Name: identifying transcription factor olig2 genomic binding sites in acutely purified pdgfr&#945;+ cells by low-cell chromatin immunoprecipitation sequencing analysis
Uploaded: 2018-04-16T14:00:00
Description: Watch this Scientific Journal Video about Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRÎ±+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysi

JQW, XD, RCDD, and YY were supported by grants from the National Institutes of Health R01 NS088353; NIH grant 1R21AR071583-01; the Staman Ogilvie Fund-Memorial Hermann Foundation; the UTHealth BRAIN Initiative and CTSA UL1 TR000371; and a grant from the University of Texas System Neuroscience and Neurotechnology Research Institute (Grant #362469).

All animal usage and experimental protocols were performed in accordance with the Guide for the Care and Use of Laboratory Animals and approved by the Institutional Biosafety Committee and Animal Welfare Committee at the University of Texas Health Science Center at Houston.
1. Purification of PDGFR&#945; Positive Oligodendrocyte Lineage Cells from Mouse Brain (modified from previously described immunopanning protocols5,6,<sup ...

<ol>
	<li>Wu, J. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tcf7+is+an+important+regulator+of+the+switch+of+self-renewal+and+differentiation+in+a+multipotential+hematopoietic+cell+line.">Tcf7 is an important regulator of the switch of self-renewal and differentiation in a multipotential hematopoietic cell line.</a> PLoS Genet. 8 (3), e1002565 (2012).</li><li>Zuchero, J. B., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrinsic+and+extrinsic+control+of+oligodendrocyte+development.">Intrinsic and extrinsic control of oligodendrocyte development.</a> Curr Opin Neurobiol. 23 (6), 914-920 (2013).</li><li>Liu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+oligodendrocyte+differentiation+by+Olig2+and+Sox10:+evidence+for+reciprocal+interactions+and+dosage-dependent+mechanisms.">Induction of oligodendrocyte differentiation by Olig2 and Sox10: evidence for reciprocal interactions and dosage-dependent mechanisms.</a> Dev Biol. 302 (2), 683-693 (2007).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+Identification+of+Long+Non-coding+RNAs+in+Purified+Cell+Types+from+the+Brain+Reveals+Functional+LncRNA+in+OPC+Fate+Determination.">Comprehensive Identification of Long Non-coding RNAs in Purified Cell Types from the Brain Reveals Functional LncRNA in OPC Fate Determination.</a> PLoS Genet. 11 (12), e1005669 (2015).</li><li>Hilgenberg, L. G., Smith, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+dissociated+mouse+cortical+neuron+cultures.">Preparation of dissociated mouse cortical neuron cultures.</a> J Vis Exp. (10), e562 (2007).</li><li>Emery, B., Dugas, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+oligodendrocyte+lineage+cells+from+mouse+cortices+by+immunopanning.">Purification of oligodendrocyte lineage cells from mouse cortices by immunopanning.</a> Cold Spring Harb Protoc. 2013 (9), 854-868 (2013).</li><li>Cahoy, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcriptome+database+for+astrocytes,+neurons,+and+oligodendrocytes:+a+new+resource+for+understanding+brain+development+and+function.">A transcriptome database for astrocytes, neurons, and oligodendrocytes: a new resource for understanding brain development and function.</a> J Neurosci. 28 (1), 264-278 (2008).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA-sequencing+transcriptome+and+splicing+database+of+glia,+neurons,+and+vascular+cells+of+the+cerebral+cortex.">An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.</a> J Neurosci. 34 (36), 11929-11947 (2014).</li><li>Cheng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+morphogenetic+protein+signaling+and+olig1/2+interact+to+regulate+the+differentiation+and+maturation+of+adult+oligodendrocyte+precursor+cells.">Bone morphogenetic protein signaling and olig1/2 interact to regulate the differentiation and maturation of adult oligodendrocyte precursor cells.</a> Stem Cells. 25 (12), 3204-3214 (2007).</li><li>Bolger, A. M., Lohse, M., Usadel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trimmomatic:+a+flexible+trimmer+for+Illumina+sequence+data.">Trimmomatic: a flexible trimmer for Illumina sequence data.</a> Bioinformatics. 30 (15), 2114-2120 (2014).</li><li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+gapped-read+alignment+with+Bowtie+2.">Fast gapped-read alignment with Bowtie 2.</a> Nat Methods. 9 (4), 357-359 (2012).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Heinz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+combinations+of+lineage-determining+transcription+factors+prime+cis-regulatory+elements+required+for+macrophage+and+B+cell+identities.">Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities.</a> Mol Cell. 38 (4), 576-589 (2010).</li><li>Team, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+language+and+environment+for+statistical+computing.">A language and environment for statistical computing.</a> R Foundation for Statistical Computing. , (2015).</li><li>Kharchenko, P. V., Tolstorukov, M. Y., Park, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+analysis+of+ChIP-seq+experiments+for+DNA-binding+proteins.">Design and analysis of ChIP-seq experiments for DNA-binding proteins.</a> Nat Biotechnol. 26 (12), 1351-1359 (2008).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Quinlan, A. R., Hall, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BEDTools:+a+flexible+suite+of+utilities+for+comparing+genomic+features.">BEDTools: a flexible suite of utilities for comparing genomic features.</a> Bioinformatics. 26 (6), 841-842 (2010).</li><li>Robinson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat Biotechnol. 29 (1), 24-26 (2011).</li><li>Bailey, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MEME+SUITE:+tools+for+motif+discovery+and+searching.">MEME SUITE: tools for motif discovery and searching.</a> Nucleic Acids Res. 37 (Web Server issue), W202-W208 (2009).</li><li>Sims, D., Sudbery, I., Ilott, N. E., Heger, A., Ponting, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+depth+and+coverage:+key+considerations+in+genomic+analyses.">Sequencing depth and coverage: key considerations in genomic analyses.</a> Nat Rev Genet. 15 (2), 121-132 (2014).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Res. 22 (9), 1813-1831 (2012).</li><li>Consortium, E. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+encyclopedia+of+DNA+elements+in+the+human+genome.">An integrated encyclopedia of DNA elements in the human genome.</a> Nature. 489 (7414), 57-74 (2012).</li><li>Mazzoni, E. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell-based+mapping+of+developmental+transcriptional+programs.">Embryonic stem cell-based mapping of developmental transcriptional programs.</a> Nat Methods. 8 (12), 1056-1058 (2011).</li><li>Kheradpour, P., Kellis, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+discovery+and+characterization+of+regulatory+motifs+in+ENCODE+TF+binding+experiments.">Systematic discovery and characterization of regulatory motifs in ENCODE TF binding experiments.</a> Nucleic Acids Res. 42 (5), 2976-2987 (2014).</li><li>Dugas, J. C., Tai, Y. C., Speed, T. P., Ngai, J., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomic+analysis+of+oligodendrocyte+differentiation.">Functional genomic analysis of oligodendrocyte differentiation.</a> J Neurosci. 26 (43), 10967-10983 (2006).</li><li>Gilfillan, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Limitations+and+possibilities+of+low+cell+number+ChIP-seq.">Limitations and possibilities of low cell number ChIP-seq.</a> BMC Genomics. 13, 645 (2012).</li><li>Raskatov, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modulation+of+NF-kappaB-dependent+gene+transcription+using+programmable+DNA+minor+groove+binders.">Modulation of NF-kappaB-dependent gene transcription using programmable DNA minor groove binders.</a> Proc Natl Acad Sci U S A. 109 (4), 1023-1028 (2012).</li><li>Cheneby, J., Gheorghe, M., Artufel, M., Mathelier, A., Ballester, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ReMap+2018:+an+updated+atlas+of+regulatory+regions+from+an+integrative+analysis+of+DNA-binding+ChIP-seq+experiments.">ReMap 2018: an updated atlas of regulatory regions from an integrative analysis of DNA-binding ChIP-seq experiments.</a> Nucleic Acids Res. , (2017).</li><li>Yevshin, I., Sharipov, R., Valeev, T., Kel, A., Kolpakov, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GTRD:+a+database+of+transcription+factor+binding+sites+identified+by+ChIP-seq+experiments.">GTRD: a database of transcription factor binding sites identified by ChIP-seq experiments.</a> Nucleic Acids Res. 45 (D1), D61-D67 (2017).</li><li>Kulakovskiy, I. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HOCOMOCO:+a+comprehensive+collection+of+human+transcription+factor+binding+sites+models.">HOCOMOCO: a comprehensive collection of human transcription factor binding sites models.</a> Nucleic Acids Res. 41 (Database issue), D195-D202 (2013).</li><li>Jain, D., Baldi, S., Zabel, A., Straub, T., Becker, P. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+promoters+give+rise+to+false+positive+'Phantom+Peaks'+in+ChIP-seq+experiments.">Active promoters give rise to false positive 'Phantom Peaks' in ChIP-seq experiments.</a> Nucleic Acids Res. 43 (14), 6959-6968 (2015).</li><li>Gerstein, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Architecture+of+the+human+regulatory+network+derived+from+ENCODE+data.">Architecture of the human regulatory network derived from ENCODE data.</a> Nature. 489 (7414), 91-100 (2012).</li></ol>

Mammalian gene regulation networks are very complex. ChIP-seq is a powerful method to investigate genome-wide protein-DNA interactions. This protocol includes how to perform Olig2 ChIP-seq by using a low number of purified OPCs from mouse brains (as low as 20 thousand cells per reaction). The first key step for this protocol is the purification of OPCs from mouse brains by immunopanning with PDGFR&#945; antibody. For positive selection of OPCs with PDGFR&#945; coated plates, OPCs often weakly bind to the PDGFR&#945; coat...

It is important to study the protein (or protein complex) DNA bindings and the epigenetic marks to build transcriptional regulatory networks involved in various biological processes. Particularly, the bindings of transcription factors to the genomic DNA can play an important role in the gene regulation, the cell differentiation, and the tissue development. A powerful tool for studying the transcriptional regulation and epigenetic mechanisms is chromatin immunoprecipitation (ChIP). Owing to the rapid advancements in the next generation sequencing technology, ChIP coupled with high-throughput DNA sequencing (ChIP-seq) is used for the analyses of protein-DNA bindings and epigenetic marks1. However, a standard ChIP-seq protocol requires about 20 million cells per reaction, which makes the application of this technique difficult when the cell number is limited, such as isolated primary cells and rare cell populations.
Oligodendrocyte lineage cells including oligodendrocyte precursor cells (OPCs) and oligodendrocytes are widely distributed throughout the brain and are essential for the development and function of the brain. As a type of precursor cells, OPCs are capable of both self-renewal and differentiation. OPCs not only serve as progenitors for oligodendrocytes but also play an important role in the propagation of neuronal signaling by communicating with other types of brain cells2. Previous studies have suggested that oligodendrocyte development is regulated by lineage-specific transcription factors such as Olig2 and Sox103,4. These transcription factors were found to bind to the promoter or enhancer regions of some crucial genes to influence their expression during oligodendrocyte specification and differentiation. However, it is challenging to identify DNA binding of protein (or protein complex) of interest in acutely purified primary OPCs with a very limited number of cells.
This protocol describes how to systematically investigate the genomic DNA immunoprecipitated by Olig2 in purified mouse OPCs at genome-wide scale using ChIP-seq technique. OPCs from mouse brains were acutely purified by immunopanning and used in a ChIP experiment without proliferation in vitro. A limited number of OPCs can be obtained by immunopanning and is insufficient for standard ChIP-seq experiments. Herein, a low-cell ChIP-seq protocol with as low as 20 thousand cells per ChIP reaction for transcription factors is described. In brief, cross-linked cells were lysed and sonicated by a sonication device to shear the chromatin. The sheared chromatin was incubated with Olig2 antibody as well as protein A-coated beads to precipitate Olig2 antibody bound genomic DNA. After elution from protein A-coated beads and reverse cross-linking, genomic DNA precipitated by Olig2 antibody was purified by phenol-chloroform extraction. The resulting product was quantified and subjected to T-tailing, primer annealing template switching and extension, the addition of adapters and amplification, library size selection and purification steps for ChIP-seq library construction.
After sequencing, the quality of the raw reads from both the sample prepared with Olig2 transcription factor antibody and the control sample was analyzed. Low-quality base pairs and adapter containing read fragments were trimmed. Next, trimmed reads were aligned to the mouse reference genome. The genomic regions that were significantly enriched for ChIP reads, compared to the control sample, were detected as peaks. Significant peaks, representing potential transcription factor binding sites, were filtered and visualized in a genome browser.
Notably, the method described in this protocol can be broadly used for ChIP-seq of other transcription factors with any cell type of limited numbers.

<table>
	<tbody>
		<tr>
			<td>Reagent/ Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Banderiaea simplicifolia lectin 1</td>
			<td>Vector Laboratories</td>
			<td># L-1100</td>
			<td></td>
		</tr>
		<tr>
			<td>Rat anti-PDGFRa antibody</td>
			<td>BD Bioscience</td>
			<td># 558774</td>
			<td></td>
		</tr>
		<tr>
			<td>Neural tissue dissociation Kit (P)</td>
			<td>MACS Miltenyi Biotec</td>
			<td># 130-092-628</td>
			<td></td>
		</tr>
		<tr>
			<td>Accutase</td>
			<td>STEMCELL technologies</td>
			<td># 07920</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol</td>
			<td>Thermo Fisher</td>
			<td># 15596026</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-NG2 Chondroitin Sulfate Proteoglycan Antibody</td>
			<td>Millipore</td>
			<td># AB5320</td>
			<td></td>
		</tr>
		<tr>
			<td>Bioruptor Pico sonication device</td>
			<td>Diagenode</td>
			<td># B01060001</td>
			<td></td>
		</tr>
		<tr>
			<td>True MicroChIP kit</td>
			<td>Diagenode</td>
			<td># C01010130</td>
			<td></td>
		</tr>
		<tr>
			<td>Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v)</td>
			<td>Thermo Fisher</td>
			<td># 15593031</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoSpin Gel and PCR Clean-Up kit</td>
			<td>MACHEREY-NAGEL</td>
			<td># 740609</td>
			<td></td>
		</tr>
		<tr>
			<td>Quant-iT PicoGreen dsDNA Assay Kit</td>
			<td>Thermo Fisher</td>
			<td># P11496</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA SMART ChIP-Seq kit</td>
			<td>Clontech Laboratories</td>
			<td># 634865</td>
			<td></td>
		</tr>
		<tr>
			<td>Agencourt AMPure XP</td>
			<td>Beckman Voulter</td>
			<td># A63880</td>
			<td></td>
		</tr>
		<tr>
			<td>GlycoBlue</td>
			<td>Thermo Fisher</td>
			<td># AM9516</td>
			<td></td>
		</tr>
		<tr>
			<td>pico-green</td>
			<td>Thermo Fisher</td>
			<td># P11496</td>
			<td></td>
		</tr>
		<tr>
			<td>D-PBS</td>
			<td>Thermo Fisher</td>
			<td># 14190-144</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green master mix</td>
			<td>Bio-Rad Laboratories</td>
			<td># 1725124</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F12</td>
			<td>Fisher Scientific</td>
			<td># 11-320-033</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin (P/S)</td>
			<td>Fisher Scientific</td>
			<td># 15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>N-2 Supplement</td>
			<td>Fisher Scientific</td>
			<td># 17502048</td>
			<td></td>
		</tr>
		<tr>
			<td>B-27 Supplement</td>
			<td>Fisher Scientific</td>
			<td># 17504044</td>
			<td></td>
		</tr>
		<tr>
			<td>insulin</td>
			<td>Sigma</td>
			<td># I6634</td>
			<td>Prepare 0.5 mg/ml insulin solution by dissolving 5 mg insulin in 10 ml water and 50 &#956;l of 1 N HCl.</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin, suitable for cell culture (BSA)</td>
			<td>Sigma</td>
			<td># A4161</td>
			<td>Prepare 4% BSA solution by dissolving 4 g BSA in 100 ml D-PBS and adjust the pH to 7.4</td>
		</tr>
		<tr>
			<td>Fibroblast Growth Factor basic Protein, Human recombinant (bFGF)</td>
			<td>EMD Millipore</td>
			<td># GF003</td>
			<td></td>
		</tr>
		<tr>
			<td>HUMAN PDGF-AA</td>
			<td>VWR</td>
			<td># 102061-188</td>
			<td></td>
		</tr>
		<tr>
			<td>poly-D-lysine</td>
			<td>VWR</td>
			<td># IC15017510</td>
			<td>Prepare 1 mg/ml poly-D-lysine solution by dissolving 10 mg poly-D-lysine in 10 ml water and dilute 100 times when using.</td>
		</tr>
		<tr>
			<td>Falcon Disposable Petri Dishes, Sterile, Corning, 100x15mm</td>
			<td>VWR</td>
			<td># 25373-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Falcon Disposable Petri Dishes, Sterile, Corning, 150x15mm</td>
			<td>VWR</td>
			<td># 25373-187</td>
			<td></td>
		</tr>
		<tr>
			<td>HBSS, 10X, no Calcium, no Magnesium, no Phenol Red</td>
			<td>Fisher Scientific</td>
			<td># 14185-052</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue</td>
			<td>Stemcell Technologies</td>
			<td># 07050</td>
			<td></td>
		</tr>
		<tr>
			<td>protease inhibitor cocktail</td>
			<td>Sigma</td>
			<td># 11697498001</td>
			<td></td>
		</tr>
		<tr>
			<td>Software</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>FastQC</td>
			<td>[10] http://www.bioinformatics.babraham.ac.uk/projects/fastqc/</td>
			<td></td>
			<td>Obtaining quality control metrics of raw and trimmed reads</td>
		</tr>
		<tr>
			<td>Trimmomatic 0.33</td>
			<td>[11] http://www.usadellab.org/cms/?page=trimmomatic</td>
			<td></td>
			<td>Trimming and filtering raw reads</td>
		</tr>
		<tr>
			<td>GENCODE mm10</td>
			<td>ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_mouse/release_M15/GRCm38.primary_assembly.genome.fa.gz</td>
			<td></td>
			<td>Mouse reference genome</td>
		</tr>
		<tr>
			<td>Bowtie2 2.2.4</td>
			<td>[12] http://bowtie-bio.sourceforge.net/bowtie2/index.shtml</td>
			<td></td>
			<td>Aligning reads to a reference genome</td>
		</tr>
		<tr>
			<td>SAMTools 1.5</td>
			<td>[13] http://samtools.sourceforge.net/</td>
			<td></td>
			<td>Converting SAM file into BAM format</td>
		</tr>
		<tr>
			<td>HOMER 4.9.1</td>
			<td>[14] http://homer.ucsd.edu/homer/</td>
			<td></td>
			<td>Creating a tag directory and annotating enriched genomic regions with gene symbols</td>
		</tr>
		<tr>
			<td>R 3.2.2</td>
			<td>[15] https://www.R-project.org/</td>
			<td></td>
			<td>Programming scripts and running functions</td>
		</tr>
		<tr>
			<td>SPP 1.13</td>
			<td>[16] https://github.com/hms-dbmi/spp</td>
			<td></td>
			<td>Creating a strand cross-correlation plot</td>
		</tr>
		<tr>
			<td>MACS2 2.2.4</td>
			<td>[17] https://github.com/taoliu/MACS</td>
			<td></td>
			<td>Finding regions of ChIP enrichment over control</td>
		</tr>
		<tr>
			<td>BEDTools 2.25</td>
			<td>[18] http://bedtools.readthedocs.io/en/latest/</td>
			<td></td>
			<td>Genome arithmetics</td>
		</tr>
		<tr>
			<td>bedGraphToBigWig</td>
			<td>http://hgdownload.cse.ucsc.edu/admin/exe/</td>
			<td></td>
			<td>Converting bedGraph file into bigwig</td>
		</tr>
		<tr>
			<td>IGV browser 2.3.58</td>
			<td>[19] http://software.broadinstitute.org/software/igv/</td>
			<td></td>
			<td>Visualization and browsing of significant ChIP-seq peaks</td>
		</tr>
		<tr>
			<td>Microsoft Excel</td>
			<td></td>
			<td></td>
			<td>Spreasheet program</td>
		</tr>
		<tr>
			<td>ENCODE&#39;s blacklist</td>
			<td>https://sites.google.com/site/anshulkundaje/projects/blacklists</td>
			<td></td>
			<td>Filtering peaks</td>
		</tr>
		<tr>
			<td>mm10.chrom.sizes</td>
			<td>http://hgdownload.cse.ucsc.edu/goldenPath/mm10/bigZips/mm10.chrom.sizes.</td>
			<td></td>
			<td>Converting bedGraph file into bigwig</td>
		</tr>
		<tr>
			<td>ENCODE&#39;s motif database</td>
			<td>[25] http://compbio.mit.edu/encode-motifs/</td>
			<td></td>
			<td>Comprehensive motif database required for motif enrichment</td>
		</tr>
		<tr>
			<td>MEME-ChIP</td>
			<td>[20] http://meme-suite.org/index.html</td>
			<td></td>
			<td>Motif enrichment analysis and motif discovery</td>
		</tr>
		<tr>
			<td>Primer names used for qPCR</td>
			<td></td>
			<td></td>
			<td>Primer sequences used for qPCR</td>
		</tr>
		<tr>
			<td>Mbp-F:</td>
			<td></td>
			<td></td>
			<td>CTATAAATCGGCTCACAAGG</td>
		</tr>
		<tr>
			<td>Mbp-R:</td>
			<td></td>
			<td></td>
			<td>AGGCGGTTATATTAAGAAGC</td>
		</tr>
		<tr>
			<td>Iba1-F:</td>
			<td></td>
			<td></td>
			<td>ACTGCCAGCCTAAGACAACC</td>
		</tr>
		<tr>
			<td>Iba1-R:</td>
			<td></td>
			<td></td>
			<td>GCTTTTCCTCCCTGCAAATCC</td>
		</tr>
		<tr>
			<td>Mog-F:</td>
			<td></td>
			<td></td>
			<td>GGCTTCTTGGAGGAAGGGAC</td>
		</tr>
		<tr>
			<td>Mog-R:</td>
			<td></td>
			<td></td>
			<td>TGAATTGTCCTGCATAGCTGC</td>
		</tr>
		<tr>
			<td>GAPDH-F</td>
			<td></td>
			<td></td>
			<td>ATGACATCAAGAAGGTGGTG</td>
		</tr>
		<tr>
			<td>GAPDH-R</td>
			<td></td>
			<td></td>
			<td>CATACCAGGAAATGAGCTTG</td>
		</tr>
		<tr>
			<td>Tuj1-F</td>
			<td></td>
			<td></td>
			<td>TTTTCGTCTCTAGCCGCGTG</td>
		</tr>
		<tr>
			<td>Tuj1-R</td>
			<td></td>
			<td></td>
			<td>GATGACCTCCCAGAACTTGGC</td>
		</tr>
		<tr>
			<td>PDGFR&#945;-F</td>
			<td></td>
			<td></td>
			<td>AGAGTTACACGTTTGAGCTGTC</td>
		</tr>
		<tr>
			<td>PDGFR&#945;-R</td>
			<td></td>
			<td></td>
			<td>GTCCCTCCACGGTACTCCT</td>
		</tr>
	</tbody>
</table>

identifying transcription factor olig2 genomic binding sites in acutely purified pdgfr&#945;+ cells by low-cell chromatin immunoprecipitation sequencing analysis

In mammalian cells, gene transcription is regulated in a cell type specific manner by the interactions of transcriptional factors with genomic DNA. Lineage-specific transcription factors are considered to play essential roles in cell specification and differentiation during development. ChIP coupled with high-throughput DNA sequencing (ChIP-seq) is widely used to analyze genome-wide binding sites of transcription factors (or its associated complex) to genomic DNA. However, a large number of cells are required for one standard ChIP reaction, which makes it difficult to study the limited number of isolated primary cells or rare cell populations. In order to understand the regulatory mechanism of oligodendrocyte lineage-specific transcription factor Olig2 in acutely purified mouse OPCs, a detailed method using ChIP-seq to identify the genome-wide binding sites of Olig2 (or Olig2 complex) is shown. First, the protocol explains how to purify the platelet-derived growth factor receptor alpha (PDGFR&#945;) positive OPCs from mouse brains. Next, Olig2 antibody mediated ChIP and library construction are performed. The last part describes the bioinformatic software and procedures used for Olig2 ChIP-seq analysis. In summary, this paper reports a method to analyze the genome-wide bindings of transcriptional factor Olig2 in acutely purified brain OPCs.

Low-cell ChIP-seq was performed and bioinformatic analyses were done to investigate the potential interactions of transcriptional factor Olig2 with genomic DNA in acutely purified brain OPCs. Figure 1 shows a general workflow of both the experimental and the data analysis procedures. In this protocol, postnatal mice brains were dissociated into a single-cell suspension. After tissue dissociation, immunopanning was performed to purify OPCs by using PDGFR&#945;...

Watch this Scientific Journal Video about Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRÎ±+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysi

Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFR&#945;+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysis

Here we present a protocol which is designed to analyze the genome-wide binding of the oligodendrocyte transcription factor 2 (Olig2) in acutely purified brain oligodendrocyte precursor cells (OPCs) by performing low-cell chromatin immunoprecipitation (ChIP), library preparation, high-throughput sequencing and bioinformatic data analysis.

In mammalian cells, gene transcription is regulated in a cell type specific manner by the interactions of transcriptional factors with genomic DNA. ...

The overall goal of this experiment is to analyze the genome-wide binding of oligodendrocyte transcription factor two in acutely purified brain oligodendrocyte precursor cells by performing immunopanning, low-cell chromatin immunoprecipitation, high-throughput sequencing, and bioinformatic data analysis. This method is a powerful tool for studying genome-wide transcriptional regulation and epigenetic mechanisms, which play important roles in cell differentiation and development. The main advantage of this technique is that it is broadly applicable in ChIP-seq of other transcription factors with any cell type of limited numbers, including acutely purified primary cells without proliferation in vitro.Demonstrating the procedure will be Yanan You, a postdoc from my laboratory. She is the co-author of this paper. To select the PDGFR-alpha-positive cells, prepare one plate for immunopanning.Prepare another two plates for endothelial cells and microglia depletion. Then, coat a 10-centimeter Petri dish with 30 microliters of goat anti-rat immunoglobulin. Then, agitate the plate in order to ensure that the entire surface of the plate is evenly covered with the coating solution.Leave the Petri dish overnight at four degrees Celsius. Next, dilute 40 microliters of rat anti-PDGFR-alpha antibody with 12 milliliters of DPBS containing 0.2%bovine serum albumin. Next, wash the immunoglobulin G-coated plate with 10 milliliters of 1X DPBS for three consecutive times.Then, incubate the immunoglobulin G-coated plate with PDGFR-alpha antibody solution at room temperature for four hours. After four hours, carefully add DPBS along the side wall of the plate to wash the rat anti-PDGFR-alpha antibody-coated plate three times. Do not disturb the coated surface of the plate.Next, use 20 milliliters of DPBS with 2.3 micrograms per milliliter of BSL-1 to coat two 15-centimeter Petri plates for two hours. After incubation, carefully add 20 milliliters of DPBS along the side wall of the plate to wash the BSL-1 plate three times. Do not disturb the coated surface.After washing, centrifuge the single-cell suspension at 300 times g for 10 minutes at room temperature. Post-centrifugation, add 15 milliliters of immunopanning buffer to the cell pellet. Then, incubate the single-cell suspensions from two mouse brains sequentially on two BSL-1-coated Petri dishes.Then, leave the plates for 15 minutes at room temperature. Agitate the plate every five minutes during the incubation. Then, gently swirl the plate to collect all the non-adherent cells from the cell suspension.Then, seed the cells on the rat PDGFR-alpha antibody-coated plate. Incubate the plate for 45 minutes at room temperature. At the end of 45 minutes, swirl the plate again.Then, discard the cell suspension. Next, rinse the plate with DPBS for eight times to remove the non-adherent cells. Examine the plate under a microscope.Next, add cell detachment solution on the rat PDGFR-alpha antibody-coated plate. Then, incubate the plate at 37 degrees Celsius for 10 minutes. In the meanwhile, shake the plate to dislodge the adherent cells, and examine it under the microscope.Next, centrifuge the cells at 300 times g at room temperature. After centrifugation, resuspend the cell pellet with one milliliter of OPC cell culture medium. Then, count the cells utilizing the trypan blue exclusion method in a hemocytometer.After counting in a hemocytometer, add 20, 000 purified OPCs in one milliliter of OPC cell culture medium for the ChIP reaction. Then, add 27 microliters of 36.5%of formaldehyde at room temperature for 10 minutes. This will fix the cells.After 10 minutes, add 50 microliters of 2.5 molar glycine on the fixed cells for five minutes at room temperature. Adding the glycine will stop the DNA-protein cross-linking. Then, wash the cross-linked cells with one milliliter of HBSS buffer with protease inhibitor cocktail.Next, centrifuge the cells in a pre-cooled centrifuge machine at 300 times g at four degrees Celsius. After cross-linking the purified OPCs, the cross-linked cells should be washed using ice-cold HBSS solution, and the remaining ChIP steps should be carried out at four degree, otherwise the antibody cannot precipitate the genomic DNA properly. Then, add 25 microliters of complete lysis buffer to the cell pellet, and leave on ice for five minutes.Next, pipette 75 microliters of ice-cold HBSS buffer with protease inhibitor cocktail. Then, shear the chromatin of the cell lysate in a pre-cooled sonication system with five cycles of 30 seconds on and 30 seconds off program. Once the chromatin is sheared, centrifuge the cell lysate at 14, 000 times g for 10 minutes at four degrees Celsius.At the end of the centrifugation, collect the supernatant. Then, dilute 100 microliters of the sheared chromatin with an equal volume of the ice-cold ChIP buffer with protease inhibitor. Next, add one microliter of rabbit anti-Olig2 antibody to 180 microliters of the diluted sheared chromatin.Incubate the tubes on a rotating wheel for 16 hours at four degrees Celsius at 40 revolutions per minute. Next, add 10 microliters of pre-washed protein A-coated beads to the ChIP reaction tube in a cold room. Again, incubate the ChIP tubes at four degrees Celsius for another two hours on the rotating wheel.After two hours, leave the ChIP reaction tube on the magnetic rack for a minute. Then, wash the bead pellet with 100 microliters of four wash buffers each for four minutes on a rotating wheel at four degrees Celsius. Then, add 200 microliters of elution buffer to the bead pellet.Incubate the reaction tube at 65 degrees Celsius for four hours. Once the double-stranded DNA is denatured, dephosphorylate the three-prime end of the single-strand DNA by adding shrimp alkaline phosphatase. Then, add poly-T tail to the single-stranded DNA using terminal deoxynucleotidyl transferase.Next, anneal the DNA poly-dA primer to the single-stranded DNA template. Next, amplify the ChIP-sequence library using forward and reverse primers for indexing. The number of PCR cycles for library preparation depends on the amount of starting DNA.A good library preparation requires accurate quantification of input DNA amount. Too many or too few PCR cycles can influence library concentration, as well as the complexity, leading to PCR artifacts. Use paramagnetic beads to select the fragments ranging from 250 to 500 base pairs from the PCR-amplified ChIP-sequence library.Use a microfluidic chip-capillary electrophoresis device to examine the quality of the selected ChIP-sequence library. To evaluate the purity of the immunopanned OPCs, immunostaining studies are performed. On using the OPC lineage marker NG2 antibody, it shows that the majority of the PDGFR-alpha antibody immunopanned cells are NG2 positive.Next, quantitative PCR is done to verify the enrichment of PDGFR-alpha. The plot obtained shows little expression of Tuj1, a neuronal marker indicating significant enrichment of PDGFR-alpha in comparison to the dissociated brain cells. Similar results are obtained showing little expression for all the other markers, such as GFAP, Mog, and Mbp, indicating enrichment of PDGFR-alpha.Then, the quality of the ChIP-sequence library is analyzed. The electropherogram represents a clear peak for Olig2 transcription factor ranging from 250 to 500 base pairs after size selection of the library PCR product. Here, the histogram shows the tag clonality, to verify the quality control metrics obtained before peak calling.The bar indicates that more than 90%of the reads are mapped to only one genomic location. Then, a strand correlation plot is obtained, which depicts an enriched peak corresponding to the predominant fragment length. In the plot, the red lines represent the read length at 50 base pairs and the fragment length at 130 base pairs, respectively, thereby indicating high-quality data.Once mastered, this technique can be done in three days if it is performed properly. After its development, this technique paved the way for researchers to explore genome-wide DNA binding site of transcription factors and other proteins in primary cells or rare cells. After watching this video, you should have a good understanding of how to purify primary OPCs from mouse brain by immunopanning and how to perform ChIP-seq experiment by using low number of cells.

identifying-transcription-factor-olig2-genomic-binding-sites-acutely

Education

Research

JoVE Core

JoVE Journal

Molecular Biology

Biology

Neuroscience

Genetics

Unit 1

DNA Structure and Function

Gene Expression

SCIENTISTS IN ACTION

Transfection of Mouse Retinal Ganglion Cells by in vivo Electroporation

The targeting and refinement of RGC projections to the midbrain is a popular and powerful model system for studying how precise patterns of neural connectivity form during development. In mice, retinofugal projections are arranged in a topographic manner and form eye-specific layers in the Lateral Geniculate Nucleus (dLGN) of the thalamus and the Superior Colliculus (SC). The development of these precise patterns of retinofugal projections has typically been studied by labeling populations of RGCs with fluorescent dyes and tracers, such as horseradish peroxidase1-4. However, these methods are too coarse to provide insight into developmental changes in individual RGC axonal arbor morphology that are the basis of retinotopic map formation. They also do not allow for the genetic manipulation of RGCs.
Recently, electroporation has become an effective method for providing precise spatial and temporal control for delivery of charged molecules into the retina5-11. Current retinal electroporation protocols do not allow for genetic manipulation and tracing of retinofugal projections of a single or small cluster of RGCs in postnatal mice. It has been argued that postnatal in vivo electroporation is not a viable method for transfecting RGCs since the labeling efficiency is extremely low and hence requires targeting at embryonic ages when RGC progenitors are undergoing differentiation and proliferation6. 
In this video we describe an in vivo electroporation protocol for targeted delivery of genes, shRNA, and fluorescent dextrans to murine RGCs postnatally. This technique provides a cost effective, fast and relatively easy platform for efficient screening of candidate genes involved in several aspects of neural development including axon retraction, branching, lamination, regeneration and synapse formation at various stages of circuit development. In summary we describe here a valuable tool which will provide further insights into the molecular mechanisms underlying sensory map development.

Transfection of Mouse Retinal Ganglion Cells by in vivo Electroporation

We demonstrate an in vivo electroporation protocol for transfecting single or small clusters of retinal ganglion cells (RGCs) and other retinal cell types in postnatal mice over a wide range of ages. The ability to label and genetically manipulate postnatal RGCs in vivo is a powerful tool for developmental studies.

The targeting and refinement of RGC projections to the midbrain is a popular and powerful model system for studying how precise patterns of neural ...

Live-cell Imaging of Sensory Organ Precursor Cells in Intact Drosophila Pupae

Since the discovery of Green Fluorescent Protein (GFP), there has been a revolutionary change in the use of live-cell imaging as a tool for understanding fundamental biological mechanisms. Striking progress has been particularly evident in Drosophila, whose extensive toolkit of mutants and transgenic lines provides a convenient model to study evolutionarily-conserved developmental and cell biological mechanisms. We are interested in understanding the mechanisms that control cell fate specification in the adult peripheral nervous system (PNS) in Drosophila. Bristles that cover the head, thorax, abdomen, legs and wings of the adult fly are individual mechanosensory organs, and have been studied as a model system for understanding mechanisms of Notch-dependent cell fate decisions. Sensory organ precursor (SOP) cells of the microchaetes (or small bristles), are distributed throughout the epithelium of the pupal thorax, and are specified during the first 12 hours after the onset of pupariation. After specification, the SOP cells begin to divide, segregating the cell fate determinant Numb to one daughter cell during mitosis. Numb functions as a cell-autonomous inhibitor of the Notch signaling pathway.
Here, we show a method to follow protein dynamics in SOP cell and its progeny within the intact pupal thorax using a combination of tissue-specific Gal4 drivers and GFP-tagged fusion proteins 1,2.This technique has the advantage over fixed tissue or cultured explants because it allows us to follow the entire development of an organ from specification of the neural precursor to growth and terminal differentiation of the organ. We can therefore directly correlate changes in cell behavior to changes in terminal differentiation. Moreover, we can combine the live imaging technique with mosaic analysis with a repressible cell marker (MARCM) system to assess the dynamics of tagged proteins in mitotic SOPs under mutant or wildtype conditions. Using this technique, we and others have revealed novel insights into regulation of asymmetric cell division and the control of Notch signaling activation in SOP cells (examples include references 1-6,7 ,8).

Live-cell Imaging of Sensory Organ Precursor Cells in Intact Drosophila Pupae

In this video, we describe a method for live cell imaging of asymmetrically dividing sensory organ progenitor cells and epidermal cells in intact Drosophila pupae

Since the discovery of Green Fluorescent Protein (GFP), there has been a revolutionary change in the use of live-cell imaging as a tool for understanding ...

Chromatin Immunoprecipitation from Dorsal Root Ganglia Tissue following Axonal Injury

Axons in the central nervous system (CNS) do not regenerate while those in the peripheral nervous system (PNS) do regenerate 
to a limited extent after injury (Teng et al., 2006). It is recognized that transcriptional programs essential for neurite and axonal outgrowth are 
reactivated upon injury in the PNS (Makwana et al., 2005). However the tools available to analyze neuronal gene regulation in vivo are limited and 
often challenging.
The dorsal root ganglia (DRG) offer an excellent injury model system because both the CNS and PNS are innervated by a 
bifurcated axon originating from the same soma. The ganglia represent a discrete collection of cell bodies where all transcriptional events occur, 
and thus provide a clearly defined region of transcriptional activity that can be easily and reproducibly removed from the animal. Injury of nerve 
fibers in the PNS (e.g. sciatic nerve), where axonal regeneration does occur, should reveal a set of transcriptional programs that are distinct from 
those responding to a similar injury in the CNS, where regeneration does not take place (e.g. spinal cord). Sites for transcription factor binding, 
histone and DNA modification resulting from injury to either PNS or CNS can be characterized using chromatin immunoprecipitation (ChIP). 
Here, we describe a ChIP protocol using fixed mouse DRG tissue following axonal injury. This powerful combination provides a means for characterizing the pro-regeneration chromatin environment necessary for promoting axonal regeneration.

We present a method for chromatin immunoprecipitation from dorsal root ganglia tissue following axonal injury. The approach can be used to identify specific transcription factor binding sites and epigenetic modification of histone and DNA important for the regeneration of injured axons in both the peripheral and central nervous system.

Axons in the central nervous system (CNS) do not regenerate while those in the peripheral nervous system (PNS) do regenerate 
to a limited extent after ...

Detection of Protein Palmitoylation in Cultured Hippocampal Neurons by Immunoprecipitation and Acyl-Biotin Exchange (ABE)

Palmitoylation is a post-translational lipid modification involving the attachment of a 16-carbon saturated fatty acid, palmitate, to cysteine residues of substrate proteins through a labile thioester bond [reviewed in1]. Palmitoylation of a substrate protein increases its hydrophobicity, and typically facilitates its trafficking toward cellular membranes. Recent studies have shown palmitoylation to be one of the most common lipid modifications in neurons1, 2, suggesting that palmitate turnover is an important mechanism by which these cells regulate the targeting and trafficking of proteins. The identification and detection of palmitoylated substrates can therefore better our understanding of protein trafficking in neurons.
Detection of protein palmitoylation in the past has been technically hindered due to the lack of a consensus sequence among substrate proteins, and the reliance on metabolic labeling of palmitoyl-proteins with 3H-palmitate, a time-consuming biochemical assay with low sensitivity. Development of the Acyl-Biotin Exchange (ABE) assay enables more rapid and high sensitivity detection of palmitoylated proteins2-4, and is optimal for measuring the dynamic turnover of palmitate on neuronal proteins. The ABE assay is comprised of three biochemical steps (Figure 1): 1) irreversible blockade of unmodified cysteine thiol groups using N-ethylmaliemide (NEM), 2) specific cleavage and unmasking of the palmitoylated cysteine's thiol group by hydroxylamine (HAM), and 3) selective labeling of the palmitoylated cysteine using a thiol-reactive biotinylation reagent, biotin-BMCC. Purification of the thiol-biotinylated proteins following the ABE steps has differed, depending on the overall goal of the experiment.
Here, we describe a method to purify a palmitoylated protein of interest in primary hippocampal neurons by an initial immunoprecipitation (IP) step using an antibody directed against the protein, followed by the ABE assay and western blotting to directly measure palmitoylation levels of that protein, which is termed the IP-ABE assay. Low-density cultures of embryonic rat hippocampal neurons have been widely used to study the localization, function, and trafficking of neuronal proteins, making them ideally suited for studying neuronal protein palmitoylation using the IP-ABE assay. The IP-ABE assay mainly requires standard IP and western blotting reagents, and is only limited by the availability of antibodies against the target substrate. This assay can easily be adapted for the purification and detection of transfected palmitoylated proteins in heterologous cell cultures, primary neuronal cultures derived from various brain tissues of both mouse and rat, and even primary brain tissue itself.

Detection of Protein Palmitoylation in Cultured Hippocampal Neurons by Immunoprecipitation and Acyl-Biotin Exchange ABE

The reversible addition of palmitate to proteins is an important regulator of intracellular protein trafficking. This is of particular interest in neurons where many synaptic proteins are palmitoylated. We utilize a simple biochemical method to detect palmitoylated proteins in cultured neurons, which can be adapted for multiple cell types and tissues.

Palmitoylation is a post-translational lipid  modification involving the attachment of a 16-carbon saturated fatty acid,  palmitate, to cysteine residues ...

Extracellularly Identifying Motor Neurons for a Muscle Motor Pool in Aplysia californica

In animals with large identified neurons (e.g. mollusks), analysis of motor pools is done using intracellular techniques1,2,3,4. Recently, we developed a technique to extracellularly stimulate and record individual neurons in Aplysia californica5. We now describe a protocol for using this technique to uniquely identify and characterize motor neurons within a motor pool.
This extracellular technique has advantages. First, extracellular electrodes can stimulate and record neurons through the sheath5, so it does not need to be removed. Thus, neurons will be healthier in extracellular experiments than in intracellular ones. Second, if ganglia are rotated by appropriate pinning of the sheath, extracellular electrodes can access neurons on both sides of the ganglion, which makes it easier and more efficient to identify multiple neurons in the same preparation. Third, extracellular electrodes do not need to penetrate cells, and thus can be easily moved back and forth among neurons, causing less damage to them. This is especially useful when one tries to record multiple neurons during repeating motor patterns that may only persist for minutes. Fourth, extracellular electrodes are more flexible than intracellular ones during muscle movements. Intracellular electrodes may pull out and damage neurons during muscle contractions. In contrast, since extracellular electrodes are gently pressed onto the sheath above neurons, they usually stay above the same neuron during muscle contractions, and thus can be used in more intact preparations.
To uniquely identify motor neurons for a motor pool (in particular, the I1/I3 muscle in Aplysia) using extracellular electrodes, one can use features that do not require intracellular measurements as criteria: soma size and location, axonal projection, and muscle innervation4,6,7. For the particular motor pool used to illustrate the technique, we recorded from buccal nerves 2 and 3 to measure axonal projections, and measured the contraction forces of the I1/I3 muscle to determine the pattern of muscle innervation for the individual motor neurons.
We demonstrate the complete process of first identifying motor neurons using muscle innervation, then characterizing their timing during motor patterns, creating a simplified diagnostic method for rapid identification. The simplified and more rapid diagnostic method is superior for more intact preparations, e.g. in the suspended buccal mass preparation8 or in vivo9. This process can also be applied in other motor pools10,11,12 in Aplysia or in other animal systems2,3,13,14.

Extracellularly Identifying Motor Neurons for a Muscle Motor Pool in Aplysia californica

In animals with large identified neurons (e.g. mollusks), analysis of motor pools is done using intracellular techniques1,2,3,4. Recently, we developed a technique to extracellularly stimulate and record individual neurons in Aplysia californica5. We now describe a protocol for using this technique to uniquely identify and characterize motor neurons within a motor pool.

In animals with large  identified neurons (e.g. mollusks), analysis of motor pools is done using  intracellular techniques1,2,3,4. Recently,  we developed ...

Assessment of Dopaminergic Homeostasis in Mice by Use of High-performance Liquid Chromatography Analysis and Synaptosomal Dopamine Uptake

Dopamine (DA) is a modulatory neurotransmitter controlling motor activity, reward processes and cognitive function. Impairment of dopaminergic (DAergic) neurotransmission is strongly associated with several central nervous system-associated diseases such as Parkinson&#39;s disease, attention-deficit-hyperactivity disorder and drug addiction1,2,3,4. Delineating disease mechanisms involving DA imbalance is critically dependent on animal models to mimic aspects of the diseases, and thus protocols that assess specific parts of the DA homeostasis are important to provide novel insights and possible therapeutic targets for these diseases.
Here, we present two useful experimental protocols that when combined provide a functional read-out of the DAergic system in mice. Biochemical and functional parameters on DA homeostasis are obtained through assessment of DA levels and dopamine transporter (DAT) functionality5. When investigating the DA system, the ability to reliably measure endogenous levels of DA from adult brain is essential. Therefore, we present how to perform high-performance liquid chromatography (HPLC) on brain tissue from mice to determine levels of DA. We perform the experiment on tissue from dorsal striatum (dStr) and nucleus accumbens (NAc), but the method is also suitable for other DA-innervated brain areas.
DAT is essential for reuptake of DA into the presynaptic terminal, thereby controlling the temporal and spatial activity of released DA. Knowing the levels and functionality of DAT in the striatum is of major importance when assessing DA homeostasis. Here, we provide a protocol that allows to simultaneously deduce information on surface levels and function using a synaptosomal6 DA uptake assay.
Current methods combined with standard immunoblotting protocols provide the researcher with relevant tools to characterize the DAergic system.

Synaptosomal dopamine uptake and high-performance liquid chromatography analysis represent experimental tools to investigate dopamine homeostasis in mice by assessing the function of the dopamine transporter and levels of dopamine in striatal tissue, respectively. Here we present protocols to measure dopamine tissue content and assess the functionality of the dopamine transporter.

Dopamine (DA) is a modulatory neurotransmitter controlling motor activity, reward processes and cognitive function. Impairment of dopaminergic (DAergic) ...

Isolation and Cultivation of Neural Progenitors Followed by Chromatin-Immunoprecipitation of Histone 3 Lysine 79 Dimethylation Mark

Brain development is a complex process, which is controlled in a temporo-spatial manner by gradients of morphogens and different transcriptional programs. Additionally, epigenetic chromatin modifications, like histone methylation, have an important role for establishing and maintaining specific cell fates within this process. The vast majority of histone methylation occurs on the flexible histone tail, which is accessible to histone modifiers, erasers, and histone reader proteins. In contrast, H3K79 methylation is located in the globular domain of histone 3 and is implicated in different developmental functions. H3K79 methylation is evolutionarily conserved and can be found in a wide range of species from Homo sapiens to Saccharomyces cerevisiae. The modification occurs in different cell populations within organisms, including neural progenitors. The location of H3K79 methylation in the globular domain of histone 3 makes it difficult to assess. Here, we present methods to isolate and culture cortical progenitor cells (CPCs) from embryonic cortical brain tissue (E11.5-E14.5) or cerebellar granular neuron progenitors (CGNPs) from postnatal tissue (P5-P7), and to efficiently immunoprecipitate H3K79me2 for quantitative PCR (qPCR) and genome-wide sequencing.

We present an effective and reproducible method to isolate and culture neural progenitor cells from embryonic and postnatal brain tissue for chromatin immunoprecipitation (ChIP) of histone 3 lysine 79 dimethylation (H3K79me2) - a histone mark located within the globular domain of histone 3.

Brain development is a complex process, which is controlled in a temporo-spatial manner by gradients of morphogens and different transcriptional programs. ...

Isolation of Adult Spinal Cord Nuclei for Massively Parallel Single-nucleus RNA Sequencing

Probing an individual cell&#39;s gene expression enables the identification of cell type and cell state. Single-cell RNA sequencing has emerged as a powerful tool for studying transcriptional profiles of cells, particularly in heterogeneous tissues such as the central nervous system. However, dissociation methods required for single cell sequencing can lead to experimental changes in the gene expression and cell death. Furthermore, these methods are generally restricted to fresh tissue, thus limiting studies on archival and bio-bank material. Single nucleus RNA sequencing (snRNA-Seq) is an appealing alternative for transcriptional studies, given that it accurately identifies cell types, permits the study of tissue that is frozen or difficult to dissociate, and reduces dissociation-induced transcription. Here, we present a high-throughput protocol for rapid isolation of nuclei for downstream snRNA-Seq. This method enables isolation of nuclei from fresh or frozen spinal cord samples and can be combined with two massively parallel droplet encapsulation platforms.

Here, we present a protocol to rapidly isolate high-quality nuclei from the fresh or frozen tissue for downstream massively parallel RNA sequencing. We include detergent-mechanical and hypotonic-mechanical tissue disruption and cell lysis options, both of which can be used for isolation of nuclei.

Probing an individual cell&#39;s gene expression enables the identification of cell type and cell state. Single-cell RNA sequencing has emerged as a ...

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing (DIVA-Seq)

Single-cell RNA sequencing (RNA-seq) is now a widely implemented tool for assaying gene expression. Commercially available single-cell RNA-sequencing platforms process all input cells indiscriminately. Sometimes, fluorescence-activated cell sorting (FACS) is used upstream to isolate a specifically labeled population of interest. A limitation of FACS is the need for high numbers of input cells with significantly labeled fractions, which is impractical for collecting and profiling rare or sparsely labeled neuron populations from the mouse brain. Here, we describe a method for manually collecting sparse fluorescently labeled single neurons from freshly dissociated mouse brain tissue. This process allows for capturing single-labeled neurons with high purity and subsequent integration with an in vitro transcription-based amplification protocol that preserves endogenous transcript ratios. We describe a double linear amplification method that uses unique molecule identifiers (UMIs) to generate individual mRNA counts. Two rounds of amplification results in a high degree of gene detection per single cell.

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing DIVA-Seq

This protocol describes the manual sorting procedure to isolate single fluorescently labeled neurons followed by in vitro transcription-based mRNA amplification for high-depth single-cell RNA sequencing.

Single-cell RNA sequencing (RNA-seq) is now a widely implemented tool for assaying gene expression. Commercially available single-cell RNA-sequencing ...

Identifying Cell Surface Markers of Primary Neural Stem and Progenitor Cells by Metabolic Labeling of Sialoglycan

Neural stem and progenitor cells (NSPCs) are the cellular basis for the complex structures and functions of the brain. They are located in specialized niches in vivo and can be isolated and expanded in vitro, serving as an important resource for cell transplantation to repair brain damage. However, NSPCs are heterogeneous and not clearly defined at the molecular level or purified due to a lack of specific cell surface markers. The protocol presented, which has been previously reported, combines a neural-endothelial co-culture system with a metabolic glycan labeling method to identify the surface sialoglycoproteome of primary NSPCs. The NSPC-endothelial co-culture system allows self-renewal and expansion of primary NSPCs in vitro, generating a sufficient number of NSPCs. Sialoglycans in cultured NSPCs are labeled using an unnatural sialic acid metabolic reporter with bioorthogonal functional groups. By comparing the sialoglycoproteome from self-renewing NSPCs expanded in an endothelial co-culture with differentiating neural culture, we identify a list of membrane proteins that are enriched in NSPCs. In detail, the protocol involves: 1) set-up of an NSPC-endothelial co-culture and NSPC differentiating culture; 2) labeling with azidosugar per-O-acetylated N-azidoacetylmannosamine (Ac4ManNAz); and 3) biotin conjugation to modified sialoglycan for imaging after fixation of neural culture or protein extraction from neural culture for mass spectrometry analysis. Then, the NSPC-enriched surface marker candidates are selected by comparative analysis of mass spectrometry data from both the expanded NSPC and differentiated neural cultures. This protocol is highly sensitive for identifying membrane proteins of low abundance in the starting materials, and it can be applied to marker discovery in other systems with appropriate modifications

Presented here is a protocol that combines an in vitro neural-endothelial co-culture system and metabolic incorporation of sialoglycan with bioorthogonal functional groups to expand primary neural stem and progenitor cells and label their surface sialoglycoproteins for imaging or mass-spectrometry analysis of cell surface markers.

Neural stem and progenitor cells (NSPCs) are the cellular basis for the complex structures and functions of the brain. They are located in specialized ...