study+of+adipocyte+precursors.">Isolation and study of adipocyte precursors.</a> Methods Enzymol. 537, 31-46 (2014).</li><li>Buffolo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+Paracrine+Signaling+Mechanism+Linking+CD34(high)+Progenitors+to+the+Regulation+of+Visceral+Fat+Expansion+and+Remodeling.">Identification of a Paracrine Signaling Mechanism Linking CD34(high) Progenitors to the Regulation of Visceral Fat Expansion and Remodeling.</a> Cell Reports. 29 (2), 270-282 (2019).</li><li>Shao, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+adipocyte+differentiation+from+Pdgfrbeta(+)+preadipocytes+protects+against+pathologic+visceral+adipose+expansion+in+obesity.">De novo adipocyte differentiation from Pdgfrbeta(+) preadipocytes protects against pathologic visceral adipose expansion in obesity.</a> Nature Communications. 9 (1), 890 (2018).</li><li>Lee, P. Y., Wang, J. X., Parisini, E., Dascher, C. C., Nigrovic, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ly6+family+proteins+in+neutrophil+biology.">Ly6 family proteins in neutrophil biology.</a> Journal of Leukocyte Biology. 94 (4), 585-594 (2013).</li><li>Vijay, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+analysis+of+human+adipose+tissue+identifies+depot+and+disease+specific+cell+types.">Single-cell analysis of human adipose tissue identifies depot and disease specific cell types.</a> Nature Metabolism. 2 (1), 97-109 (2020).</li></ol>

T.A.P. is an employee and shareholder in Novo Nordisk A/S

The C57BL/6 strain of mice is the most used mouse strain in studies of diet-induced obesity. C57BL/6 mice rapidly gain weight when placed on a high-fat diet (HFD) and develop some of the prominent features of metabolic syndrome associated with obesity (e.g., insulin resistance and hyperlipidemia). Notably, WAT expansion occurring in association with high-fat diet (HFD) feeding occurs in a depot-specific manner19,20,21,22,23. Expansion of the subcutaneous inguinal WAT depot (iWAT) occurs almost exclusively through adipocyte hypertrophy, whereas the expansion of the gonadal WAT (gWAT) occurs through both adipocyte hypertrophy and hyperplasia. The gWAT depot of obese mice is also a prominent site of metabolic inflammation. Thus, the gWAT depot of diet-induced obese mice represents a model to study multiple features of adipose tissue remodeling linked to obesity.
Over the past several years, the most commonly used strategies to prospectively isolate APCs from adipose depots selects cells on the basis of CD29, SCA-1, and CD34 expression (CD29+ CD34+ SCA-1+ CD31- CD45-)24,25. This approach remains useful for the selection of APCs from iWAT and other WAT depots; however, in the gonadal WAT depot and other intra-abdominal depots, CD34 and SCA-1 expression are enriched in anti-adipogenic cells rather than APCs15,26. Buffolo et al. provide direct evidence of this, demonstrating that gWAT stromal cells selected on the basis of high expression of CD34 (CD34high) are anti-adipogenic26. Therefore, the selection of cells based on the expression of CD34 and SCA-1 from this WAT depot yields a heterogeneous population that likely includes FIPs. The presence of such anti-adipogenic cells may explain the reported lack of adipogenic potential that isolated gonadal CD34+ SCA-1+ cells possess in vitro when compared to corresponding cells from the inguinal WAT depot25. The approach we describe here allows for the enrichment of intra-abdominal WAT APCs that are highly adipogenic in vitro. Moreover, APCs transplanted into lipodystrophic mice can form an ectopic fat pad15. Our strategy allows for the isolation of APCs from multiple intra-abdominal depots of both male and female mice, including gWAT, mesenteric WAT, and retroperitoneal WAT15. Multiple genetic lineage tracing studies demonstrate that adipocytes emerging in gWAT in association with HFD feeding originate from perivascular stromal cells expressing Pdgfrb (PDGFR&#946; protein)21,23. Importantly, the health of gWAT in obese mice is dependent on the adipogenic capacity of PDGFR&#946;+ cells27. These data support the notion that the gWAT APCs isolated by the approach described here are of physiological relevance.
Gonadal WAT APCs isolated by this approach differentiate rapidly into adipocytes upon reaching confluence in two-dimensional culture, or even prior to confluence. Unlike most established preadipocyte cell lines, these primary APCs do not require the addition of commonly used adipogenic factors (i.e., dexamethasone, IMBX, or PPAR&#947; agonist). Readers should note that the commercially used ITS supplement used in this protocol does contain high levels of insulin. In addition, adipocyte differentiation can vary significantly with different sources/lots of FBS. Testing multiple lots of FBS is sometimes necessary to find serum that supports differentiation. Moreover, the varying levels of endotoxin in FBS may also influence the baseline pro-inflammatory phenotypes of APCs and FIPs.
FACS has been the commonly used technique for isolating APCs from the adipose SVF. This approach allows for the precise separation of cell populations and removal of debris and dead cells. Nevertheless, the duration and physical stress imposed on the cells may impact gene expression and/or cellular function. Moreover, multi-channel cell sorters may not be readily available to all investigators. We provide details here on how APCs can be also isolated by magnetic bead separation. From our experience, the yield of both populations through magnetic bead separation is lower than observed when using FACS. Moreover, as shown in Figure 2 above, this approach sacrifices some degree of purity. Nevertheless, magnetic bead separation yields cultures of APCs with high adipogenic potential. The purity of APC isolated through this approach can likely increase with repeated washing steps; however, this may compromise yield. A critical step in the protocol is the binding of biotinylated antibodies to target antigens on the surface of desired or undesired cells. If incubation time is insufficient or antibody concentrations are too low, target cells will remain unlabeled. Investigators may need to optimize antibody concentration for their isolations. The same principle applies to the incubation with streptavidin nanospheres. Failure to form streptavidin-biotin complexes will affect the efficiency of the isolation. Researchers should also pay additional attention to each washing step and resist the temptation to blot off any hanging droplets when collecting or discarding eluates from the magnet; blotting can result in cross-contamination from undesired cell populations. It should be of note that when performing a positive selection, the nanobeads are not removed from the cell fraction and may be detectable under a microscope. In our experience, the presence of these beads does not interfere with downstream functional assays. Investigators should note that under this magnetic-bead separation strategy, the non-APC fraction remains heterogeneous. This population contains mostly FIPs (&#62;75% LY6C+); however, other cell types are likely present (e.g., CD9+ mesothelial cells). As such, the magnetic bead separation protocol presented here is perhaps most useful when the aim is to simply isolate APCs, and FACS machines are not readily available or cost prohibitive.
Investigators should also note important limitations to the overall sorting strategies described here. First and foremost, the protocols we describe here are currently only applicable to intra-abdominal WAT depots of mice. The subcutaneous iWAT depot in mice contains PDGFR&#946;+ adipose progenitors; however, LY6C expression does not readily discriminate between functionally distinct progenitor subpopulations within that depot27. Readers are referred to the work of Merrick et al. and Church et al. for protocols to isolate APCs from that depot16,25. We have not yet tested whether this sorting strategy can isolate functional APCs from rats. Moreover, it should be noted that there is no apparent ortholog for LY6C in humans28. As such, human APCs cannot be sorted based on these markers. Recent single-cell sequencing studies of human adipose stromal cells may lead to new strategies to isolate distinct progenitor populations from human tissues29. Second, there are limitations to the use of the cells in vitro. FIPs are highly proliferative and can be propagated for several passages and maintain their functional properties; however, APCs substantially lose their adipogenic potential with passage. This provides a technical challenge for those aiming to perform biochemical assays that require high cell numbers or manipulate gene expression (e.g., CRISPR/Cas9 or RNA interference). In our view, our approach is well-suited when the objective is to compare the frequency and properties of native APCs and/or FIPs derived directly from intra-abdominal WAT depots of animal models (e.g., APC frequency in control and experimental animals; comparison of male and female progenitors; effect of diet, age, etc., on progenitor frequency and properties). The ability to study these distinct cell populations in isolation should greatly aid in attempts to dissect molecular mechanisms that regulate adipogenesis and adipose tissue remodeling in mice.

White adipose tissue (WAT) represents the principal site for energy storage in mammals. Within this tissue, adipocytes, or &#8220;fat cells,&#8221; store excess calories in the form of triglyceride, packaged into large unilocular lipid droplets. Moreover, adipocytes secrete a multitude of factors that regulate various aspects of energy homeostasis1,2,3. Adipocytes constitute the bulk of WAT volume; however, adipocytes only represent less than 50% of total cells found in WAT4,5. The non-adipocyte compartment of WAT, or stromal-vascular fraction (SVF), is quite heterogeneous and contains vascular endothelial cells, tissue-resident immune cells, fibroblasts, and adipocyte precursor cell (APC) populations.
WAT is exceptional in its remarkable capacity to expand in size as the demand for energy storage increases. Maintaining this tissue plasticity is essential as adequate storage of lipids in WAT protects against deleterious ectopic lipid deposition into non-adipose tissues6. The manner by which individual WAT depots undergo this expansion in response to caloric excess is a critical determinant of insulin sensitivity in the setting of obesity7. Pathologic WAT expansion, observed in obese individuals with metabolic syndrome, is characterized by preferential expansion of visceral WAT depots at the expense of metabolically favorable subcutaneous fat tissue. Moreover, insulin resistance in obesity is associated with pathologic remodeling of WAT. This is characterized by hypertrophic growth of existing adipocytes (increase in size), inadequate angiogenesis, chronic metabolic-inflammation, accumulation of extracellular matrix components (fibrosis), and tissue hypoxia8,9. These WAT phenotypes of obesity are associated with hepatic steatosis and insulin resistance, similar to what is observed in the condition of lipodystrophy (absence of functional WAT). In contrast, healthy WAT expansion is observed in the metabolically healthy obese population and is characterized by preferential expansion of protective subcutaneous WAT and depot expansion through adipocyte hyperplasia10. The recruitment of new adipocytes is mediated by de novo adipocyte differentiation from adipocyte precursor cells (APCs) (termed, &#8220;adipogenesis&#8221;). Adipocyte hyperplasia coincides with relatively lower degrees of WAT fibrosis and metabolic inflammation6,11. A multitude of cell types within the WAT microenvironment directly influence the health and expandability of WAT in obesity12. As such, defining the function of the various cell types present in WAT remains a high priority for the field.
Over the past decade, several strategies have been employed to define and isolate native APCs from human and mouse WAT SVF13. Such strategies isolate APCs based on the cell surface expression of common mesenchymal stem/progenitor cell markers using antibody-based cell separation techniques. These approaches include fluorescence-activated cell sorting (FACS), using fluorophore-labelled antibodies, or immunomagnetic bead separation (i.e., chemically modified antibodies). Cell surface proteins targeted for the isolation of APCs include PDGFR&#945;, PDGFR&#946;, CD34, and SCA-1. These approaches have helped enrich for APCs; however, cell populations isolated based on these markers are quite heterogeneous. Very recent single-cell RNA-sequencing (scRNA-seq) studies have highlighted the molecular and functional heterogeneity of stromal cells within the isolated stromal-vascular fraction (SVF) of murine WAT14,15,16,17. From our own scRNA-seq and functional analyses, we have identified and characterized functionally distinct immune-modulating and adipogenic PDGFR&#946;+ perivascular cell subpopulations in the stromal compartment of intra-abdominal WAT in adult mice15. Fibro-inflammatory precursors, or FIPs, represent a prominent subpopulation of PDGFR&#946;+ cells and can be isolated based on LY6C expression (LY6C+ PDGFR&#946;+ cells)15. FIPs lack adipogenic capacity, exert a strong pro-inflammatory response to various stimuli, produce collagen, and secrete anti-adipogenic factors15. The pro-inflammatory and fibrogenic activity of these cells increases in association with obesity in mice, implicating these cells as regulators of WAT remodeling. The LY6C- CD9- PDGFR&#946;+ subpopulation represents adipocyte precursor cells (APCs). These APCs are enriched in the expression of Pparg and other pro-adipogenic genes, and readily differentiate into mature adipocytes in vitro and in vivo15. Here, we provide a detailed protocol for the isolation of these distinct cell populations from intra-abdominal WAT depots of adult mice using FACS, and immunomagnetic bead separation with biotinylated antibodies. This protocol can be used to isolate functionally distinct adipose progenitor subpopulations from multiple intra-abdominal WAT depots of adult male and female mice15. Studying these functionally distinct cell populations in isolation may contribute greatly to our current understanding of the molecular mechanisms that regulate adipogenesis and intra-abdominal adipose tissue remodeling in health and disease.
The protocol below details the isolation of adipose progenitors from murine epididymal WAT; however, the same procedure can be used to isolate corresponding cells from the mesenteric and retroperitoneal WAT depots of both male and female mice15. A detailed protocol on how to identify and isolate these depots in mice can be found in Bagchi et al.18. This protocol has been optimized for the use of mice 6-8 weeks of age. The frequency and differentiation capacity of APCs may decline in association with ageing.

<table>
	<tbody>
		<tr>
			<td>Mechanical Tissue Preparation and SVF Isolation</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>40 and 100 &#181;m cell strainers</td>
			<td>Fisher Scientific</td>
			<td>352340/352360</td>
			<td></td>
		</tr>
		<tr>
			<td>1X Phosphate buffered saline (PBS)</td>
			<td>Fisher Scientific</td>
			<td>21040CV</td>
			<td></td>
		</tr>
		<tr>
			<td>5ml polypropylene tubes</td>
			<td>Fisher Scientific</td>
			<td>352053</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Digestion Buffer (for 10mL)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>10 ml HBSS</td>
			<td>Sigma</td>
			<td>H8264</td>
			<td></td>
		</tr>
		<tr>
			<td>10 mg Collagenase D (1 mg/ml final cc.)</td>
			<td>Roche</td>
			<td>11088882001</td>
			<td></td>
		</tr>
		<tr>
			<td>0.15 g BSA (1.5 % final cc.)</td>
			<td>Fisher Scientific</td>
			<td>BP1605-100</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Immunomagnetic separation of APCs and non-APCs</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>5X MojoSort Buffer (MS buffer)</td>
			<td>BioLegend</td>
			<td>480017</td>
			<td></td>
		</tr>
		<tr>
			<td>5 ml MojoSort Magnet (MS magnet)</td>
			<td>BioLegend</td>
			<td>480019</td>
			<td></td>
		</tr>
		<tr>
			<td>100 &#181;L MojoSort Streptavidin Nanobeads</td>
			<td>BioLegend</td>
			<td>480015</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Purity Check and FACS</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>10X Red Blood Cell Lysis Buffer</td>
			<td>eBioscience</td>
			<td>00-4300-54</td>
			<td></td>
		</tr>
		<tr>
			<td>Fc block (Mouse CD16/CD32)</td>
			<td>eBioscience</td>
			<td>553141</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibodies</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Biotin CD45</td>
			<td>BioLegend</td>
			<td>103103</td>
			<td>Concentration: &#8804; 0.25 &#181;g per 10^6 cells 
			Species: Mouse 
			Clone: 30-F11</td>
		</tr>
		<tr>
			<td>Biotin CD31</td>
			<td>BioLegend</td>
			<td>102503</td>
			<td>Concentration: &#8804; 0.25 &#181;g per 10^6 cells 
			Species: Mouse 
			Clone: MEC13.3</td>
		</tr>
		<tr>
			<td>Biotin CD9</td>
			<td>BioLegend</td>
			<td>124803</td>
			<td>Concentration: &#8804; 0.25 &#181;g per 10^6 cells 
			Species: Mouse 
			Clone: MZ3</td>
		</tr>
		<tr>
			<td>Biotin LY6C</td>
			<td>BioLegend</td>
			<td>128003</td>
			<td>Concentration: &#8804; 0.25 &#181;g per 10^6 cells 
			Species: Mouse 
			Clone: HK1.4</td>
		</tr>
		<tr>
			<td>CD31-PerCP/Cy5.5</td>
			<td>BioLegend</td>
			<td>102419</td>
			<td>Concentration: Dilution 1:400 
			Species: Mouse 
			Clone: 390</td>
		</tr>
		<tr>
			<td>CD45-PerCP/Cy5.5</td>
			<td>BioLegend</td>
			<td>103131</td>
			<td>Concentration: Dilution 1:400 
			Species: Mouse 
			Clone: 30-F11</td>
		</tr>
		<tr>
			<td>CD140b PDGFR&#946;-PE</td>
			<td>BioLegend</td>
			<td>136006</td>
			<td>Concentration: Dilution 1:50 
			Species: Mouse 
			Clone: APB5</td>
		</tr>
		<tr>
			<td>LY6C-APC</td>
			<td>BioLegend</td>
			<td>128016</td>
			<td>Concentration: Dilution 1:400 
			Species: Mouse 
			Clone: HK1.4</td>
		</tr>
		<tr>
			<td>CD9-FITC</td>
			<td>BioLegend</td>
			<td>124808</td>
			<td>Concentration: Dilution 1:400 
			Species: Mouse 
			Clone: MZ3</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Cell Culture and Differentiation</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Gonadal APC Culture media (for 500mL)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>288 mL DMEM with 1 g/L glucose</td>
			<td>Corning</td>
			<td>10-014-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>192 mL MCDB201</td>
			<td>Sigma</td>
			<td>M6770</td>
			<td></td>
		</tr>
		<tr>
			<td>10 mL Fetal bovine serum (FBS)** lot#14E024</td>
			<td>Sigma</td>
			<td>12303C</td>
			<td></td>
		</tr>
		<tr>
			<td>5 mL 100% ITS premix</td>
			<td>BD Bioscience</td>
			<td>354352</td>
			<td></td>
		</tr>
		<tr>
			<td>5 mL 10 mM L-ascorbic acid-2-2phosphate</td>
			<td>Sigma</td>
			<td>A8960-5G</td>
			<td></td>
		</tr>
		<tr>
			<td>50 &#181;L 100 g/ml FGF-basic</td>
			<td>R&#38;D systems</td>
			<td>3139-FB-025/CF</td>
			<td></td>
		</tr>
		<tr>
			<td>5 mL Pen/Strep</td>
			<td>Corning</td>
			<td>30-001-CI</td>
			<td></td>
		</tr>
		<tr>
			<td>500 &#181;L Gentamycin</td>
			<td>Gibco</td>
			<td>15750-060</td>
			<td></td>
		</tr>
		<tr>
			<td>**NOTE: The adipogenic capacity of primary APCs can vary from lot to lot of commercial FBS. Multiple lots/sources of FBS should be tested.</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of adipogenic and fibro-inflammatory stromal cell subpopulations from murine intra-abdominal adipose depots

The stromal-vascular fraction (SVF) of white adipose tissue (WAT) is remarkably heterogeneous and consists of numerous cell types that contribute functionally to the expansion and remodeling of WAT in adulthood. A tremendous barrier to studying the implications of this cellular heterogeneity is the inability to readily isolate functionally distinct cell subpopulations from WAT SVF for in vitro and in vivo analyses. Single-cell sequencing technology has recently identified functionally distinct fibro-inflammatory and adipogenic PDGFR&#946;+ perivascular cell subpopulations in intra-abdominal WAT depots of adult mice. Fibro-inflammatory progenitors (termed, &#8220;FIPs&#8221;) are non-adipogenic collagen producing cells that can exert a pro-inflammatory phenotype. PDGFR&#946;+ adipocyte precursor cells (APCs) are highly adipogenic both in vitro and in vivo upon cell transplantation. Here, we describe multiple methods for the isolation of these stromal cell subpopulations from murine intra-abdominal WAT depots. FIPs and APCs can be isolated by fluorescence-activated cell sorting (FACS) or by taking advantage of biotinylated antibody-based immunomagnetic bead technology. Isolated cells can be used for molecular and functional analysis. Studying the functional properties of stromal cell subpopulation in isolation will expand our current knowledge of adipose tissue remodeling under physiological or pathological conditions on the cellular level.

This protocol describes two strategies that allow for the isolation of distinct stromal cell populations from intra-abdominal WAT depots of adult mice. APCs and FIPs can be isolated by FACS (Figure 1) or immunomagnetic bead separation with biotinylated antibodies (Figure 2). Both approaches utilize reagents and antibodies that are all commercially available. Immunomagnetic bead separation leads to the separation of adipogenic from non-adipogenic cells from the gWAT SVF. Flow cytometry analysis showed that 75% of cells within the adipogenic fraction represented LY6C- CD9- APCs. &#62;75% of the non-adipogenic fraction represented FIPs (LY6C+ cells).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/61610/61610fig01.jpg" /> 
Figure 1: Isolation of PDGFR &#946; + stromal cell subpopulations from gonadal WAT by FACS.&#160;(A) Schematic overview of the procedure: The stromal vascular fraction (non-adipocyte cells) was separated from mature adipocytes by enzymatic tissue digestion and centrifugation. Fluorescence-activated cell sorting (FACS) was then used to remove endothelial (CD31+) and hematopoietic (CD45+) lineage cells and isolate LY6C+ PDGFR&#946;+ cells (FIPs) and LY6C- CD9- PDGFR&#946;+ cells (APCs). (B) Representative FACS collection gates. Panel A is reproduced from ref.11 with permission. <a href="https://www.jove.com/files/ftp_upload/61610/61610fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/61610/61610fig02.jpg" /> 
Figure 2: Separation of adipogenic and non-adipogenic stromal cells by immunomagnetic bead separation.&#160;(A) Schematic overview of the procedure: Step 1: CD31+ &#38; CD45+ cells bind to the magnet. This removes both endothelial and hematopoietic lineage cells. The eluate containing CD31- &#38; CD45- cells were collected and then incubated with antibodies recognizing LY6C and CD9, respectively. Step 2: CD9+ and LY6C+ cells binding to the magnet. Step 3: The supernatant (unbound fraction) containing CD9- &#38; LY6C- cells was collected as this represented the adipogenic fraction (APCs). Non-adipogenic CD9+ and LY6C+ cells bound to nanospheres were eluted as the non-APC fraction containing FIPs. (B) Flow cytometry analysis to assess the frequency of APCs (LY6C- CD9-) and FIPs (LY6C+) within adipogenic and non-adipogenic fractions, respectively. <a href="https://www.jove.com/files/ftp_upload/61610/61610fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Light microscopy and gene expression analysis demonstrate that APCs isolated by FACs or through magnetic bead separation from gWAT of 6-8 week-old mice differentiated into lipid-containing adipocytes to a high degree within 7-10 days following the initial plating of cells in Gonadal APC Culture media (Figure 3). In contrast, non-adipogenic precursors (such as fibro-inflammatory precursors, or FIPs) remained fibroblast-like and did not become adipocytes when maintained in the same culture media (Gonadal APC Culture Media) (Figure 3). It should be noted that few cells in the non-APCs cultures showed some lipid accumulation (Figure 3D). These likely arise from APC-contamination during cell isolation. Additional washes might improve the purity of this fraction.
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/61610/61610fig03.jpg" /> 
Figure 3: In vitro differentiation of PDGFR &#946; + stromal cell populations isolated from gWAT of adult mice.&#160;(A-D) Representative bright-field images of differentiated stromal cell subpopulations isolated by immunomagnetic bead separation (A-B) or FACS (C-D) from 6-8-week-old mouse gWAT SVF. Images were taken seven days after plating cells in Gonadal APC Culture Media. Within 7-10 days of plating, APCs undergo spontaneous adipocyte differentiation. Magnification 10X. Scale = 250 &#181;M. (E-F) mRNA levels of adipocyte-selective genes in differentiated cultures shown in A-D. Bar graphs represent mean + SEM. <a href="https://www.jove.com/files/ftp_upload/61610/61610fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>FIPs</td>
			<td>Enriched Genes (vs. APCs)</td>
			<td colspan="2">Forward Primer 5&#8217;-3&#8217;</td>
			<td colspan="2">Reverse Primer 5&#8217;-3&#8217;</td>
		</tr>
		<tr>
			<td></td>
			<td>Ly6c1</td>
			<td colspan="2">ACTGTGCCTGCAACCTTGTCT</td>
			<td colspan="2">GGCCACAAGAAGAATGAGCAC</td>
		</tr>
		<tr>
			<td></td>
			<td>CD9</td>
			<td colspan="2">GCGGGAAACACTCAAAGCCAT</td>
			<td colspan="2">AAAGCTGTTTCTTGGGGCAGG</td>
		</tr>
		<tr>
			<td></td>
			<td>Nov</td>
			<td colspan="2">GTTCCAAGAGCTGTGGAATGG</td>
			<td colspan="2">CTCTTGTTCACAAGGCCGAAC</td>
		</tr>
		<tr>
			<td></td>
			<td>Efhd1</td>
			<td colspan="2">GGCCGCTCTAAGGTCTTCAAT</td>
			<td colspan="2">GTCAATAAAGCCGTCCCTTCC</td>
		</tr>
		<tr>
			<td></td>
			<td>Stmn4</td>
			<td colspan="2">ACCTGAACTGGTGCGTCATCT</td>
			<td colspan="2">CTTGGGAGGGAGGCATTAAAC</td>
		</tr>
		<tr>
			<td></td>
			<td>Dact2</td>
			<td colspan="2">AGCCCCCTAAAGGAAGAAACC</td>
			<td colspan="2">GGTCCTTGGCCACAGTCATTA</td>
		</tr>
		<tr>
			<td></td>
			<td>Il33</td>
			<td colspan="2">ATTTCCCCGGCAAAGTTCAG</td>
			<td colspan="2">AACGGAGTCTCATGCAGTAGA</td>
		</tr>
		<tr>
			<td></td>
			<td>Ccl2</td>
			<td colspan="2">CCACAACCACCTCAAGCACTTC</td>
			<td colspan="2">AAGGCATCACAGTCCGAGTCAC</td>
		</tr>
		<tr>
			<td></td>
			<td>Tgfb2</td>
			<td colspan="2">GGTGTTGTTCCACAGGGGTTA</td>
			<td colspan="2">CGGTCCTTCAGATCCTCCTTT</td>
		</tr>
		<tr>
			<td></td>
			<td>Fn1</td>
			<td colspan="2">GAGAGCACACCCGTTTTCATC</td>
			<td colspan="2">GGGTCCACATGATGGTGACTT</td>
		</tr>
		<tr>
			<td></td>
			<td>DPP4</td>
			<td colspan="2">TGGTGGATGCTGGTGTGGATT</td>
			<td colspan="2">AAGGGGCCTCTCTTCTCTTCCT</td>
		</tr>
		<tr>
			<td></td>
			<td>Thy1</td>
			<td colspan="2">TCTTCTTTCCCTTGCCCCTCTG</td>
			<td colspan="2">AGGTTGCAAGACTCTCGCTGT</td>
		</tr>
		<tr>
			<td colspan="6"></td>
		</tr>
		<tr>
			<td>APCs</td>
			<td>Enriched Genes (vs. FIPs)</td>
			<td colspan="2">Forward Primer 5&#8217;-3&#8217;</td>
			<td colspan="2">Reverse Primer 5&#8217;-3&#8217;</td>
		</tr>
		<tr>
			<td></td>
			<td>Agt</td>
			<td colspan="2">GTTCTGGGCAAAACTCAGTGC</td>
			<td colspan="2">GAGGCTCTGCTGCTCATCATT</td>
		</tr>
		<tr>
			<td></td>
			<td>Cxcl14</td>
			<td colspan="2">TGGACGGGTCCAAGTGTAAGT</td>
			<td colspan="2">TCCTCGCAGTGTGGGTACTTT</td>
		</tr>
		<tr>
			<td></td>
			<td>Mmd2</td>
			<td colspan="2">ATCTGGGAGCTGATGACAGGA</td>
			<td colspan="2">AGTGGGTACCAGCACCAAATG</td>
		</tr>
		<tr>
			<td></td>
			<td>Pde11a</td>
			<td colspan="2">CGAGCTTGTCAGGAAAGGAGA</td>
			<td colspan="2">TTCAGCCACCTGTCTGGAGAT</td>
		</tr>
		<tr>
			<td></td>
			<td>Lrn1</td>
			<td colspan="2">CAACATGGGAGAGCTGGTTTC</td>
			<td colspan="2">GCACACTACGGAAAGCCAAAC</td>
		</tr>
		<tr>
			<td></td>
			<td>Pparg</td>
			<td colspan="2">GCATGGTGCCTTCGCTGA</td>
			<td colspan="2">TGGCATCTCTGTGTCAACCATG</td>
		</tr>
		<tr>
			<td></td>
			<td>Fabp4</td>
			<td colspan="2">ACTGGGCGTGGAATTCGATGA</td>
			<td colspan="2">ACCAGCTTGTCACCATCTCGT</td>
		</tr>
		<tr>
			<td></td>
			<td>Lpl</td>
			<td colspan="2">CATCGAGAGAGGATCCGAGTGAA</td>
			<td colspan="2">TGCTGAGTCCTTTCCCTTCTG</td>
		</tr>
		<tr>
			<td></td>
			<td>Cd36</td>
			<td colspan="2">GAGTTGGCGAGAAAACCAGTG</td>
			<td colspan="2">GAGAATGCCTCCAAACACAGC</td>
		</tr>
	</tbody>
</table>
Table 1: qPCR primers sequences used to validate the isolation of FIPs and APCs

Read this Scientific Article Protocol about Isolation of Adipogenic and Fibro-Inflammatory Stromal Cell Subpopulations from Murine Intra-Abdominal Adipose Depots at JoVE.com

Isolation of Adipogenic and Fibro-Inflammatory Stromal Cell Subpopulations from Murine Intra-Abdominal Adipose Depots

This protocol describes the technical approach to isolate adipogenic and fibro-inflammatory stromal cell subpopulations from murine intra-abdominal white adipose tissue (WAT) depots by fluorescence-activated cell sorting or immunomagnetic bead separation.

The stromal-vascular fraction (SVF) of white adipose tissue (WAT) is remarkably heterogeneous and consists of numerous cell types that contribute ...

isolation-adipogenic-fibro-inflammatory-stromal-cell-subpopulations

Universidad San Sebastian

Research

JoVE Journal

Immunology and Infection

2.5K Views.  Novo Nordisk A/S. This protocol describes the technical approach to isolate adipogenic and fibro-inflammatory stromal cell subpopulations from murine intra-abdominal white adipose tissue (WAT) depots by fluorescence-activated cell sorting or immunomagnetic bead separation.

Video: Isolation of Adipogenic and Fibro-Inflammatory Stromal Cell Subpopulations from Murine Intra-Abdominal Adipose Depots

Isolation of Precursor B-cell Subsets from Umbilical Cord Blood

Umbilical cord blood is highly enriched for hematopoietic progenitor cells at different lineage commitment stages. We have developed a protocol for isolating precursor B-cells at four different stages of differentiation. Because genes are expressed and epigenetic modifications occur in a tissue specific manner, it is vital to discriminate between tissues and cell types in order to be able to identify alterations in the genome and the epigenome that may lead to the development of disease. This method can be adapted to any type of cell present in umbilical cord blood at any stage of differentiation.	
This method comprises 4 main steps. First, mononuclear cells are separated by density centrifugation. Second, B-cells are enriched using biotin conjugated antibodies that recognize and remove non B-cells from the mononuclear cells. Third the B-cells are fluorescently labeled with cell surface protein antibodies specific to individual stages of B-cell development. Finally, the fluorescently labeled cells are sorted and individual populations are recovered. The recovered cells are of sufficient quantity and quality to be utilized in downstream nucleic acid assays.

Here we describe a protocol for isolating subsets of precursor B-cells from umbilical cord blood. A sufficient quantity and quality of nucleic acids may be extracted from the cells and used in subsequent assays utilizing DNA or RNA.

Umbilical cord blood is highly enriched for hematopoietic progenitor cells at different lineage commitment stages. We have developed a protocol for ...

Isolation of Adipose Tissue Immune Cells

The discovery of increased macrophage infiltration in the adipose tissue (AT) of obese rodents and humans has led to an intensification of interest in immune cell contribution to local and systemic insulin resistance. Isolation and quantification of different immune cell populations in lean and obese AT is now a commonly utilized technique in immunometabolism laboratories; yet extreme care must be taken both in stromal vascular cell isolation and in the flow cytometry analysis so that the data obtained is reliable and interpretable. In this video we demonstrate how to mince, digest, and isolate the immune cell-enriched stromal vascular fraction. Subsequently, we show how to antibody label macrophages and T lymphocytes and how to properly gate on them in flow cytometry experiments. Representative flow cytometry plots from low fat-fed lean and high fat-fed obese mice are provided. A critical element of this analysis is the use of antibodies that do not fluoresce in channels where AT macrophages are naturally autofluorescent, as well as the use of proper compensation controls.

Adipose tissue (AT) is a site of intense immune cell activation and interaction. Almost all cells of the immune system are present in AT and their ratios are altered by obesity. Proper isolation, quantification, and characterization of AT immune cell populations are critical for understanding their role in immunometabolic disease.

The discovery of increased macrophage infiltration in  the adipose tissue (AT) of obese rodents and humans has led to an  intensification of interest in ...

Isolation of Cortical Microglia with Preserved Immunophenotype and Functionality From Murine Neonates

Isolation of microglia from CNS tissue is a powerful investigative tool used to study microglial biology ex vivo. The present method details a procedure for isolation of microglia from neonatal murine cortices by mechanical agitation with a rotary shaker. This microglia isolation method yields highly pure cortical microglia that exhibit morphological and functional characteristics indicative of quiescent microglia in normal, nonpathological conditions in vivo. This procedure also preserves the microglial immunophenotype and biochemical functionality as demonstrated by the induction of morphological changes, nuclear translocation of the p65 subunit of NF-&#954;B (p65), and secretion of the hallmark proinflammatory cytokine, tumor necrosis factor-&#945; (TNF-&#945;), upon lipopolysaccharide (LPS) and Pam3CSK4 (Pam) challenges. Therefore, the present isolation procedure preserves the immunophenotype of both quiescent and activated microglia, providing an experimental method of investigating microglia biology in ex vivo conditions.

One key to successful investigation of microglial biology is the preservation of microglial immunofunction ex vivo during isolation from CNS tissue. Isolating microglia via rotary shaking results in highly pure and immunofunctional cell cultures as assessed by fluorescent imaging, immunocytochemistry, and ELISA following microglia activation with the proinflammatory stimuli lipopolysaccharide (LPS) and Pam3CSK4 (Pam).

Isolation of microglia from CNS tissue is a powerful investigative tool used to study microglial biology ex vivo. The present method details a procedure ...

Detection of Fluorescent Nanoparticle Interactions with Primary Immune Cell Subpopulations by Flow Cytometry

Engineered nanoparticles are endowed with very promising properties for therapeutic and diagnostic purposes. This work describes a fast and reliable method of analysis by flow cytometry to study nanoparticle interaction with immune cells. Primary immune cells can be easily purified from human or mouse tissues by antibody-mediated magnetic isolation. In the first instance, the different cell populations running in a flow cytometer can be distinguished by the forward-scattered light (FSC), which is proportional to cell size, and the side-scattered light (SSC), related to cell internal complexity. Furthermore, fluorescently labeled antibodies against specific cell surface receptors permit the identification of several subpopulations within the same sample. Often, all these features vary when cells are boosted by external stimuli that change their physiological and morphological state. Here, 50 nm FITC-SiO2 nanoparticles are used as a model to identify the internalization of nanostructured materials in human blood immune cells. The cell fluorescence and side-scattered light increase after incubation with nanoparticles allowed us to define time and concentration dependence of nanoparticle-cell interaction. Moreover, such protocol can be extended to investigate Rhodamine-SiO2 nanoparticle interaction with primary microglia, the central nervous system resident immune cells, isolated from mutant mice that specifically express the Green Fluorescent Protein (GFP) in the monocyte/macrophage lineage. Finally, flow cytometry data related to nanoparticle internalization into the cells have been confirmed by confocal microscopy.

Analysis of nanoparticle interaction with defined subpopulations of immune cells by flow cytometry.

Engineered nanoparticles are endowed with very promising properties for therapeutic and diagnostic purposes. This work describes a fast and reliable ...

Isolation of Murine Lymph Node Stromal Cells

Secondary lymphoid organs including lymph nodes are composed of stromal cells that provide a structural environment for homeostasis, activation and differentiation of lymphocytes. Various stromal cell subsets have been identified by the expression of the adhesion molecule CD31 and glycoprotein podoplanin (gp38), T zone reticular cells or fibroblastic reticular cells, lymphatic endothelial cells, blood endothelial cells and FRC-like pericytes within the double negative cell population. For all populations different functions are described including, separation and lining of different compartments, attraction of and interaction with different cell types, filtration of the draining fluidics and contraction of the lymphatic vessels. In the last years, different groups have described an additional role of stromal cells in orchestrating and regulating cytotoxic T cell responses potentially dangerous for the host. 
Lymph nodes are complex structures with many different cell types and therefore require a appropriate procedure for isolation of the desired cell populations. Currently, protocols for the isolation of lymph node stromal cells rely on enzymatic digestion with varying incubation times; however, stromal cells and their surface molecules are sensitive to these enzymes, which results in loss of surface marker expression and cell death. Here a short enzymatic digestion protocol combined with automated mechanical disruption to obtain viable single cells suspension of lymph node stromal cells maintaining their surface molecule expression is proposed.

Isolation of lymph node stromal cells is a multistep procedure including enzymatic digestion and mechanical disaggregation to obtain fibroblastic reticular cells, lymphatic and blood endothelial cells. In the described procedure, a short digestion is combined with automated mechanical disaggregation to minimize surface marker degradation of viable lymph node stromal cells.

Secondary lymphoid organs including lymph nodes are composed of stromal cells that provide a structural environment for homeostasis, activation and ...

Isolation of Leukocytes from the Murine Tissues at the Maternal-Fetal Interface

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing fetus. This tolerance is initiated during coitus, established during fecundation and implantation, and maintained throughout pregnancy. Active cellular and molecular mediators of maternal-fetal tolerance are enriched at the site of contact between fetal and maternal tissues, known as the maternal-fetal interface, which includes the placenta and the uterine and decidual tissues. This interface is comprised of stromal cells and infiltrating leukocytes, and their abundance and phenotypic characteristics change over the course of pregnancy. Infiltrating leukocytes at the maternal-fetal interface include neutrophils, macrophages, dendritic cells, mast cells, T cells, B cells, NK cells, and NKT cells that together create the local micro-environment that sustains pregnancy. An imbalance among these cells or any inappropriate alteration in their phenotypes is considered a mechanism of disease in pregnancy. Therefore, the study of leukocytes that infiltrate the maternal-fetal interface is essential in order to elucidate the immune mechanisms that lead to pregnancy-related complications. Described herein is a protocol that uses a combination of gentle mechanical dissociation followed by a robust enzymatic disaggregation with a proteolytic and collagenolytic enzymatic cocktail to isolate the infiltrating leukocytes from the murine tissues at the maternal-fetal interface. This protocol allows for the isolation of high numbers of viable leukocytes (&#62;70%) with sufficiently conserved antigenic and functional properties. Isolated leukocytes can then be analyzed by several techniques, including immunophenotyping, cell sorting, imaging, immunoblotting, mRNA expression, cell culture, and in vitro functional assays such as mixed leukocyte reactions, proliferation, or cytotoxicity assays.

Described herein is a protocol to isolate and analyze the infiltrating leukocytes of tissues at the maternal-fetal interface (uterus, decidua, and placenta) of mice. This protocol maintains the integrity of most cell surface markers and yields enough viable cells for downstream applications including flow cytometry analysis.

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing ...

Isolation, Expansion, and Adipogenic Induction of CD34+CD31+ Endothelial Cells from Human Omental and Subcutaneous Adipose Tissue

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor response to insulin, local hypoxia, and inflammation. By stimulating the differentiation of functional white adipocytes from progenitors, radical hypertrophy of the adipocyte population can be prevented and, consequently, the metabolic health of adipose tissue can be improved along with a reduction of inflammation. Also, by stimulating a differentiation of beige/brown adipocytes, the total body energy expenditure can be increased, resulting in weight loss. This approach could prevent the development of obesity co-morbidities such as type 2 diabetes and cardiovascular disease.
This paper describes the isolation, expansion, and differentiation of white and beige adipocytes from a subset of human adipose tissue endothelial cells that co-express the CD31 and CD34 markers. The method is relatively cheap and is not labor-intensive. It requires access to human adipose tissue and the subcutaneous depot is suitable for sampling. For this protocol, fresh adipose tissue samples from morbidly obese subjects [body mass index (BMI) &#62;35] are collected during bariatric surgery procedures. Using a sequential immunoseparation from the stromal vascular fraction, enough cells are produced from as little as 2&#8211;3 g of fat. These cells can be expanded in culture over 10&#8211;14 days, can be cryopreserved, and retain their adipogenic properties with passaging up to passage 5&#8211;6. The cells are treated for 14 days with an adipogenic cocktail using a combination of human insulin and the PPAR&#947; agonist-rosiglitazone.
This methodology can be used for obtaining proof of concept experiments on molecular mechanisms that drive adipogenic responses in adipose endothelial cells, or for screening new drugs that can enhance the adipogenic response directed either towards white or beige/brown adipocyte differentiation. Using small subcutaneous biopsies, this methodology can be used to screen out non-responder subjects for clinical trials aimed to stimulate beige/brown and white adipocytes for the treatment of obesity and co-morbidities.

The differentiation of white and beige adipocytes from adipose tissue vascular progenitors bears potential for metabolic improvement in obesity. We describe protocols for a CD34+CD31+ endothelial cell isolation from human fat and for a subsequent in vitro expansion and differentiation into white and beige adipocytes. Several downstream applications are discussed.

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor ...

Simultaneous Study of the Recruitment of Monocyte Subpopulations Under Flow In Vitro

The recruitment of monocytes from the blood to targeted peripheral tissues is critical to the inflammatory process during tissue injury, tumor development and autoimmune diseases. This is facilitated through a process of capture from free flow onto the luminal surface of activated endothelial cells, followed by their adhesion and transendothelial migration (transmigration) into the underlying affected tissue. However, the mechanisms that support the preferential and context-dependent recruitment of monocyte subpopulations are still not fully understood. Therefore, we have developed a method that allows the recruitment of different monocyte subpopulations to be simultaneously visualized and measured under flow. This method, based on time-lapse confocal imaging, allows for the unambiguous distinction between adherent and transmigrated monocytes. Here, we describe how this method can be used to simultaneously study the recruitment cascade of pro-angiogenic and non-angiogenic monocytes in vitro. Furthermore, this method can be extended to study the different steps of recruitment of up to three monocyte populations.

Here, we present an integrated protocol that measures monocyte subpopulation trafficking under flow in vitro by use of specific surface markers and confocal fluorescence microscopy. This protocol can be used to explore sequential recruitment steps as well as to profile other leukocyte subtypes using other specific surface markers.

The recruitment of monocytes from the blood to targeted peripheral tissues is critical to the inflammatory process during tissue injury, tumor development ...

Isolation of Single Intracellular Bacterial Communities Generated from a Murine Model of Urinary Tract Infection for Downstream Single-cell Analysis

In this article, we outline a procedure used to isolate individual intracellular bacterial communities from a mouse that has been experimentally infected in the urinary tract. The protocol can be broadly divided into three sections: the infection, bladder epithelial cell harvesting, and mouth micropipetting to isolate individual infected epithelial cells. The isolated epithelial cell contains viable bacterial cells and is nearly free of contaminating extracellular bacteria, making it ideal for downstream single-cell analysis. The time taken from the start of infection to obtaining a single intracellular bacterial community is about 8 h. This protocol is inexpensive to deploy and uses widely available materials, and we anticipate that it can also be utilized in other infection models to isolate single infected cells from cell mixtures even if those infected cells are rare. However, due to a potential risk in mouth micropipetting, this procedure is not recommended for highly infectious agents.

This protocol describes a simple method of isolating single, infected-bladder epithelial cells from a murine model of urinary tract infection.

In this article, we outline a procedure used to isolate individual intracellular bacterial communities from a mouse that has been experimentally infected ...

Isolation of Lamina Propria Mononuclear Cells from Murine Colon Using Collagenase E

The intestine is the home to the largest number of immune cells in the body. The small and large intestinal immune systems police exposure to exogenous antigens and modulate responses to potent microbially derived immune stimuli. For this reason, the intestine is a major target site of immune dysregulation and inflammation in many diseases including but, not limited to inflammatory bowel diseases such as Crohn&#8217;s disease and ulcerative colitis, graft-versus-host disease (GVHD) after bone marrow transplantation (BMT), and many allergic and infectious conditions. Murine models of gastrointestinal inflammation and colitis are heavily used to study GI complications and to pre-clinically optimize strategies for prevention and treatment. Data gleaned from these models via isolation and phenotypic analysis of immune cells from the intestine is critical to further immune understanding that can be applied to ameliorate gastrointestinal and systemic inflammatory disorders. This report describes a highly effective protocol for the isolation of mononuclear cells (MNC) from the colon using a mixed silica-based density gradient interface. This method reproducibly isolates a significant number of viable leukocytes while minimizing contaminating debris, allowing subsequent immune phenotyping by flow cytometry or other methods.

The goal of this protocol is to isolate mononuclear cells that reside in the lamina propria of the colon by enzymatic digestion of the tissue using collagenase. This protocol allows for the efficient isolation of mononuclear cells resulting in a single cell suspension which in turn can be used for robust immunophenotyping.

The intestine is the home to the largest number of immune cells in the body. The small and large intestinal immune systems police exposure to exogenous ...