Este trabalho foi financiado pelos fundos de inicialização nova faculdade da North Carolina State University para Guozhou Xu.

Nota: É utilizado um sistema de célula/baculovirus inseto com vetores de expressão modificada para expressão de proteínas secretoras de planta e cristalização.
1. modificação de um vetor de expressão de Baculovirus com o peptídeo sinal GP67 para expressão de secreção de proteínas vegetais
<ol><li>Sintetiza um fragmento de DNA contendo uma 5' BglII corte local13, a sequência de sinal de secreção de GP67 e um site multi-clonagem com NotI, BamHI, EcoRI, StuI sobre, SalI, SpeI, XbaI, PstI e XhoI (figura 1A). Nota: Desde que ambos BglII e BamHI digerido DNA resultou no mesmas adesivas, extremidades, o vetor tornado linear pode ligar para o fragmento de DNA digerido enquanto o BglII e BamHI sites na sequência da ligadura recozido serão ser uma mutação para uma sequência que não é cleavable por BglII ou BamHI14.</li>
	<li>Digest 4 µ g de DNA com BglII e XhoI e 4 µ g de um vetor de expressão DNA com BamHI e XhoI14. 10 unidades de cada enzima de restrição se misturam com o DNA em uma concentração de tampão de reação (acetato de potássio de 50 mM, 20 mM Tris-Acetato, acetato de magnésio de 10 mM e 100 µ g/mL BSA, pH 7.9 a 25 ° C) de 1x e incubar a mistura a 37 ° C por 4 h.<ol>
<li>Purifica o fragmento de DNA extirpado e o vetor tornado linear do DNA por um DNA gel de extração kit15.</li>
	</ol>
</li>
	<li>Mix 100 ng de DNA vetor tornado linear com 400 ng de DNA digerido fragmentar-se em uma mistura de reação de ligadura de 10 µ l contendo 1 x amortecedor da reação T4 DNA ligase (50 mM Tris-HCl, 10 mM MgCl2, ATP de 1 mM e 10 mM DTT, pH 7,5 a 25 ° C) e 5 unidades de ADN T4 ligase. Incube a mistura de reação a 16 ° C, durante 16 h.</li>
	<li>Transformar a 5 µ l da mistura de ligadura em 100 µ l de células competentes DH5α, seguindo um protocolo padrão de transformação e selecione as colônias resultantes em um de placa de ágar de ampicilina-LB16. Pegar de 5 a 10 colônias e crescer cada colônia em 2 mL de meio LB contendo 100 ampicilina µ g/mL a 220 rpm e 37 ° C numa incubadora tremendo para 16 h.</li>
	<li>Extrair cada plasmídeo com um DNA miniprep kit17 e confirmar os clones de sequenciação de ADN com uma cartilha AGTATTTTACTGTTTTCGTAACAG.</li>
	<li>PCR-amplificação do gene TDR a. thaliana fragmento codificação resíduos 30-642 de um gene sintético de TDR construir (encaminhar cartilha: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, primer reverso: GC GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). Amplifica o DNA para 30 ciclos em um buffer de reação de polimerase de DNA contendo uma mistura de dNTP 0,5 mM, as primeiras demão de 0,2 µM, 0,1 µ g do modelo de DNA, 0,4 mM MgCl2e 1 unidade de reação da polimerase da ADN.<ol>
<li>Para as etapas do ciclo PCR, defina a desnaturação inicial a 95 ° C por 30 s e depois de 30 ciclos de desnaturação a 95 ° C por 30 s, recozendo a 55 ° C por 30 s e extensão a 72 ° C por 1 min, com uma extensão final a 72 ° C por 5 min.</li>
	</ol>
</li>
	<li>Digeri tanto o fragmento PCR e o vetor modificado com NotI e BamHI enzimas endonucleases de restrição. Ligam o fragmento de gene com o vetor tornado linear. Mix 100 ng de DNA vetor tornado linear com 400 ng de DNA digerido fragmentar-se em uma mistura de reação de ligadura de 10 µ l contendo tampão de reação T4 DNA ligase e 5 unidades de T4 DNA ligase. Incube a mistura de reação a 16 ° C, durante 16 h.</li>
	<li>Transformar a 5 µ l da mistura de ligadura em 100 µ l de células competentes DH5α, seguindo um protocolo padrão de transformação e selecione as colônias resultantes em um de placa de ágar de ampicilina-LB16. Confirme os corretos clones de sequenciação de ADN.</li>
</ol>2. modificação de um vetor de expressão de Baculovirus com o peptídeo sinal Hemolin inseto planta secreção na expressão de proteínas
<ol><li>Sintetiza um fragmento de DNA contendo uma 5' BglII corte local13, a sequência de sinal de secreção de insetos hemolin e um site multi-clonagem com NotI, BamHI, EcoRI, StuI sobre, SalI, SpeI, XbaI, PstI e XhoI (figura 1B).</li>
	<li>Digest 4 µ g de DNA com BglII e XhoI e 4 µ g de um vetor de expressão DNA com BamHI e XhoI14. 10 unidades de cada enzima de restrição se misturam com o DNA em uma concentração de tampão de reação (acetato de potássio de 50 mM, 20 mM Tris-Acetato, acetato de magnésio de 10 mM e 100 µ g/mL BSA, pH 7.9 a 25 ° C) de 1x e incubar a mistura a 37 ° C por 4 h.<ol>
<li>Purifica o fragmento de DNA extirpado e o vetor tornado linear do DNA por um DNA gel de extração kit15.</li>
	</ol>
</li>
	<li>Mix 100 ng de DNA vetor tornado linear com 400 ng de DNA digerido fragmentar-se em uma mistura de reação de ligadura de 10 µ l contendo 1 x amortecedor da reação T4 DNA ligase (50 mM Tris-HCl, 10 mM MgCl2, ATP de 1 mM e 10 mM DTT, pH 7,5 a 25 ° C) e 5 unidades de ADN T4 ligase. Incube a mistura de reação a 16 ° C, durante 16 h.</li>
	<li>Transformar a 5 µ l da mistura de ligadura em 100 µ l de células competentes DH5α e selecione as colônias em uma placa de ágar de ampicilina-LB. Pegar de 5 a 10 colônias e crescer cada colônia em um meio LB de 2 mL contendo 100 µ g/mL de ampicilina a 220 rpm e 37 ° C numa incubadora tremendo para 16 h.</li>
	<li>Extrair o DNA do plasmídeo com um DNA miniprep kit17 e confirmar os clones de sequenciação de ADN com uma cartilha AGTATTTTACTGTTTTCGTAACAG.</li>
	<li>PCR-amplificar a. thaliana pólen Receptor quinase 3 (PRK3) gene fragmento codificação resíduos 20-237 de uma construção de gene PRK3 sintética (encaminhar cartilha: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, primer reverso: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC). Amplifica o DNA para 30 ciclos em um buffer de reação de polimerase de DNA contendo uma mistura de dNTP 0,5 mM, as primeiras demão de 0,2 µM, 0,1 µ g do modelo de DNA, 0,4 mM MgCl2e 1 unidade de reação da polimerase da ADN.<ol>
<li>Para as etapas do ciclo PCR, defina a desnaturação inicial a 95 ° C por 30 s e depois de 30 ciclos de desnaturação a 95 ° C por 30 s, recozendo a 55 ° C por 30 s e extensão a 72 ° C por 30 s dentro de cada ciclo e a extensão final a 72 ° C por 5 min.</li>
	</ol>
</li>
	<li>Digeri tanto o fragmento PCR e o vetor modificado com NotI e BamHI enzimas endonucleases de restrição. Ligam o fragmento de gene com o vetor tornado linear. Mix 100 ng de DNA vetor tornado linear com 400 ng de DNA digerido fragmentar-se em uma mistura de reação de ligadura de 10 µ l contendo tampão de reação T4 DNA ligase e 5 unidades de T4 DNA ligase. Incube a mistura de reação a 16 ° C, durante 16 h.</li>
	<li>Transformar a 5 µ l da mistura de ligadura em 100 µ l de células competentes DH5α, seguindo um protocolo padrão de transformação e selecione as colônias resultantes em um de placa de ágar de ampicilina-LB16. Confirme os corretos clones de sequenciação de ADN.</li>
</ol>3. produção e amplificação de Baculovirus constrói abrigando o Cassette de expressão de proteínas recombinantes
<ol><li>Uso 100 ng do plasmídeo de construção para transformar 40 µ l de células competentes DH10Bac, seguindo o protocolo do baculovirus expressão sistema1. Incube as placas de transformação a 37 ° C por 48 h.</li>
	<li>Pegue duas colónias brancas de cada prato de transformação, inocular cada colônia em 2 mL de meio LB contendo 50 µ g/mL canamicina, gentamicina 7 de µ g/mL e 10 tetraciclina µ g/mL. Siga o protocolo do baculovirus expressão sistema1 para extrair e verificar a bacmid DNA. Alíquota cada DNA em dois tubos com 20 µ l cada e armazenar os tubos a-20 ° C. Nota: As etapas a seguir exigem uma operação asséptica.</li>
	<li>Cresce uma monocamada de células Sf9 em meios de cultura com 10% de soro fetal bovino (FBS) e 100 µ g/mL (ou 100 teórica) antibióticos penicilina-estreptomicina a 27 ° C a confluência de 80% em uma placa de 6. Estime a porcentagem de confluência com base na porcentagem de área coberta na placa de cultura de tecidos.</li>
	<li>Prepare as seguintes soluções em dois tubos de centrífuga de 1,5 mL estéril.<ol>
<li>Tubo 1: Para cada transfeccao, dilua 20 µ l de bacmid DNA em 100 µ l de unsupplemented meio de cultura celular Sf9 sem antibióticos. Misture delicadamente a diluição por agredir o lado do tubo.</li>
		<li>Tubo 2: Para cada transfeccao, dilua 8 µ l de reagente de Transfeccao de lipídios em 100 µ l de unsupplemented meio de cultura celular Sf9 sem antibióticos. Homogeneiza a diluição pipetando para cima e para baixo para x 6.</li>
	</ol>
</li>
	<li>Combinar as duas soluções, misture-os delicadamente pipetando lentamente acima e para baixo para x 3 e incube-os por 20-40 min à temperatura ambiente.</li>
	<li>Lavagem de cada poço da monocamada Sf9 células 2x com 3 mL de meio de cultura de células Sf9 unsupplemented sem antibióticos. Para cada transfeccao, adicione 0,8 mL de meio de cultura de células Sf9 unsupplemented sem antibióticos a cada tubo contendo a mistura de lipídios-DNA. Misture o conteúdo dos tubos suavemente pipetando lentamente acima e para baixo para x 3. Aspirar a mídia de lavagem das placas e as amostras com a mistura de Transfeccao de sobreposição.</li>
	<li>Após a adição da mistura de transfeccao, incubar a placa transfectada para 5h a 27 ° C. Substitua os meios de comunicação de transfeccao completa Sf9 célula meio de cultura contendo 10% FBS e 100 µ g/mL (ou 100 teórica) antibióticos penicilina-estreptomicina. Incube a placa transfectada a 27 ° C, durante 4 d.</li>
	<li>Colheita e amplificar o baculovirus recombinante.<ol>
<li>Recolha o sobrenadante da placa infectado em um tubo cônico de 15 mL estéril após 4D de incubação. Gire o sobrenadante a 1010 x g por 5 min remover os detritos de células. Descartar a pelota e decante o sobrenadante para um tubo limpo e armazená-lo em 4 ° C por até 1 ano. Nota: Este é o vírus de P0. Pode ser aliquotadas e armazenado a-80 ° C por um longo período de tempo.</li>
		<li>Para amplificar cada vírus recombinantes, cresce uma monocamada de células Sf9 em uma placa de 150 mm a confluência de 80%. Aspire a mídia do prato, adicione 2 mL do vírus P0 para o aderente de células para a placa e incubar a placa por 1h em uma incubadora de 27 ° C. Agitar a placa cada 15 min para misturar o meio com as células.<ol>
<li>Adicionar 25 mL de mídia da Grace completo contendo 10% FBS e 100 µ g/mL (ou 100 teórica) antibióticos penicilina-estreptomicina. Incube a placa para 3-d em uma incubadora de 27 ° C para obter o vírus de passagem P1.</li>
		</ol>
</li>
		<li>Recolha o sobrenadante da placa em um tubo cônico estéril de 50 mL e girar a 1010 x g por 5 min remover os detritos de células infectada. Decante o sobrenadante para um tubo limpo e armazená-lo em 4 ° C por até 1 ano. Nota: O vírus P1 pode ser aliquotadas e armazenado a-80 ° C por um longo período de tempo.</li>
		<li>Para amplificar o vírus de P1 para P2 passagem, crescer uma monocamada de células Sf9 em uma placa de 150 mm a confluência de 90%, aspirar a mídia da placa, adicione 2 mL do vírus P1 para a placa e incubá-lo por 1h em uma incubadora de 27 ° C.</li>
		<li>Repita as etapas 3.8.2 e 3.8.3 para obter as passagens P2 e P3 dos vírus. Não guarde o P3 vírus por mais de 2 meses.</li>
	</ol>
</li>
</ol>4. proteína expressão, purificação com NiNTA e cristalização
<ol><li>Cultura 1 L de células de inseto Hi5 em meios de cultura com 100 µ g/mL (ou 100 teórica) antibióticos penicilina-estreptomicina para uma densidade de 2 x 106 a 100 rpm em um shaker de incubadora de 27 ° C. Gire para baixo as células a 570 x g por 5 min, decante o sobrenadante, Ressuspender as células em 20 mL do vírus P3 recentemente produzido e mantê-lo em temperatura ambiente por 1 h. Agite suavemente o frasco de rotação para Ressuspender as células 1 x a cada 15 min.</li>
	<li>Transferir as células para 1 L de antibióticos penicilina-estreptomicina de meios de cultura com 100 µ g/mL (ou 100 teórica), cultura de células em 100 rpm em um shaker de incubadora de 27 ° C por 72 h. Spin para baixo as células a 1.010 x g por 5 min e recolher o sobrenadante.</li>
	<li>Indicador de pH de uso tiras para ajustar o pH do líquido sobrenadante para 8.0 adicionando ou 0.1 M HCl ou NaOH 0.1 de M e adicionar tampão de ligação em uma concentração final, contendo tampão Tris de 20mm a pH 8.0, 100 mM de NaCl e imidazol de 5 mM. Adicione uma certa quantidade de resina NiNTA (10-40 mL) com base no rendimento estimado da proteína recombinante com sua tag expressa.<ol>
<li>Misturar a solução em uma agitação magnética com baixa velocidade a 4 ° C, durante 1 h. lavagem a resina e eluir a proteína ligada seguindo o padrão de protocolo de purificação NiNTA18.</li>
	</ol>
</li>
	<li>Submeta a proteína purificada a troca iônica e cromatografia de filtração, bem como outros métodos de purificação de proteínas, para produzir uma amostra homogênea do gel. Nota: Para o ectodomínio TDR, 20 mM Tris, pH 8, 100 mM de NaCl foram usadas como amortecedor de gel filtração. Para o ectodomínio PRK3, bis-Tris de 20 mM, pH 6, 100 mM de NaCl foram usados como o amortecedor de filtração de gel preferencial.</li>
</ol>

<ol>
	<li>Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+using+the+baculovirus-insect+cell+expression+system.">Protein production using the baculovirus-insect cell expression system.</a> Biotechnology Progress. 30, 1-18 (2014).</li><li>Khan, S., Ng, M. L., Tan, Y. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+the+severe+acute+respiratory+syndrome+coronavirus+3a+protein+and+the+assembly+of+coronavirus-like+particles+in+the+baculovirus+expression+system.">Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system.</a> Methods in Molecular Biology. 379, 35-50 (2007).</li><li>Possee, R. D., King, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+Transfer+Vectors.">Baculovirus Transfer Vectors.</a> Methods in Molecular Biology. 1350, 51-71 (2016).</li><li>Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+establishment+of+two+cell+lines+from+the+insect+Spodoptera+frugiperda+(Lepidoptera;+Noctuidae).">The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae).</a> In Vitro. 13, 213-217 (1977).</li><li>Hink, W. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Established+insect+cell+line+from+the+cabbage+looper,+Trichoplusia+ni.">Established insect cell line from the cabbage looper, Trichoplusia ni.</a> Nature. 226, 466-467 (1970).</li><li>Davis, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+recombinant+protein+production+of+eight+insect+cell+lines.">Comparative recombinant protein production of eight insect cell lines.</a> In Vitro Cellular &amp; Development Biology - Animal. 29A, 388-390 (1993).</li><li>Wickham, T. J., Nemerow, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+growth+methods+and+recombinant+protein+production+in+BTI-Tn-5B1-4+insect+cells+using+the+baculovirus+expression+system.">Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system.</a> Biotechnology Progress. 9, 25-30 (1993).</li><li>Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+expression+of+alkaline+phosphatase+as+a+reporter+gene+for+evaluation+of+production,+glycosylation+and+secretion.">Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion.</a> Nature Biotechnology. 10, 1148-1150 (1992).</li><li>Murphy, C. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+expression,+secretion,+and+large-scale+purification+of+recombinant+HIV-1+gp120+in+insect+cell+using+the+baculovirus+egt+and+p67+signal+peptides.">Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides.</a> Protein Expression and Purification. 4, 349-357 (1993).</li><li>Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemolin:+an+insect-immune+protein+belonging+to+the+immunoglobulin+superfamily.">Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily.</a> Science. 250, 1729-1732 (1990).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+CLE+peptide+perception+by+plant+receptors+implicated+from+structural+and+functional+analyses+of+TDIF-TDR+interactions.">Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions.</a> PLoS One. 12, e0175317 (2017).</li><li>Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Extracellular+Domain+of+Pollen+Receptor+Kinase+3+is+structurally+similar+to+the+SERK+family+of+co-receptors.">The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors.</a> Scientific Reports. 8, 2796 (2018).</li><li>Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Total+synthesis+of+a+gene.">Total synthesis of a gene.</a> Science. 203, 614-625 (1979).</li><li>Bahl, C. P., Marians, K. J., Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+for+inserting+specific+DNA+sequences+into+cloning+vehicles.">A general method for inserting specific DNA sequences into cloning vehicles.</a> Gene. 1, 81-92 (1976).</li><li>Xu, W., Zhang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Characterization+of+Vaccine-Derived+Polioviruses,+Relevance+for+the+Global+Polio+Eradication+Initiative.">Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative.</a> Methods in Molecular Biology. 1387, 213-226 (2016).</li><li>Hanahan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+transformation+of+Escherichia+coli+with+plasmids.">Studies on transformation of Escherichia coli with plasmids.</a> Journal of Molecular Biology. 166, 557-580 (1983).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Reddy, B. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+and+purification+of+the+alpha+subunit+of+the+epithelial+sodium+channel,+ENaC.">Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC.</a> Protein Expression and Purification. 117, 67-75 (2016).</li><li>Harris, T. J., Emtage, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+heterologous+genes+in+E.+coli.">Expression of heterologous genes in E. coli.</a> Microbiological Sciences. 3, 28-31 (1986).</li><li>Kaur, J., Kumar, A., Kaur, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+optimization+of+heterologous+protein+expression+in+E.+coli:+Roadblocks+and+reinforcements.">Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements.</a> International Journal of BIological Macromolecules. 106, 803-822 (2018).</li><li>Guo, Y., Yang, F., Tang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+of+Protein+Secretion+in+Yeast+and+Animal+Cells.">An Overview of Protein Secretion in Yeast and Animal Cells.</a> Methods in Molecular Biology. 1662, 1-17 (2017).</li><li>Blight, M. A., Chervaux, C., Holland, I. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+secretion+pathway+in+Escherichia+coli.">Protein secretion pathway in Escherichia coli.</a> Current Opinion in Biotechnology. 5, 468-474 (1994).</li><li>Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+protein+secretion+in+yeast:+strategies+and+impact+on+protein+production.">Engineering of protein secretion in yeast: strategies and impact on protein production.</a> Applied Microbiology and Biotechnology. 86, 403-417 (2010).</li><li>Wormald, M. R., Dwek, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycoproteins:+glycan+presentation+and+protein-fold+stability.">Glycoproteins: glycan presentation and protein-fold stability.</a> Structure. 7, R155-R160 (1999).</li><li>Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+and+History+of+Glyco-Engineering+in+Insect+Expression+Systems.">An Overview and History of Glyco-Engineering in Insect Expression Systems.</a> Methods in Molecular Biology. 1321, 131-152 (2015).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-ray+crystallographic+studies+of+the+extracellular+domain+of+the+first+plant+ATP+receptor,+DORN1,+and+the+orthologous+protein+from+Camelina+sativa.">X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa.</a> Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).</li><li>Aricescu, A. R., Owens, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+recombinant+glycoproteins+in+mammalian+cells:+towards+an+integrative+approach+to+structural+biology.">Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology.</a> Current Opinion in Structural Biology. 23, 345-356 (2013).</li><li>Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scale-up+of+hydrophobin-assisted+recombinant+protein+production+in+tobacco+BY-2+suspension+cells.">Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells.</a> Plant Biotechnology Journal. 12, 402-410 (2014).</li><li>Dohi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+virus-mediated+expression+of+a+foreign+protein+in+suspension-cultured+plant+cells.">Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells.</a> Archives of Virology. 151, 1075-1084 (2006).</li></ol>

Os autores não têm nada para divulgar.

Dada a diversidade no tamanho e na estabilidade dos milhares de proteínas presentes nos sistemas biológicos, é frequentemente empírica para uma pesquisa laboratorial para decidir qual sistema de expressão heteróloga tem de ser escolhida para a expressão de uma proteína específica. O sistema de expressão de Escherichia coli é frequentemente a primeira escolha para a expressão da proteína devido ao curto ciclo de vida das bactérias, baixo custos dos meios de cultura e relativa facilidade para escalar...

É imperativo para um laboratório de pesquisa ser capaz de produzir grandes quantidades de proteínas recombinantes homogêneas para Caracterização bioquímica e biofísica, especialmente para estudos cristalográficos de raio-x. Existem muitos sistemas de expressão heteróloga bem estabelecidas, tais como Escherichia coli, levedura, células de inseto, células de mamíferos, células vegetais, etc. , entre eles, o sistema de expressão de células de inseto mediada por baculovirus é um dos mais comumente usado técnicas para produzir grandes quantidades de estruturalmente dobrado de grande porte eukaryotic proteínas recombinantes para cristalização de proteínas1.
Os vetores de expressão do sistema de expressão de baculovirus são projetados para conter uma forte polyhedrin ou promotor P10 para produzir um alto rendimento de proteínas recombinantes intracelular2,3. Para tornar um baculovirus recombinante, o gene de interesse foi clonado em um inseto vetor contendo o locus polyhedrin (polh) do genoma de multi-nucleopolyhedroviral Autographa californica . A construção resultante é então sequenciada e seu quadro correto de leitura aberta (ORF) é verificado. A construção correta é então introduzida célula hospedeira de insetos através do processo do transfection. O gene de interesse é inserido no genoma viral por recombinação homóloga. Este evento resulta na produção do genoma viral recombinante, que é então replicada para produzir recombinante brotou de partículas do vírus1.
As células de insetos que são mais comumente usadas no sistema de expressão são Sf9 e alta cinco células (Hi5). Sf9 células são uma clonal isolada de Sf21, derivado das células dos ovários pupal de Spodoptera frugiperda, e Hi5 células são uma clonal isolada derivada o parental Trichoplusia ni ovário célula linha TN-3684,5. Co transfections, amplificação de vírus e ensaios de placa são realizados em células de Sf9, enquanto células Hi5 são normalmente Selecionadodas para produzir maiores quantidades de proteínas recombinantes6. É interessante notar que as células do Hi5 não são adequadas para a geração e amplificação de progênies de vírus por causa de sua tendência a produzir vírus mutantes. Tradicionalmente, uma faixa de temperatura de 25-30 ° C é considerada bom para o cultivo de células de inseto. No entanto, foi relatado que o 27-28 ° C é a temperatura ideal para o inseto celular crescimento e infecção7,8.
A introdução de uma sequência de forte sinal precede o gene é necessária para a alta expressão das proteínas secretadas. A sequência de sinal guiariam eficientemente a proteína recombinante traduzida no retículo endoplasmático por secreção de proteína e modificações borne-translational necessárias para dobramento adequado e de estabilização3. Sequências de peptídeo sinal, tais como os baculovirus envelop proteína GP64/67, Melitina abelha e outros, foram escolhidas para facilitar a expressão de proteínas recombinantes secretoras no expressão mediada por baculovirus sistemas3. A introdução do peptídeo sinal de GP67 foi mostrada para melhorar o rendimento de expressão de uma proteína recombinante secretado, em comparação com usando o peptídeo sinal intrínseco do gene alvo9. Hemolin é uma proteína de hemolinfa da mariposa gigante de seda Hyalophora cecropia, induzida após infecção de bactérias10. Devido o nível relativamente elevado de expressão induzida, a sequência do peptídeo sinal do gene pode ser usada para mediar a expressão de secreção de proteínas recombinantes em sistema de célula de baculovirus-inseto.
O . thaliana Tracheary elemento de diferenciação Inhibitory Factor Receptor (TDR) e pólen Receptor quinase 3 (PRK3), ambos pertencem à família de repetição como Receptor quinase (LRR-RLK) planta rica em leucina de proteínas11,12 . Para estudar a estrutura e a função desta família de receptores proteínas vegetais, bem como para facilitar a caracterização estrutural e bioquímica de outras proteínas de planta secretada, foi modificado o sistema de expressão de células de baculovirus-inseto para Melhore o rendimento de produção e qualidade de proteína. Os domínios extracelulares de TDR e PRK3 com êxito foram expressas usando dois vetores de expressão modificados no sistema de expressão de célula de baculovirus-inseto. Cristalizaram-se ambos os domínios extracelulares de proteínas TDR e PRK3. Este artigo relata a expressão e purificação de grandes quantidades de proteínas recombinantes planta secretada com baculovirus modificados dois vetores da expressão, incorporando um GP67 ou uma sequência de sinal de hemolin entre o promotor e clonagem múltiplos sites.

<table>
	<tbody>
		<tr>
			<td>Incubator shaker</td>
			<td>VWR</td>
			<td>Model Excella E25</td>
			<td>27 oC</td>
		</tr>
		<tr>
			<td>Incubator</td>
			<td>VWR</td>
			<td>Model 2005</td>
			<td>27 oC</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>BECKMAN</td>
			<td>Model J-6</td>
			<td>with a swing bucket rotor</td>
		</tr>
		<tr>
			<td>Herculase II Fusion DNA Polymerase</td>
			<td>Agilent</td>
			<td>600677-51</td>
			<td>For PCR amplification of DNA</td>
		</tr>
		<tr>
			<td>Thermal Cycler</td>
			<td>BIO-RAD</td>
			<td>Model C1000 Touch</td>
			<td>For PCR amplification of DNA</td>
		</tr>
		<tr>
			<td>Incubator shaker</td>
			<td>New Brunswick Scientific</td>
			<td>Model I 24</td>
			<td>For growing baceria culture</td>
		</tr>
		<tr>
			<td>Customer DNA synthesis</td>
			<td>GENSCRIPT</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BamHI (HF)</td>
			<td>New England Biolabs</td>
			<td>R3136S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>BglII</td>
			<td>New England Biolabs</td>
			<td>R0144S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>NotI (HF)</td>
			<td>New England Biolabs</td>
			<td>R3189S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>XhoI</td>
			<td>New England Biolabs</td>
			<td>R0146S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>New England Biolabs</td>
			<td>M0202T</td>
			<td>DNA ligation</td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction Kit</td>
			<td>Qiagen</td>
			<td>28704</td>
			<td>DNA purification from Agorase gel</td>
		</tr>
		<tr>
			<td>QIAprep Spin Miniprep Kit</td>
			<td>Qiagen</td>
			<td>27104</td>
			<td>Plasmid DNA purification from bacteria culture</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Thermo Fisher Scientific</td>
			<td>15510-019</td>
			<td>For DNA gel electropherosis</td>
		</tr>
		<tr>
			<td>MAX Efficiency DH5&#945; competen cell</td>
			<td>Invitrogen</td>
			<td>18-258-012</td>
			<td>For transformation of DNA ligation mixture</td>
		</tr>
		<tr>
			<td>Lennox L LB Broth</td>
			<td>Research Product International Corp.</td>
			<td>L24066-5000.0</td>
			<td>For making bacteria culture</td>
		</tr>
		<tr>
			<td>Ampicillin sodium salt</td>
			<td>Thermo Fisher Scientific</td>
			<td>11593-019</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Kanamycin Sulfate</td>
			<td>Thermo Fisher Scientific</td>
			<td>15160-054</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Tetracycline</td>
			<td>Thermo Fisher Scientific</td>
			<td>64-75-5</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Gentamicin</td>
			<td>Thermo Fisher Scientific</td>
			<td>15710-064</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>MAX Efficiency DH10Bac competent cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>10361-012</td>
			<td>For making bacmid DNA</td>
		</tr>
		<tr>
			<td>S.O.C. Medium</td>
			<td>Thermo Fisher Scientific</td>
			<td>15544-034</td>
			<td>For DNA transformation</td>
		</tr>
		<tr>
			<td>CellFECTIN II Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>10362-101</td>
			<td>Insect cell transfection reagent</td>
		</tr>
		<tr>
			<td>Bac-to-Bac Expression System</td>
			<td>Thermo Fisher Scientific</td>
			<td>10359-016</td>
			<td>Baculovirus-insect cells expression kit</td>
		</tr>
		<tr>
			<td>Bluo-gal</td>
			<td>Thermo Fisher Scientific</td>
			<td>15519-028</td>
			<td>For isolation of recominant Bacmid DNA</td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>Thermo Fisher Scientific</td>
			<td>15529-019</td>
			<td>For isolation of recominant Bacmid DNA</td>
		</tr>
		<tr>
			<td>pFastBac1</td>
			<td>Thermo Fisher Scientific</td>
			<td>10360014</td>
			<td>Baculorirus expression vector</td>
		</tr>
		<tr>
			<td>Sf9 cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>11496015</td>
			<td>Sf9 monolayer cells</td>
		</tr>
		<tr>
			<td>Hi5 cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>B85502</td>
			<td>High Five insect cells</td>
		</tr>
		<tr>
			<td>Grace&#8217;s insect medium, unsupplemented</td>
			<td>Thermo Fisher Scientific</td>
			<td>11595030</td>
			<td>Sf9 cell transfection minimum medium</td>
		</tr>
		<tr>
			<td>Grace&#8217;s insect medium, supplemented</td>
			<td>Thermo Fisher Scientific</td>
			<td>11605102</td>
			<td>Sf9 monolayer cell culture complete medium</td>
		</tr>
		<tr>
			<td>Sf-900 II SFM</td>
			<td>Thermo Fisher Scientific</td>
			<td>10902104</td>
			<td>Sf9 suspension cell culture medium without FBS</td>
		</tr>
		<tr>
			<td>Express Five SFM</td>
			<td>Thermo Fisher Scientific</td>
			<td>10486025</td>
			<td>Hi5 cell culture medium</td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>15140122</td>
			<td>100 ml (10,000 I.U./ml)</td>
		</tr>
		<tr>
			<td>L-Glutamine (200 mM)&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>25030081</td>
			<td>100 ml</td>
		</tr>
		<tr>
			<td>FBS Certified</td>
			<td>Thermo Fisher Scientific</td>
			<td>16000-044</td>
			<td>500 ml</td>
		</tr>
		<tr>
			<td>6-well plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>08-772-1B</td>
			<td>Flat-bottom</td>
		</tr>
		<tr>
			<td>150 mm plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>353025</td>
			<td>100/case</td>
		</tr>
		<tr>
			<td>1.5 ml Microcentrifuge Tubes</td>
			<td>USA Scientific</td>
			<td>1415-2500</td>
			<td>500 tubes/bag</td>
		</tr>
		<tr>
			<td>15 ml conical screw cap centrifuge tubes</td>
			<td>USA Scientific</td>
			<td>1475-0511</td>
			<td>25 tubes/bag</td>
		</tr>
		<tr>
			<td>50 ml conical screw cap centrifuge tubes</td>
			<td>USA Scientific</td>
			<td>1500-1211</td>
			<td>25 tubes/bag</td>
		</tr>
		<tr>
			<td>Ni-NTA Superflow</td>
			<td>Qiagen</td>
			<td>30430</td>
			<td>NiNTA resin</td>
		</tr>
		<tr>
			<td>pH-indicator strips</td>
			<td>EMD Millipore Corporation</td>
			<td>1.09535.0001</td>
			<td>pH 0 - 14</td>
		</tr>
	</tbody>
</table>

modifying baculovirus expression vectors to produce secreted plant proteins in insect cells

Tem sido um desafio para cientistas de expressar proteínas recombinantes de eucariotas secretoras para estudos bioquímicos e estruturais. O sistema de expressão de células de inseto mediada por baculovirus é um dos sistemas utilizados para expressar proteínas recombinantes de secretoras eucarióticas, com algumas modificações borne-translational. As proteínas secretoras precisam ser roteadas através de vias secretoras para proteína glycosylation, formação de ligações de bissulfeto e outras modificações borne-translational. Para melhorar a expressão célula inseto existentes de proteínas vegetais secretora, um vetor de expressão de baculovirus é modificado pela adição de qualquer um GP67 ou uma sequência de peptídeo sinal hemolin entre o promotor e a clonagem de vários sites. Este sistema de vetor modificado recentemente projetado com sucesso produzido um alto rendimento de proteínas do receptor solúvel recombinante secretada planta de Arabidopsis thaliana. Duas das proteínas expressas da planta, os domínios extracelulares de receptores de membrana plasmática de Arabidopsis TDR e PRK3, foram cristalizada para estudos cristalográficos de raio-x. O sistema do vetor modificado é uma ferramenta melhorada que potencialmente pode ser usada para a expressão de proteínas recombinantes de secretoras no reino animal também.

Como mostrado na Figura 1, dois vetores de expressão de baculovirus pFastBac1 modificados foram usados para expressar as proteínas secretadas com o GP67 ou a sequência de sinal hemolin para substituir a sequência de sinal intrínseco do gene do alvo. O GP67 viral e os genes de insetos hemolin têm demonstrados que têm níveis de expressão de alta secreção nas células. Proteínas de fusão com qualquer destas duas sequências de sinal deverão ter mel...

Watch this Scientific Journal Video about Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells at JoVE.com

Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Modificar vetores de expressão de Baculovirus para produzir secretado proteínas vegetais em células de inseto

Aqui, apresentamos os protocolos para utilizando o inseto sistema expressão da proteína celular e baculovirus para produzir grandes quantidades de proteínas vegetais secretada por cristalização de proteínas. Um vetor de expressão de baculovirus foi modificado com GP67 ou inseto hemolin peptídeo sinal planta secreção na expressão de proteínas nas células de inseto.

It has been a challenge for scientists to express recombinant secretory eukaryotic proteins for structural and biochemical studies. The ...

modifying-baculovirus-expression-vectors-to-produce-secreted-plant

Research

JoVE Journal

Biochemistry

11.4K visualizações.  North Carolina State University. Aqui, apresentamos os protocolos para utilizando o inseto sistema expressão da proteína celular e baculovirus para produzir grandes quantidades de proteínas vegetais secretada por cristalização de proteínas. Um vetor de expressão de baculovirus foi modificado com GP67 ou inseto hemolin peptídeo sinal planta secreção na expressão de proteínas nas células de inseto.

Vídeo: Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug used to treat depression and anxiety by binding to the serotonin transporter with high-affinity, blocking serotonin reuptake. Here we report an efficient procedure and a set of tools to stabilize, express, purify, and crystallize serotonin transporter-antibody complexes bound to S-citalopram and other antidepressants. Mutations which stabilize the serotonin transporter were identified using an S-citalopram binding assay. Serotonin transporter expressed in baculovirus-transduced HEK293S GnTI- cells, was reconstituted into proteoliposomes and used to raise high-affinity antibodies. We have developed a strategy to discover antibodies that are useful for structural studies. A straightforward approach for the expression of antibody fragments in Sf9 cells has also been established. Transporter-antibody complexes purified using this procedure are well-behaved and readily crystallize, producing complexes with S-citalopram that diffract X-rays to 3-4 &#197; resolution. The strategies developed here can be utilized to determine the structure of other challenging membrane proteins.

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

This manuscript describes how to screen for thermostabilizing mutations, purify the human serotonin transporter, generate high affinity antibodies, and crystallize the serotonin transporter-antibody complex bound to the antidepressant drug S-citalopram. This protocol can be adapted to the study of other challenging membrane transporters, receptors, and channels.

Termoestabilização, expressão, purificação e cristalização do transportador de serotonina humano Bound to<em&gt; S</em&gt; -citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug ...

Bioquímica

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from the oxidation of reduced compounds such as nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FADH2). The complete annotation of the Arabidopsis thaliana genome has established it as the most widely used plant model system, and thus the need to purify mitochondria from a variety of organs (leaf, root, or flower) is necessary to fully utilize the tools that are now available for Arabidopsis to study mitochondrial biology. Mitochondria are isolated by homogenization of the tissue using a variety of approaches, followed by a series of differential centrifugation steps producing a crude mitochondrial pellet that is further purified using continuous colloidal density gradient centrifugation. The colloidal density material is subsequently removed by multiple centrifugation steps. Starting from 100 g of fresh leaf tissue, 2 - 3 mg of mitochondria can be routinely obtained. Respiratory experiments on these mitochondria display typical rates of 100 - 250 nmol O2 min-1 mg total mitochondrial protein-1 (NADH-dependent rate) with the ability to use various substrates and inhibitors to determine which substrates are being oxidized and the capacity of the alternative and cytochrome terminal oxidases. This protocol describes an isolation method of mitochondria from Arabidopsis thaliana leaves using continuous colloidal density gradients and an efficient respiratory measurements of purified plant mitochondria.

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

As mitochondria are only a small percentage of the plant cell, they need to be purified for a range of studies. Mitochondria can be isolated from a variety of plant organs by homogenization, followed by differential and density gradient centrifugation to obtain a highly purified mitochondrial fraction.

Isolamento e medições respiratória de mitocôndrias de Arabidopsis thaliana

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from ...

Caffeine Extraction, Enzymatic Activity and Gene Expression of Caffeine Synthase from Plant Cell Suspensions

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a chemical defense because it has antimicrobial activity and is considered a natural insecticide. Caffeine can also produce negative allelopathic effects that prevent the growth of surrounding plants. In addition, people around the world consume caffeine for its analgesic and stimulatory effects. Due to interest in the technological applications of caffeine, research on the biosynthetic pathway of this compound has grown. These studies have primarily focused on understanding the biochemical and molecular mechanisms that regulate the biosynthesis of caffeine. In vitro tissue culture has become a useful system for studying this biosynthetic pathway. This article will describe a step-by-step protocol for the quantification of caffeine and for measuring the transcript levels of the gene (CCS1) encoding caffeine synthase (CS) in cell suspensions of C. arabica L. as well as its activity.

This protocol describes an efficient methodology for the extraction and quantification of caffeine in cell suspensions of C. arabica L. and an experimental process for evaluating the enzymatic activity of caffeine synthase with the expression level of the gene that encodes this enzyme.

Extração de cafeína, atividade enzimática e expressão gênica de cafeína sintase de suspensões celulares de planta

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a ...

Dissipative Microgravimetry to Study the Binding Dynamics of the Phospholipid Binding Protein Annexin A2 to Solid-supported Lipid Bilayers Using a Quartz Resonator

The dissipative quartz crystal microbalance technique is a simple and label-free approach to measure simultaneously the mass uptake and viscoelastic properties of the absorbed/immobilized mass on sensor surfaces, allowing the measurements of the interaction of proteins with solid-supported surfaces, such as lipid bilayers, in real-time and with a high sensitivity. Annexins are a highly conserved group of phospholipid-binding proteins that interact reversibly with the negatively charged headgroups via the coordination of calcium ions. Here, we describe a protocol that was employed to quantitatively analyze the binding of annexin A2 (AnxA2) to planar lipid bilayers prepared on the surface of a quartz sensor. This protocol is optimized to obtain robust and reproducible data and includes a detailed step-by-step description. The method can be applied to other membrane-binding proteins and bilayer compositions.

Here, we present an experimental protocol that can be employed to determine the binding affinities and mode of interaction of label-free phospholipid-binding protein annexin A2 with immobilized solid-supported bilayers (SLB) by simultaneously measuring the mass uptake and the viscoelastic properties of the protein annexin A2.

Microgravimetry dissipativo para estudar a dinâmica da vinculação do fosfolipídeo proteína anexina A2 para Bilayers do Lipid com suporte sólido usando um ressonador de quartzo

The dissipative quartz crystal microbalance technique is a simple and label-free approach to measure simultaneously the mass uptake and viscoelastic ...

How to Quantify the Fraction of Photoactivated Fluorescent Proteins in Bulk and in Live Cells

Photoactivatable and -convertible fluorescent proteins (PA-FPs) have been used in fluorescence live-cell microscopy for analyzing the dynamics of cells and protein ensembles. Thus far, no method has been available to quantify in bulk and in live cells how many of the PA-FPs expressed are photoactivated to fluoresce.
Here, we present a protocol involving internal rulers, i.e., genetically coupled spectrally distinct (photoactivatable) fluorescent proteins, to ratiometrically quantify the fraction of all PA-FPs expressed in a cell that are switched on to be fluorescent. Using this protocol, we show that different modes of photoactivation yielded different photoactivation efficiencies. Short high-power photoactivation with a confocal laser scanning microscope (CLSM) resulted in up to four times lower photoactivation efficiency than hundreds of low-level exposures applied by CLSM or a short pulse applied by widefield illumination. While the protocol has been exemplified here for (PA-)GFP and (PA-)Cherry, it can in principle be applied to any spectrally distinct photoactivatable or photoconvertible fluorescent protein pair and any experimental set-up.

Here, we present a protocol that involves genetically coupled spectrally distinct photoactivatable and fluorescent proteins. These fluorescent protein chimeras permit quantification of the PA-FP fraction that is photoactivated to be fluorescent, i.e., the photoactivation efficiency. The protocol reveals that different modes of photoactivation yield different photoactivation efficiencies.

Como quantificar a fração de proteínas fluorescentes fotoativo a granel e em células vivas

Photoactivatable and -convertible fluorescent proteins (PA-FPs) have been used in fluorescence live-cell microscopy for analyzing the dynamics of cells ...

Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological functions. Such interactions can be highly dynamic, meaning the interacting subunits are constantly associated and dissociated at certain rates. While measuring the binding affinity using techniques such as quantitative pull-down reveals the strength of the interaction, studying the binding kinetics provides insights on how fast the interaction occurs and how long each complex can exist. Furthermore, measuring the kinetics of an interaction in the presence of an additional factor, such as a protein exchange factor or a drug, helps reveal the mechanism by which the interaction is regulated by the other factor, providing important knowledge for the advancement of biological and medical research. Here, we describe a protocol for measuring the binding kinetics of a protein complex that has a high intrinsic association rate and can be dissociated quickly by another protein. The method uses fluorescence resonance energy transfer to report the formation of the protein complex in vitro, and it enables monitoring the fast association and dissociation of the complex in real time on a stopped-flow fluorimeter. Using this assay, the association and dissociation rate constants of the protein complex are quantified.

Protein-protein interactions are critical for biological systems, and studies of the binding kinetics provide insights into the dynamics and function of protein complexes. We describe a method that quantifies the kinetic parameters of a protein complex using fluorescence resonance energy transfer and the stopped-flow technique. &#160;

Usando na transferência de energia de ressonância de fluorescência de Vitro para estudar a dinâmica dos complexos de proteínas em uma escala de tempo de milissegundo

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological ...

Expression, Purification, Crystallization, and Enzyme Assays of Fumarylacetoacetate Hydrolase Domain-Containing Proteins

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this superfamily generally display multi-functionality, involving mainly hydrolase and decarboxylase mechanisms. This article presents a series of consecutive methods for the expression and purification of FAHD proteins, mainly FAHD protein 1 (FAHD1) orthologues among species (human, mouse, nematodes, plants, etc.). Covered methods are protein expression in E. coli, affinity chromatography, ion exchange chromatography, preparative and analytical gel filtration, crystallization, X-ray diffraction, and photometric assays. Concentrated protein of high levels of purity (&#62;98%) may be employed for crystallization or antibody production. Proteins of similar or lower quality may be employed in enzyme assays or used as antigens in detection systems (Western-Blot, ELISA). In the discussion of this work, the identified enzymatic mechanisms of FAHD1 are outlined to describe its hydrolase and decarboxylase bi-functionality in more detail.

Expression and purification of fumarylacetoacetate hydrolase domain-containing proteins is described with examples (expression in E. coli, FPLC). Purified proteins are used for crystallization and antibody production and employed for enzyme assays. Selected photometric assays are presented to display the multi-functionality of FAHD1 as oxaloacetate decarboxylase and acylpyruvate hydrolase.

Expressão, purificação, cristalização e ensaios enzimáticos de proteínas contendo domínio de Fumarilacetoacetato de hidrolase

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this ...

Obtaining High-Quality Transcriptome Data from Cereal Seeds by a Modified Method for Gene Expression Profiling

The characterization of gene expression is dependent on RNA quality. In germinating, developing and mature cereal seeds, the extraction of high-quality RNA is often hindered by high starch and sugar content. These compounds can reduce both the yield and the quality of the extracted total RNA. The deterioration in quantity and quality of total RNA can subsequently have a significant impact on the downstream transcriptomic analyses, which may not accurately reflect the spatial and/or temporal variation in the gene expression profile of the samples being tested. In this protocol, we describe an optimized method for extraction of total RNA with sufficient quantity and quality to be used for whole transcriptome analysis of cereal grains. The described method is suitable for several downstream applications used for transcriptomic profiling of developing, germinating, and mature cereal seeds. The method of transcriptome profiling using a microarray platform is shown. This method is specifically designed for gene expression profiling of cereals with described genome sequences. The detailed procedure from microarray handling to final quality control is described. This includes cDNA synthesis, cRNA labelling, microarray hybridization, slide scanning, feature extraction, and data quality validation. The data generated by this method can be used to characterize the transcriptome of cereals during germination, in various stages of grain development, or at different biotic or abiotic stress conditions. The results presented here exemplify high-quality transcriptome data amenable for downstream bioinformatics analyses, such as the determination of differentially expressed genes (DEGs), characterisation of gene regulatory networks, and conducting transcriptome-wide association study (TWAS).

A method for transcriptome profiling of cereals is presented. The microarray-based gene expression profiling starts with the isolation of high-quality total RNA from cereal grains and continues with the generation of cDNA. After cRNA labelling and microarray hybridization, recommendations are given for signal detection and quality control.

Obtenção de dados de transcriptome de alta qualidade de sementes de cereal por um método modificado para criação de perfil de expressão genética

The characterization of gene expression is dependent on RNA quality. In germinating, developing and mature cereal seeds, the extraction of high-quality ...

Transverse Sectioning of Mature Rice (Oryza sativa L.) Kernels for Scanning Electron Microscopy Imaging Using Pipette Tips as Immobilization Support

Starch granules (SGs) exhibit different morphologies depending on the plant species, especially in the endosperm of the Poaceae family. Endosperm phenotyping can be used to classify genotypes based on SG morphotype using scanning electron microscopic (SEM) analysis. SGs can be visualized using SEM by slicing through the kernel (pericarp, aleurone layers, and endosperm) and exposing the organellar contents. Current methods require the rice kernel to be embedded in plastic resin and sectioned using a microtome or embedded in a truncated pipette tip and sectioned by hand using a razor blade. The former method requires specialized equipment and is time-consuming, while the latter introduces a new host of problems depending on rice genotype. Chalky rice varieties, particularly, pose a problem for this type of sectioning due to the friable nature of their endosperm tissue. Presented here is a technique for preparing translucent and chalky rice kernel sections for microscopy, requiring only pipette tips and a scalpel blade. Preparing the sections within the confines of a pipette tip prevents rice kernel endosperm from shattering (for translucent or &#8216;vitreous&#8217; phenotypes) and crumbling (for chalky phenotypes). Using this technique, endosperm cell patterning and the structure of intact SGs can be observed.

Transverse Sectioning of Mature Rice Oryza sativa L. Kernels for Scanning Electron Microscopy Imaging Using Pipette Tips as Immobilization Support

This protocol allows for the preparation of transverse sections of cereal seeds (e.g., rice) for the analysis of endosperm and starch granule morphology using scanning electron microscopy.

Secção Transversa de Arroz Maduro (Oryza sativa L.) Kernels para digitalização de imagens de microscopia eletrônica usando dicas de pipeta como suporte à imobilização

Starch granules (SGs) exhibit different morphologies depending on the plant species, especially in the endosperm of the Poaceae family. Endosperm ...

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Protein phosphorylation is crucial for the regulation of enzyme activity and gene expression under osmotic condition. Mass spectrometry (MS)-based phosphoproteomics has transformed the way of studying plant signal transduction. However, requirement of lots of starting materials and prolonged MS measurement time to achieve the depth of coverage has been the limiting factor for the high throughput study of global phosphoproteomic changes in plants. To improve the sensitivity and throughput of plant phosphoproteomics, we have developed a stop and go extraction (stage) tip based phosphoproteomics approach coupled with Tandem Mass Tag (TMT) labeling for the rapid and comprehensive analysis of plant phosphorylation perturbation in response to osmotic stress. Leveraging the simplicity and high throughput of stage tip technique, the whole procedure takes approximately one hour using two tips to finish phosphopeptide enrichment, fractionation, and sample cleaning steps, suggesting an easy-to-use and high efficiency of the approach. This approach not only provides an in-depth plant phosphoproteomics analysis (&#62; 11,000 phosphopeptide identification) but also demonstrates the superior separation efficiency (&#60; 5% overlap) between adjacent fractions. Further, multiplexing has been achieved using TMT labeling to quantify the phosphoproteomic changes of wild-type and snrk2 decuple mutant plants. This approach has successfully been used to reveal the phosphorylation events of Raf-like kinases in response to osmotic stress, which sheds light on the understanding of early osmotic signaling in land plants.

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Presented here is a phosphoproteomic approach, namely stop and go extraction tip based phosphoproteomic, which provides high-throughput and deep coverage of Arabidopsis phosphoproteome. This approach delineates the overview of osmotic stress signaling in Arabidopsis.

Modificar vetores de expressão de Baculovirus para produzir secretado proteínas vegetais em células de inseto

PLAYLIST