Name: agrobacterium-mediated genetic transformation, transgenic production, and its application for the study of male reproductive development in rice
Uploaded: 2020-10-06T14:00:00
Description: Watch this Scientific Journal Video about Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice at JoVE.com

The authors would like to acknowledge Xiaofei Chen for providing the young rice inflorescences and assistance in making the rice tissue culture medium. This work was supported by the National Natural Science Foundation of China (31900611).

1. sgRNA-CAS9 plant expression vector construction and Agrobacterium-mediated transformation
<ol>
	<li>Target a male sterile gene OsABCG15 in rice according to the published literature28.</li>
	<li>Design sgRNA for the targeted site located between 106&#8211;125 bp in the second exon of OsABCG15 (Figure 1).</li>
	<li>Use T4 polynucleotide kinase to synthesize the sgRNA oligos (sgR-OsABCG15-F: 5&#8217;TGGCAAGCACATCCTCAAGGGGAT3&#8217; and 5&...

<ol>
	<li>Izawa, T., Shimamoto, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Becoming+a+model+plant:+The+importance+of+rice+to+plant+science.">Becoming a model plant: The importance of rice to plant science.</a> Trends in Plant Science. 1 (3), 95-99 (1996).</li><li>Shimamoto, K., Kyozuka, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rice+as+a+model+for+comparative+genomics+of+plants.">Rice as a model for comparative genomics of plants.</a> Annual Review of Plant Biology. 53 (1), 399-419 (2002).</li><li>Selva, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hybrid+breeding+in+wheat:+how+shaping+floral+biology+can+offer+new+perspectives.">Hybrid breeding in wheat: how shaping floral biology can offer new perspectives.</a> Functional Plant Biology. 47 (8), 675-694 (2020).</li><li>Lippman, Z. B., Zamir, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterosis:+revisiting+the+magic.">Heterosis: revisiting the magic.</a> Trends in Genetics. 23 (2), 60-66 (2007).</li><li>Zhang, D., Liang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+food+security:+using+male+fertility+for+hybrid+seed+breeding.">Improving food security: using male fertility for hybrid seed breeding.</a> Science. , 45-48 (2016).</li><li>Masters, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-Mediated+Immature+Embryo+Transformation+of+Recalcitrant+Maize+Inbred+Lines+Using+Morphogenic+Genes.">Agrobacterium-Mediated Immature Embryo Transformation of Recalcitrant Maize Inbred Lines Using Morphogenic Genes.</a> Journal of Visualized Experiments. (156), e60782 (2020).</li><li>Laurenceau, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+type+IV+pilus+mediates+DNA+binding+during+natural+transformation+in+Streptococcus+pneumoniae.">A type IV pilus mediates DNA binding during natural transformation in Streptococcus pneumoniae.</a> PLoS Pathogens. 9 (6), 1003473 (2013).</li><li>Tzfira, T., Citovsky, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+genetic+transformation+of+plants:+biology+and+biotechnology.">Agrobacterium-mediated genetic transformation of plants: biology and biotechnology.</a> Current Opinion in Biotechnology. 17 (2), 147-154 (2006).</li><li>Gelvin, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+in+the+genomics+age.">Agrobacterium in the genomics age.</a> Plant Physiology. 150 (4), 1665-1676 (2009).</li><li>Lacroix, B., Citovsky, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+roles+of+bacterial+and+host+plant+factors+in+Agrobacterium-mediated+genetic+transformation.">The roles of bacterial and host plant factors in Agrobacterium-mediated genetic transformation.</a> International Journal of Developmental Biology. 57, 467-481 (2013).</li><li>Hiei, Y., Komari, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+rice+using+immature+embryos+or+calli+induced+from+mature+seed.">Agrobacterium-mediated transformation of rice using immature embryos or calli induced from mature seed.</a> Nature Protocols. 3 (5), 824 (2008).</li><li>Hiei, Y., Ohta, S., Komari, T., Kumashiro, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transformation+of+rice+(Oryza+sativa+L.)+mediated+by+Agrobacterium+and+sequence+analysis+of+the+boundaries+of+the+T-DNA.">Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA.</a> The Plant Journal. 6 (2), 271-282 (1994).</li><li>Hiei, Y., Komari, T., Kubo, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+rice+mediated+by+Agrobacterium+tumefaciens.">Transformation of rice mediated by Agrobacterium tumefaciens.</a> Plant Molecular Biology. 35 (1-2), 205-218 (1997).</li><li>Nishimura, A., Aichi, I., Matsuoka, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+protocol+for+Agrobacterium-mediated+transformation+in+rice.">A protocol for Agrobacterium-mediated transformation in rice.</a> Nature Protocols. 1 (6), 2796 (2006).</li><li>Yara, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+transgenic+japonica+rice+(Oryza+sativa)+cultivar,+Taichung+65,+by+the+Agrobacterium-mediated+method.">Production of transgenic japonica rice (Oryza sativa) cultivar, Taichung 65, by the Agrobacterium-mediated method.</a> Plant Biotechnology. 18 (4), 305-310 (2001).</li><li>Cho, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transformation+of+Korean+rice+cultivars+(Oryza+sativa+L.)+mediated+by+Agrobacterium+tumefaciens.">Efficient transformation of Korean rice cultivars (Oryza sativa L.) mediated by Agrobacterium tumefaciens.</a> Journal of Plant Biology. 41 (4), 262-268 (1998).</li><li>Toki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+and+efficient+Agrobacterium-mediated+transformation+in+rice.">Rapid and efficient Agrobacterium-mediated transformation in rice.</a> Plant Molecular Biology Reporter. 15, 16-21 (1997).</li><li>Zhang, J., Xu, R. j., Elliott, M. C., Chen, D. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+elite+indica+and+japonica+rice+cultivars.">Agrobacterium-mediated transformation of elite indica and japonica rice cultivars.</a> Molecular Biotechnology. 8 (3), 223-231 (1997).</li><li>Aldemita, R. R., Hodges, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+tumefaciens-mediated+transformation+of+japonica+and+indica+rice+varieties.">Agrobacterium tumefaciens-mediated transformation of japonica and indica rice varieties.</a> Planta. 199 (4), 612-617 (1996).</li><li>Rashid, H., Yokoi, S., Toriyama, K., Hinata, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+plant+production+mediated+by+Agrobacterium+in+indica+rice.">Transgenic plant production mediated by Agrobacterium in indica rice.</a> Plant Cell Reports. 15 (10), 727-730 (1996).</li><li>Sahoo, K. K., Tripathi, A. K., Pareek, A., Sopory, S. K., Singla-Pareek, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+protocol+for+efficient+transformation+and+regeneration+of+diverse+indica+rice+cultivars.">An improved protocol for efficient transformation and regeneration of diverse indica rice cultivars.</a> Plant Methods. 7 (1), 49 (2011).</li><li>Rachmawati, D., Hosaka, T., Inoue, E., Anzai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+Javanica+rice+cv.+Rojolele.">Agrobacterium-mediated transformation of Javanica rice cv. Rojolele.</a> Bioscience, Biotechnology, and Biochemistry. 68 (6), 1193-1200 (2004).</li><li>Dong, J., Teng, W., Buchholz, W. G., Hall, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+Javanica+rice.">Agrobacterium-mediated transformation of Javanica rice.</a> Molecular Breeding. 2 (3), 267-276 (1996).</li><li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas9+system+for+plant+genome+editing+and+beyond.">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li><li>Li, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+japonica+photo-sensitive+genic+male+sterile+rice+lines+by+editing+carbon+starved+anther+using+CRISPR/Cas9.">Development of japonica photo-sensitive genic male sterile rice lines by editing carbon starved anther using CRISPR/Cas9.</a> Journal of Genetics and Genomics. 43 (6), 415 (2016).</li><li>Qin, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ABCG15+encodes+an+ABC+transporter+protein,+and+is+essential+for+Post-Meiotic+anther+and+pollen+exine+development+in+rice.">ABCG15 encodes an ABC transporter protein, and is essential for Post-Meiotic anther and pollen exine development in rice.</a> Plant and Cell Physiology. 54, (2013).</li><li>Mao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+CRISPR-Cas+system+for+efficient+genome+engineering+in+plants.">Application of the CRISPR-Cas system for efficient genome engineering in plants.</a> Molecular Plant. 6 (6), 2008-2011 (2013).</li><li>Itoh, J. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rice+plant+development:+from+zygote+to+spikelet.">Rice plant development: from zygote to spikelet.</a> Plant and Cell Physiology. 46 (1), 23-47 (2005).</li><li>Gawel, N. J., Jarret, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modified+CTAB+DNA+extraction+procedure+forMusa+andIpomoea.">A modified CTAB DNA extraction procedure forMusa andIpomoea.</a> Plant Molecular Biology Reporter. 9 (3), 262-266 (1991).</li><li>Wei, F. J., Droc, G., Guiderdoni, E., Hsing, Y. i. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=International+Consortium+of+Rice+Mutagenesis:+resources+and+beyond.">International Consortium of Rice Mutagenesis: resources and beyond.</a> Rice. 6 (1), 39 (2013).</li><li>Feng, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+editing+in+plants+using+a+CRISPR/Cas+system.">Efficient genome editing in plants using a CRISPR/Cas system.</a> Cell Research. 23 (10), 1229 (2013).</li></ol>

Artificial genic male sterile mutants are traditionally generated by random physical, chemical, or biological mutagenesis. Although these are powerful techniques, their random nature fails to capitalize on the vast amount of modern genomic knowledge that has the potential to deliver tailored improvements in molecular breeding32. The CRISPR-Cas9 system has been widely used in plants due to its simple and affordable means to manipulate and edit DNA29,<sup class="xr...

Rice is the most important food crop, particularly in developing countries, and represents a staple food for over half of the world&#8217;s population. Overall, the demand for rice grain is growing and is projected to increase 50% by 2030 and 100% by 20501,2. Future improvements in rice yield will need to capitalize on diverse molecular and genetic resources that make rice an excellent model for monocotyledonous plant research. These include an efficient transformation system, advanced molecular map, and publicly accessible database of expressed sequence tags, which have been generated over many years3,4. One strategy to improve crop yield is hybrid seed production5, a central element of which is the ability to manipulate male fertility. Understanding the molecular control of male fertility in cereal crops can help to translate key knowledge into practical techniques to improve hybrid seed production and enhance crop productivity6,7.
Genetic transformation is a key tool for basic research and commercial agriculture since it enables introduction of foreign genes or manipulation of endogenous genes in crop plants, and results in the generation of genetically modified lines. An appropriate transformation protocol can help to accelerate genetic and molecular biology studies for fundamental understanding of gene regulation8. In bacteria, genetic transformation takes place naturally; however, in plants, it is performed artificially using molecular biology techniques9,10. Agrobacterium tumefaciens is a soil-borne, Gram-negative bacterium that causes crown gall disease in plants by transferring T-DNA, a region of its Ti plasmid, into the plant cell via a type IV secretion system11,12. In plants, A. tumefaciens-mediated transformation is considered a widespread method for gene modification because it leads to stable and low copy number integration of T-DNA into the host genome13. Transgenic rice was first generated through Agrobacterium-mediated gene transformation in the mid-1990s in the japonica cultivar14. Using this protocol, several transgenic lines were obtained within a period of 4 months with a transformation efficiency of 10%&#8211;30%. The study indicated that there are two critical steps for the successful transformation: one is the induction of embryogenic callus from mature seeds and another is the addition of acetosyringone, a phenolic compound, to the bacterial culture during co-cultivation, which allows for higher transformation efficiency in plants14,15. This protocol has been extensively used with minor alterations in japonica16,17,18,19 as well as other cultivars such as indica20,21,22,23 and tropical japonica24,25. Indeed, over 80% of the articles describing rice transformation use Agrobacterium-mediated gene transformation as a tool13. To date, several genetic transformation protocols have been developed using rice seed as a starting material for callus induction16,17,18,19. However, very little is known about young inflorescence as explants for callus production. Overall, it is important to establish a rapid, reproducible, and efficient gene transformation and regeneration protocol for functional genomics and studies on crop improvement.
In recent years, the advancement of CRISPR-Cas9 technology has resulted in a precise genome editing mechanism to understand gene function and deliver agronomically important improvements for plant breeding26,27. CRISPR also offers considerable promise for the manipulation of male reproductive development and hybrid production. In this study, we utilized a gene knockout system using CRISPR-Cas9 technology and coupled it to an efficient rice gene transformation protocol using young inflorescences as explants, thereby creating stable male sterile lines for the study of reproductive development.

<table>
	<tbody>
		<tr>
			<td>1-Naphthaleneacetic acid</td>
			<td>Sigma-Aldrich</td>
			<td>N0640</td>
			<td></td>
		</tr>
		<tr>
			<td>2&#65292;4-Dichlorophenoxyacetic Acid</td>
			<td>Sigma-Aldrich</td>
			<td>D7299</td>
			<td></td>
		</tr>
		<tr>
			<td>6-Benzylaminopurine (6-BA)</td>
			<td>Sigma-Aldrich</td>
			<td>B3408</td>
			<td></td>
		</tr>
		<tr>
			<td>Acetosyringone</td>
			<td>Sigma-Aldrich</td>
			<td>D134406</td>
			<td></td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10000561</td>
			<td></td>
		</tr>
		<tr>
			<td>Ammonium sulfate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10002918</td>
			<td></td>
		</tr>
		<tr>
			<td>Aneurine hydrochloride</td>
			<td>Sigma-Aldrich</td>
			<td>T4625</td>
			<td></td>
		</tr>
		<tr>
			<td>Anhydrous ethanol</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10009218</td>
			<td></td>
		</tr>
		<tr>
			<td>Bacteriological peptone</td>
			<td>Sangon Biotech</td>
			<td>A100636</td>
			<td></td>
		</tr>
		<tr>
			<td>Beef extract</td>
			<td>Sangon Biotech</td>
			<td>A600114</td>
			<td></td>
		</tr>
		<tr>
			<td>Boric acid</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10004808</td>
			<td></td>
		</tr>
		<tr>
			<td>Calcium chloride dihydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>20011160</td>
			<td></td>
		</tr>
		<tr>
			<td>Casein acid hydrolysate</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>C184</td>
			<td></td>
		</tr>
		<tr>
			<td>Cobalt(&#8545;) chloride hexahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10007216</td>
			<td></td>
		</tr>
		<tr>
			<td>Copper(&#8545;) sulfate pentahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10008218</td>
			<td></td>
		</tr>
		<tr>
			<td>D(+)-Glucose anhydrous</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>63005518</td>
			<td></td>
		</tr>
		<tr>
			<td>D-sorbitol</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>63011037</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA, Disodium Salt, Dihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>E5134</td>
			<td></td>
		</tr>
		<tr>
			<td>EOS Digital SLR and Compact System Cameras</td>
			<td>Canon</td>
			<td>EOS 700D</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10010018</td>
			<td></td>
		</tr>
		<tr>
			<td>Fully Automated Rotary Microtome</td>
			<td>Leica Biosystems</td>
			<td>Leica RM 2265</td>
			<td></td>
		</tr>
		<tr>
			<td>Glacial acetic acid</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10000208</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>62011516</td>
			<td></td>
		</tr>
		<tr>
			<td>Hygromycin</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>H370</td>
			<td></td>
		</tr>
		<tr>
			<td>Inositol</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>63007738</td>
			<td></td>
		</tr>
		<tr>
			<td>Iodine</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10011517</td>
			<td></td>
		</tr>
		<tr>
			<td>Iron(&#8545;) sulfate heptahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10012116</td>
			<td></td>
		</tr>
		<tr>
			<td>Kanamycine</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>K378</td>
			<td></td>
		</tr>
		<tr>
			<td>Kinetin</td>
			<td>Sigma-Aldrich</td>
			<td>K0753</td>
			<td></td>
		</tr>
		<tr>
			<td>L-Arginine</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>62004034</td>
			<td></td>
		</tr>
		<tr>
			<td>L-Aspartic acid</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>62004736</td>
			<td></td>
		</tr>
		<tr>
			<td>L-Glutamine</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>G229</td>
			<td></td>
		</tr>
		<tr>
			<td>L-proline</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>P698</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium sulfate heptahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10013018</td>
			<td></td>
		</tr>
		<tr>
			<td>Manganese sulfate monohydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10013418</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscopes</td>
			<td>NIKON</td>
			<td>Eclipse 80i</td>
			<td></td>
		</tr>
		<tr>
			<td>MS</td>
			<td>Phytotech</td>
			<td>M519</td>
			<td></td>
		</tr>
		<tr>
			<td>Nicotinic acid</td>
			<td>Sigma-Aldrich</td>
			<td>N0765</td>
			<td></td>
		</tr>
		<tr>
			<td>Phytagel</td>
			<td>Sigma-Aldrich</td>
			<td>P8169</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10016308</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium dihydrogen phosphate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10017608</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium iodide</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10017160</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium nitrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>1001721933</td>
			<td></td>
		</tr>
		<tr>
			<td>Pyridoxine Hydrochloride (B6)</td>
			<td>Sigma-Aldrich</td>
			<td>47862</td>
			<td></td>
		</tr>
		<tr>
			<td>Rifampicin</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>R501</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium hydroxide</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10019718</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium molybdate dihydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10019816</td>
			<td></td>
		</tr>
		<tr>
			<td>Stereo microscopes</td>
			<td>Leica Microsystems</td>
			<td>Leica M205 A</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10021418</td>
			<td></td>
		</tr>
		<tr>
			<td>Technovit embedding Kits 7100</td>
			<td>Heraeus Teknovi, Germany</td>
			<td>14653</td>
			<td></td>
		</tr>
		<tr>
			<td>Timentin</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>T869</td>
			<td></td>
		</tr>
		<tr>
			<td>Toluidine Blue O</td>
			<td>Sigma-Aldrich</td>
			<td>T3260</td>
			<td></td>
		</tr>
		<tr>
			<td>Water bath for paraffin sections</td>
			<td>Leica Biosystems</td>
			<td>Leica HI1210</td>
			<td></td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>Sangon Biotech</td>
			<td>A515245</td>
			<td></td>
		</tr>
		<tr>
			<td>Zinc sulfate heptahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10024018</td>
			<td></td>
		</tr>
	</tbody>
</table>

agrobacterium-mediated genetic transformation, transgenic production, and its application for the study of male reproductive development in rice

Male sterility is an important agronomic trait for hybrid seed production that is usually characterized by functional defects in male reproductive organs/gametes. Recent advances in CRISPR-Cas9 genome editing technology allow for high editing efficacy and timesaving knockout mutations of endogenous candidate genes at specific sites. Additionally, Agrobacterium-mediated genetic transformation of rice is also a key method for gene modification, which has been widely adopted by many public and private laboratories. In this study, we applied CRISPR-Cas9 genome editing tools and successfully generated three male sterile mutant lines by targeted genome editing of OsABCG15 in a japonica cultivar. We used a modified Agrobacterium-mediated rice transformation method that could provide excellent means of genetic emasculation for hybrid seed production in rice. Transgenic plants can be obtained within 2&#8211;3 months and homozygous transformants were screened by genotyping using PCR amplification and Sanger sequencing. Basic phenotypic characterization of the male sterile homozygous line was performed by microscopic observation of the rice male reproductive organs, pollen viability analysis by iodine potassium iodide (I2-KI) staining semi-thin cross-sectioning of developing anthers.

Demonstrated here is the use of gene editing technology to create a male sterile line for future research by Agrobacterium-mediated genetic transformation in rice. To create the male sterile line of osabcg15, CRISPR-CAS9-mediated mutagenesis was used for binary vector construction. The sgRNA was driven by the OsU3 promoter, whereas the expression cassette of hSpCas9 was driven by the double 35S promoter, and the middle vector was assembled in a single binary vector pCAMBIA1300 designed for ...

Watch this Scientific Journal Video about Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice at JoVE.com

Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice

This work describes the use of CRISPR-Cas9 genome editing technology to knockout endogenous gene OsABCG15 followed by a modified Agrobacterium-mediated transformation protocol to produce a stable male-sterile line in rice.

Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice

Male sterility is an important agronomic trait for hybrid seed production that is usually characterized by functional defects in male reproductive ...

Young inflorescences as explant for callus production are important for establishing a rapid and efficient gene transformation and a regeneration method for revealing gene function as well as for crop improvement. Young inflorescences as explant for callus production are important for establishing a rapid and efficient gene transformation and the regeneration method for revealing gene function. Video demonstration of this technique will help the viewer understand the process of maintaining the materials to produce that desired transgenic align without wasting time and effort.Begin by collecting young rice inflorescences from the paddy field or a greenhouse at meiosis stage, making sure that they are covered with the leaf sheath. Wipe each inflorescence with a 70%alcohol swab and let it dry before cutting. Bring the inflorescence to a sterile lab bench and cut it into small pieces with sterilized scissors, then transfer the cuttings to a Petri plate containing NBD2 medium.Incubate the plate in the dark at 26 degrees Celsius for 10 to 14 days to induce callus. To perform transformation, transfer a single colony from the white EB plate with selective antibiotics to five milliliters of liquid YEB medium containing the same antibiotics in a 50 milliliter conical sterile test tube. Shake the tube on an orbital shaker at 250 times g and 25 to 28 degrees Celsius until bacteria grow to an OD 600 of 0.5.Add one milliliter of bacterial suspension to 100 milliliters of YEB medium with the same selective antibiotics in a 250 milliliter conical flask and shake the flask on an orbital shaker at 250 times g and 28 degrees Celsius for four hours. Centrifuge the culture at 4, 000 g for 10 minutes at room temperature to collect the bacteria. Discard the supernatant and resuspend the pellet with AAM AS medium, then dilute the suspension to an OD 600 of 0.4.After the incubation, collect around 150 healthy light yellow embryogenic calli into a 150 milliliter sterile flask. Add 50 to 75 milliliters of the bacterial cell suspension into the flask and then add 10 to 25 milliliters of fresh AAM AS medium to immerse the calli for 10 to 20 minutes, shaking occasionally. Pour the bacterial suspension out of the flask carefully and dry the calli with sterile filter paper, then place them on a Petri dish with NBD AS medium and cover them with filter paper.Incubate the calli at 25 to 28 degrees Celsius in the dark for three days, checking them for bacterial overgrowth. After three days of co-cultivation, transfer the calli to a sterile Petri dish using filter paper, then air dry them for two hours on a clean bench. Ensure that the calli are not adhered to the filter paper and transfer them to the primary selection medium NBD2.After two weeks, transfer the calli evenly to a new plate containing fresh selection medium, then move the calli to fresh MS medium for differentiation and the shoot buds to MS medium with 10 milligrams per liter Hygromycin to proliferate more shoots. Transfer the new shoots into half MS medium for root induction and culture them under light at 25 to 28 degrees Celsius. The transformed plants should produce roots within two weeks.To perform reproductive phenotype observation, remove the palea and lemma from the florid and image the whole anthers under a stereo microscope. To observe pollen viability, pick mature rice spikelets before the flower anthesis and remove the palea and lemma to release the anthers. Take six anthers and place them on a glass slide.Add one drop of distilled water, crush the anther with tweezers to release the pollen grains, then add two to three drops of iodine solution and cover with a coverslip. Observe the slide under a low magnification microscope. Pollen grains dyed black show more vigorous viability while grains with no color or those dyed yellow brown are stunted or degenerated.To perform transverse sectioning microscopy, use 0.5%toluidine blue solution to stain the slides for 30 minutes, then rinse them with water and dry them in the fume hood. Once dry, seal the slides with neutral tree glue, gently place a coverslip on the slide and dry them in the fume hood, then image the sample under a microscope. This protocol was used to create a male sterile line by Agrobacterium-mediated genetic transformation in rice.The embryogenic calli were directly used for the transformation or subcultured for proliferation to obtain more calli for further infection. After co-cultivating for 48 hours, the calli were shifted to a second round of selection medium. After 10 to 14 days, transformed calli showed newly formed microcalli while the untransformed calli turned brown and died.Later, healthy and creamy colored calli were transferred into regeneration medium. The transformed calli gradually showed green spots. These green spots were cultured in regeneration medium to allow for shoot growth and then shifted into half MS medium to induce roots.Later, healthy and vigorous growing shoots with well-developed roots were harvested. In total, 21 regenerated seedlings were obtained. PCR amplification for the Hygromycin region showed that the transformation frequency was approximately 85.71%The transformants were genotyped to identify the mutations at the sgRNA target sites.Among the 18 transgenic plants, eight heterozygous lines and three homozygous lines were CRISPR CAS9 positive. The homozygous knockout mutants were validated by basic male reproductive organ observation. The anthers of osabcg15 were smaller and paler than those of the wild type and lacked mature pollen grains.Transverse sectioning microscopy was performed to investigate the anther morphological defects in osabcg15. At stage 10, wild-type microspores became round shaped and vacuolated with dark blue stained exine. In contrast, the osabcg15 microspores collapsed and degraded.When attempting this protocol, it is important to ensure that the collected material is in meiosis stage and to control the air dry time of the calli.

Research

JoVE Journal

Biology

Testing Visual Sensitivity to the Speed and Direction of Motion in Lizards

Testing visual sensitivity in any species provides basic information regarding behaviour, evolution, and ecology. However, testing specific features of ...

Lens Transplantation in Zebrafish and its Application in the Analysis of Eye Mutants

The lens plays an important role in the development of the optic cup[1,2]. Using the zebrafish as a model organism, questions regarding lens development ...

Generation of Transgenic C. elegans by Biolistic Transformation

Generation of Transgenic C. elegans by Biolistic Transformation

The number of laboratories using the free living nematode C. elegans is rapidly growing. The popularity of this biological model is attributed to a rapid ...

Agrobacterium-Mediated Virus-Induced Gene Silencing Assay In Cotton

Cotton (Gossypium hirsutum) is one of the most important crops worldwide. Considerable efforts have been made on molecular breeding of new varieties.  The ...

Do-It-Yourself Device for Recovery of Cryopreserved Samples Accidentally Dropped into Cryogenic Storage Tanks

Liquid nitrogen is colorless, odorless, extremely cold (-196 &deg;C) liquid kept under pressure. It is commonly used as a cryogenic fluid for long term ...

Optimization and Utilization of Agrobacterium-mediated Transient Protein Production in Nicotiana

Optimization and Utilization of Agrobacterium-mediated Transient Protein Production in Nicotiana

Agrobacterium-mediated transient protein production in plants is a promising approach to produce vaccine antigens and therapeutic proteins within a short ...

Transgenic Rodent Assay for Quantifying Male Germ Cell Mutant Frequency

De novo mutations arise mostly in the male germline and may contribute to adverse health outcomes in subsequent generations. Traditional methods for ...

A Multi-hole Cryovial Eliminates Freezing Artifacts when Muscle Tissues are Directly Immersed in Liquid Nitrogen

Studies on skeletal muscle physiology face the technical challenge of appropriately processing the specimens to obtain sections with clearly visible ...

Agrobacterium-Mediated Immature Embryo Transformation of Recalcitrant Maize Inbred Lines Using Morphogenic Genes

Agrobacterium-Mediated Immature Embryo Transformation of Recalcitrant Maize Inbred Lines Using Morphogenic Genes

Demonstrated here is a detailed protocol for Agrobacterium-mediated genetic transformation of maize inbred lines using morphogenic genes Baby boom (Bbm) ...

Real-Time Detection of Reactive Oxygen Species Production in Immune Response in Rice with a Chemiluminescence Assay

Reactive oxygen species (ROS) play vital roles in a variety of biological processes, including the sensing of abiotic and biotic stresses. Upon pathogen ...