Name: isolation of murine retinal endothelial cells for next-generation sequencing
Uploaded: 2021-10-11T13:00:00
Description: Watch this Scientific Journal Video about Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing at JoVE.com

Thank you to the Yale Flow Cytometry Facility, the University of Virginia Flow Cytometry Core Facility, the Yale Center for Genomic Analysis, and the University of Virginia Genome Analysis and Technology Core for their effort, expertise, and advice in contributing to the presented experiments. This study was funded by NIH grants to N.W.C. (T32 HL007224, T32 HL007284), S.C. (T32 HL007284), K.W. (R01 HL142650), and K.K.H. (R01 HL146056, R01 DK118728, UH3 EB025765).

The Institutional Animal Care and Use Committees of Yale University and the University of Virginia approved all animal experiments listed in this protocol.
1. Obtain mouse eyes for retinal isolation
<ol>
	<li>Prepare 1x ice-cold PBS and add 500 &#956;L to each well of a 48-well plate.</li>
	<li>Euthanize neonatal mice at postnatal day six (P6) according to approved institutional guidelines. For this experiment, litters of approximately 4-8 neonatal mice are euthanized at P6&...

<ol>
	<li>Slatko, B. E., Gardner, A. F., Ausubel, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overview+of+next-generation+sequencing+technologies.">Overview of next-generation sequencing technologies.</a> Current Protocols in Molecular Biology. 122 (1), 59 (2018).</li><li>Chavkin, N. W., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+cell+analysis+in+vascular+biology.">Single cell analysis in vascular biology.</a> Frontiers in Cardiovascular Medicine. 7, 42 (2020).</li><li>Ma, F., Hernandez, G. E., Romay, M., Iruela-Arispe, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+RNA+sequencing+to+study+vascular+diversity+and+function.">Single-cell RNA sequencing to study vascular diversity and function.</a> Current Opinion in Hematology. 28 (3), 221-229 (2021).</li><li>Potter, A. S., Potter, S. S., S, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissociation+of+tissues+for+single-cell+analysis.">Dissociation of tissues for single-cell analysis.</a> Methods in Molecular Biology. 1926, 55-62 (2019).</li><li>Braga, F. A. V., Miragaia, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+handling+and+dissociation+for+single-cell+RNA-seq.">Tissue handling and dissociation for single-cell RNA-seq.</a> Single Cell Methods: Methods in Molecular Biology. 1979, 9-21 (2019).</li><li>Brink, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+sequencing+reveals+dissociatin-induced+gene+expression+in+tissue+subpopulations.">Single-cell sequencing reveals dissociatin-induced gene expression in tissue subpopulations.</a> Nature Methods. 14 (10), 935-936 (2017).</li><li>Skulska, K., Wegrzyn, A. S., Chelmonska-Soyta, A., Chodaczek, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+tissue+enzymatic+digestion+on+analysis+of+immune+cells+in+mouse+reproductive+mucosa+with+a+focus+on+gammadelta+T+cells.">Impact of tissue enzymatic digestion on analysis of immune cells in mouse reproductive mucosa with a focus on gammadelta T cells.</a> Journal of Immunological Methods. 474, 112665 (2019).</li><li>Connolly, S., Hores, T., Smith, L., D'Amore, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+vascular+development+in+the+mouse+retina.">Characterization of vascular development in the mouse retina.</a> Microvascular Research. 36 (3), 275-290 (1988).</li><li>Crist, A., Young, C., Meadows, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+arteriovenous+identity+in+the+developing+neonate+mouse+retina.">Characterization of arteriovenous identity in the developing neonate mouse retina.</a> Gene Expression Patterns: GEP. 23-24, 22-31 (2017).</li><li>dela Paz, N. G., D'Amore, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arterial+versus+venous+endothelial+cells.">Arterial versus venous endothelial cells.</a> Cell and Tissue Research. 335 (1), 5-16 (2009).</li><li>Fang, J. S., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+regulation+of+arteriovenous+endothelial+cell+specification.">Molecular regulation of arteriovenous endothelial cell specification.</a> F1000Res. 8, (2019).</li><li>Smith, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oxygen-induced+retinopathy+in+the+mouse.">Oxygen-induced retinopathy in the mouse.</a> Investigative Ophthalmology and Visual Science. 35 (1), 101-111 (1994).</li><li>Pitulescu, M. E., Schmidt, I., Benedito, R., Adams, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+gene+targeting+in+the+neonatal+vasculature+and+analysis+of+retinal+angiogenesis+in+mice.">Inducible gene targeting in the neonatal vasculature and analysis of retinal angiogenesis in mice.</a> Nature Protocols. 5 (9), 1518-1534 (2010).</li><li>Ruiz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mouse+model+of+hereditary+hemorrhagic+telangiectasia+generated+by+transmammary-delivered+immunoblocking+of+BMP9+and+BMP10.">A mouse model of hereditary hemorrhagic telangiectasia generated by transmammary-delivered immunoblocking of BMP9 and BMP10.</a> Scientific Reports. 6, 37366 (2016).</li><li>Fang, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shear-induced+Notch-Cx37-p27+axis+arrests+endothelial+cell+cycle+to+enable+arterial+specification.">Shear-induced Notch-Cx37-p27 axis arrests endothelial cell cycle to enable arterial specification.</a> Nature Communication. 8 (1), 2149 (2017).</li><li>Ola, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SMAD4+prevents+flow+induced+arterial-venous+malformations+by+inhibiting+Casein+Kinase+2.">SMAD4 prevents flow induced arterial-venous malformations by inhibiting Casein Kinase 2.</a> Circulation. 138 (21), 2379-2394 (2018).</li><li>Chavkin, N. W., Walsh, K., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+highly+purified+and+viable+retinal+endothelial+cells.">Isolation of highly purified and viable retinal endothelial cells.</a> Journal of Vascular Research. 58 (1), 49-57 (2020).</li><li>Hulspas, R., O'Gorman, M. R. G., Wood, B. L., Gratama, J. W., Sutherland, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Considerations+for+the+control+of+background+fluorescence+in+clinical+flow+cytometry.">Considerations for the control of background fluorescence in clinical flow cytometry.</a> Cytometry PartB: Clinical Cytometry. 76 (6), 355-364 (2009).</li><li>Bachman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reverse-transcription+PCR+(RT-PCR).">Reverse-transcription PCR (RT-PCR).</a> Methods in Enzymology. 530, 67-74 (2013).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+RNA+by+real-time+Reverse+Transcription-Polymerase+Chain+Reaction+(RT-PCR).">Quantification of RNA by real-time Reverse Transcription-Polymerase Chain Reaction (RT-PCR).</a> Cold Spring Harbour Protocols. 2018 (10), (2018).</li><li>Liu, L., Shi, G. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD31:+beyond+a+marker+for+endothelial+cells.">CD31: beyond a marker for endothelial cells.</a> Cardiovascular Research. 94 (1), 3-5 (2012).</li><li>Zarkada, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specialized+endothelial+tip+cells+guide+neuroretina+vascularization+and+blood-retina-barrier+formation.">Specialized endothelial tip cells guide neuroretina vascularization and blood-retina-barrier formation.</a> Developmental Cell. 56 (15), 2237-2251 (2021).</li><li>Su, X., Sorenson, C. M., Sheibani, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+murine+retinal+endothelial+cells.">Isolation and characterization of murine retinal endothelial cells.</a> Molecular Vision. 9, 171-178 (2003).</li><li>Benedito, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+notch+ligands+Dll4+and+Jagged1+have+opposing+effects+on+angiogenesis.">The notch ligands Dll4 and Jagged1 have opposing effects on angiogenesis.</a> Cell. 137 (6), 1124-1135 (2009).</li><li>Daneman, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wnt/beta-catenin+signaling+is+required+for+CNS,+but+not+non-CNS,+angiogenesis.">Wnt/beta-catenin signaling is required for CNS, but not non-CNS, angiogenesis.</a> Proceedings of the National Academy of Sciences of the United States of America. 106 (2), 641-646 (2009).</li><li>Okabe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurons+limit+angiogenesis+by+titrating+VEGF+in+retina.">Neurons limit angiogenesis by titrating VEGF in retina.</a> Cell. 159 (3), 584-596 (2014).</li><li>Crist, A. M., Lee, A. R., Patel, N. R., Westhoff, D. E., Meadows, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vascular+deficiency+of+Smad4+causes+arteriovenous+malformations:+a+mouse+model+of+Hereditary+Hemorrhagic+Telangiectasia.">Vascular deficiency of Smad4 causes arteriovenous malformations: a mouse model of Hereditary Hemorrhagic Telangiectasia.</a> Angiogenesis. 21 (2), 363-380 (2018).</li><li>Kim, Y. H., Choe, S. W., Chae, M. Y., Hong, S., Oh, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SMAD4+deficiency+leads+to+development+of+arteriovenous+malformations+in+neonatal+and+adult+mice.">SMAD4 deficiency leads to development of arteriovenous malformations in neonatal and adult mice.</a> Journal of the American Heart Association. 7 (21), 009514 (2018).</li><li>Ma, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absence+of+TGFbeta+signaling+in+retinal+microglia+induces+retinal+degeneration+and+exacerbates+choroidal+neovascularization.">Absence of TGFbeta signaling in retinal microglia induces retinal degeneration and exacerbates choroidal neovascularization.</a> eLife. 8, 42049 (2019).</li><li>Luo, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arterialization+requires+the+timely+suppression+of+cell+growth.">Arterialization requires the timely suppression of cell growth.</a> Nature. 589 (7842), 437-441 (2021).</li><li>Lawson, N. D., Vogel, A. M., Weinstein, B. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=sonic+hedgehog+and+vascular+endothelial+growth+factor+act+upstream+of+the+Notch+pathway+during+arterial+endothelial+differentiation.">sonic hedgehog and vascular endothelial growth factor act upstream of the Notch pathway during arterial endothelial differentiation.</a> Developmental Cell. 3 (1), 127-136 (2002).</li><li>Larrivee, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ALK1+signaling+inhibits+angiogenesis+by+cooperating+with+the+Notch+pathway.">ALK1 signaling inhibits angiogenesis by cooperating with the Notch pathway.</a> Developmental Cell. 22 (3), 489-500 (2012).</li><li>Wythe, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ETS+factors+regulate+Vegf-dependent+arterial+specification.">ETS factors regulate Vegf-dependent arterial specification.</a> Developmental Cell. 26 (1), 45-58 (2013).</li><li>Davis, D. M., Purvis, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+analysis+of+signaling+patterns+in+single+cells.">Computational analysis of signaling patterns in single cells.</a> Seminars in Cell and Developmental Biology. , 35-43 (2015).</li><li>Gaudet, S., Miller-Jensen, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Redefining+signaling+pathways+with+an+expanding+single-cell+toolbox.">Redefining signaling pathways with an expanding single-cell toolbox.</a> Trends in Biotechnology. 34 (6), 458-469 (2016).</li><li>Aibar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SCENIC:+single-cell+regulatory+network+inference+and+clustering.">SCENIC: single-cell regulatory network inference and clustering.</a> Nature Methods. 14 (11), 1083-1086 (2017).</li><li>Trapnell, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+dynamics+and+regulators+of+cell+fate+decisions+are+revealed+by+pseudotemporal+ordering+of+single+cells.">The dynamics and regulators of cell fate decisions are revealed by pseudotemporal ordering of single cells.</a> Nature Biotechnology. 32 (4), 381-386 (2014).</li></ol>

This protocol describes a method for the isolation of endothelial cells from postnatal murine retinal tissue that has been optimized for high cell number, purity, and viability. Cell purity is obtained by FACS isolation of endothelial cell populations from the digested single-cell suspension by CD31+/CD45- immunostaining. Quality of isolation is quantified in assays for viability by Trypan blue staining and gene expression by qPCR for CD31, CD45, and VE-Cadherin (although VE-Cadherin was not used for immunostaining). The...

The high-throughput capacity of sequencing nucleic acids via next-generation sequencing approaches has greatly advanced researchers&#39; knowledge of molecular and cellular biology. These advanced techniques include whole transcriptome RNA sequencing, DNA sequencing of targeted regions to identify Single Nucleotide Polymorphisms (SNPs), DNA sequencing of bound transcription factors in Chromatin Immunoprecipitation (ChIP) sequencing, or open chromatin regions in Assay for Transposase-Accessible Chromatin (ATAC) sequencing, and single-cell RNA sequencing1. In vascular biology, these advances have allowed researchers to elucidate complicated mechanisms of development and disease, along with distinguishing gene expression patterns along a continuum of varying phenotypes2,3. Future experiments can further define complex mechanisms by combining the next-generation sequencing with evaluated models of vascular development, but the methods for sample preparation need to be compatible with the advanced sequencing techniques.
The quality, accuracy, and reproducibility of next-generation sequencing approaches depend on the method of sample preparation. When isolating a subset of cells or generating single-cell suspensions from tissues, optimal digestion and purification methods are essential for maximizing cell number, viability, and purity of the cell population4,5. This requires a balance in the digestion method: strong digestion is necessary to release cells from the tissue and obtain enough cells for downstream approaches, but cell viability will be negatively affected if the digestion is too strong6,7. Additionally, purity of the cell population is necessary for robust results and accurate analysis of data, which can be accomplished through FACS. This highlights the importance of optimizing cell isolation methods to apply next-generation sequencing to established models of vascular development.
A well-characterized model for investigating vascular development is the murine retinal vascular development model. Murine retinal vasculature develops postnatally in a two-dimensional superficial plexus, with initial angiogenic sprouting from the optic nerve visible at postnatal day (P)3, angiogenic front with stalk- and tip-cells and initial vessel maturation visible at P6, and maturation of the vascular plexus visible after P98,9. During the remodeling of the initial vascular plexus, endothelial cells undergo specification toward arterial, capillary, and venous phenotypes in different vessels to generate a circulatory network10,11. Therefore, this method allows researchers to visualize angiogenic vascular plexus formation and endothelial arterial-venous specification and maturation at various time points during development9. Additionally, this model provides a method for investigating the effects of transgenic manipulation on angiogenesis and vascular plexus development, which has been applied for the investigation of vascular development, arterial-venous malformations, and oxygen-induced neovascularization12,13,14,15,16. In order to combine next-generation sequencing approaches with the murine retinal vascular development model, an optimized protocol for the isolation of endothelial cells from retinal tissue is necessary.
This protocol describes an optimized method for digesting retinal tissue from mice at P6 to maximize cell yield, purity, and viability. Retinal tissue is isolated from P6 mice, digested for 20 min, immunostained for CD31 and CD45, and purified through FACS to isolate a single cell suspension of endothelial cells in about 2.5 h (Figure 1A). These endothelial cells were found to maintain high viability for 60 min post-isolation17, allowing library preparations for next-generation sequencing methods. Additionally, representative results are provided for FACS gating and quality control results from two separate next-generation sequencing methods using this isolation protocol: whole transcriptome RNA sequencing and single-cell RNA sequencing. This method allows for next-generation sequencing approaches to be used in conjunction with the retinal vascularization model to elucidate novel mechanisms of vascular development.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2 mL Eppendorf&#160;safe-lock tubes</td>
			<td>USA Scientific</td>
			<td>4036-3352</td>
			<td></td>
		</tr>
		<tr>
			<td>5 ml Falcon Test Tubes with Cell Strainer Snap Cap</td>
			<td>Corning</td>
			<td>352235</td>
			<td></td>
		</tr>
		<tr>
			<td>60 mm Non TC-treated Culture Dish</td>
			<td>Corning</td>
			<td>430589</td>
			<td></td>
		</tr>
		<tr>
			<td>APC Rat Anti-Mouse CD31</td>
			<td>BD Biosciences</td>
			<td>551262</td>
			<td></td>
		</tr>
		<tr>
			<td>APC Rat IgG2a &#954; Isotype Control</td>
			<td>BD Biosciences</td>
			<td>553932</td>
			<td></td>
		</tr>
		<tr>
			<td>BD FACSChorus Software</td>
			<td>BD Biosciences</td>
			<td>FACSCHORUS</td>
			<td></td>
		</tr>
		<tr>
			<td>BD FACSMelody Cell Sorter</td>
			<td>BD Biosciences</td>
			<td>FACSMELODY</td>
			<td></td>
		</tr>
		<tr>
			<td>Collagenase Type II</td>
			<td>Sigma-Aldrich</td>
			<td>234115</td>
			<td></td>
		</tr>
		<tr>
			<td>Costar 48-well Clear TC-treated Multiple Well Plates, Individually Wrapped, Sterile</td>
			<td>Corning</td>
			<td>3548</td>
			<td></td>
		</tr>
		<tr>
			<td>D-Glucose</td>
			<td>Gibco</td>
			<td>A2494001</td>
			<td></td>
		</tr>
		<tr>
			<td>Disposable Graduated Transfer Pipettes</td>
			<td>Fisher Scientific</td>
			<td>12-711-9AM</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissecting Pan Wax</td>
			<td>Carolina</td>
			<td>629100</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissection scissors</td>
			<td>Fine Science Tools</td>
			<td>14085-08</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissection Stereo Microscope M165 FC</td>
			<td>Leica</td>
			<td>M165FC</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Gibco</td>
			<td>11965-052</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s Phosphate Buffered Saline (PBS)</td>
			<td>Gibco</td>
			<td>14190144</td>
			<td></td>
		</tr>
		<tr>
			<td>Eppendorf&#160;Flex-Tubes Microcentrifuge Tubes 1.5 mL</td>
			<td>Sigma-Aldrich</td>
			<td>22364120</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Gemini Bio</td>
			<td>100-106</td>
			<td></td>
		</tr>
		<tr>
			<td>Fine dissection forceps</td>
			<td>Fine Science Tools</td>
			<td>11250-00</td>
			<td></td>
		</tr>
		<tr>
			<td>Hank&#39;s Buffered Salt Solution (HBSS)</td>
			<td>Gibco</td>
			<td>14175095</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES (1M)</td>
			<td>Gibco</td>
			<td>15630130</td>
			<td></td>
		</tr>
		<tr>
			<td>iScript cDNA Synthesis Kit</td>
			<td>Bio-Rad</td>
			<td>1708890</td>
			<td></td>
		</tr>
		<tr>
			<td>Isoflurane, USP</td>
			<td>Covetrus</td>
			<td>11695067772</td>
			<td></td>
		</tr>
		<tr>
			<td>Isotemp General Purpose Deluxe Water Bath</td>
			<td>Fisher Scientific</td>
			<td>FSGPD20</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: ActB_Forward: 5&#8217;- agagggaaatcgtgcgtgac -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: ActB_Reverse: 5&#8217;- caatagtgatgacctggccgt -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD31_Forward: 5&#8217;- gagcccaatcacgtttcagttt -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD31_Reverse: 5&#8217;- tccttcctgcttcttgctagct -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD45_Forward: 5&#8217;- gggttgttctgtgccttgtt -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD45_Reverse: 5&#8217;- ctggacggacacagttagca -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: VE-Cadherin_Forward: 5&#8217;- tcctctgcatcctcactatcaca -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: VE-Cadherin_Reverse: 5&#8217;- gtaagtgaccaactgctcgtgaat -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium iodide</td>
			<td>Sigma-Aldrich</td>
			<td>P4864</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Plus Mini Kit</td>
			<td>Qiagen</td>
			<td>74134</td>
			<td></td>
		</tr>
		<tr>
			<td>Sorvall Legend Micro 21R Centrifuge, Refrigerated</td>
			<td>ThermoFisher</td>
			<td>75002477</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR-Green iTaq Universal SYBR Green Supermix</td>
			<td>Bio-Rad</td>
			<td>172-5120</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue Solution</td>
			<td>ThermoFisher</td>
			<td>15250061</td>
			<td></td>
		</tr>
		<tr>
			<td>V450 Rat Anti-Mouse CD45</td>
			<td>BD Biosciences</td>
			<td>560501</td>
			<td></td>
		</tr>
		<tr>
			<td>V450 Rat IgG2b, &#954; Isotype Control</td>
			<td>BD Biosciences</td>
			<td>560457</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of murine retinal endothelial cells for next-generation sequencing

Recent improvements in next-generation sequencing have advanced researchers&#39; knowledge of molecular and cellular biology, with several studies revealing novel paradigms in vascular biology. Applying these methods to models of vascular development requires the optimization of cell isolation techniques from embryonic and postnatal tissues. Cell yield, viability, and purity all need to be maximal to obtain accurate and reproducible results from next-generation sequencing approaches. The neonatal mouse retinal vascularization model is used by researchers to study mechanisms of vascular development. Researchers have used this model to investigate mechanisms of angiogenesis and arterial-venous fate specification during blood vessel formation and maturation. Applying next-generation sequencing techniques to study the retinal vascular development model requires optimization of a method for the isolation of retinal endothelial cells that maximizes cell yield, viability, and purity. This protocol describes a method for murine retinal tissue isolation, digestion, and purification using fluorescence-activated cell sorting (FACS). The results indicate that the FACS-purified CD31+/CD45- endothelial cell population is highly enriched for endothelial cell gene expression and exhibits no change in viability for 60 min post-FACS. Included are representative results of next-generation sequencing approaches on endothelial cells isolated using this method, including bulk RNA sequencing and single-cell RNA sequencing, demonstrating that this method for retinal endothelial cell isolation is compatible with next-generation sequencing applications. This method of retinal endothelial cell isolation will allow for advanced sequencing techniques to reveal novel mechanisms of vascular development.

Digestion of retinal tissue and immunostaining for CD31 and CD45 results in an identifiable population of CD31+/CD45- endothelial cells after gating for cells, single cells, and viability (Figure 2A). CD45 immunostaining is required to eliminate CD31+/CD45+ cells, which include platelets and some leukocytes21. Controls should be performed for each experiment to show antibody specificity and guide gating strategy (Figure 2B). This percenta...

Watch this Scientific Journal Video about Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing at JoVE.com

Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing

This protocol describes a method for the isolation of murine postnatal retinal endothelial cells optimized for cell yield, purity, and viability. These cells are suitable for next-generation sequencing approaches.

Recent improvements in next-generation sequencing have advanced researchers&#39; knowledge of molecular and cellular biology, with several studies ...

This method of retinal endothelial cell isolation will allow for advanced sequencing techniques to reveal novel mechanisms of vascular development. The described protocol is optimized for high degrees of viability and purity, which are essential for next-generation sequencing applications. Demonstrating the procedure will be Shelby Cain, a graduate student from the Hershey Laboratory.Start removing eyes from the euthanized neonatal mouse by cutting away the skin and membrane over the eye with a perpendicular incision to the eyelid using dissection scissors. Then use the forceps to press down above and below the eye so that the eye moves out of the socket. Carefully pinch underneath the eye with the forceps and cut the optic nerve that keeps the eye attached.Then place both the eyes from the mouse in a well of the 48-well plate in the freshly prepared ice-cold PBS until finished harvesting. To isolate mouse retinal tissue, suspend the eyes in the dissection pad in a Petri dish filled with 500 microliters of ice-cold PBS using a transfer pipe pad with a wide tip. Working under the dissection microscope, hold the optic nerve with one fine forceps and use the second forceps to pierce the hole through the anterior chamber of the eye where the cornea and sclera connect.Then tear the hole in a circle about 75%of the way around the cornea. While holding the optic nerve with one forceps, use the second forceps to gently tear the sclera and the vitreous body off the retinal tissue. To remove lens and hyaloid plexus vessels, reach into the retina with open forceps until almost touching it and then close the forceps to grab and pull the lens and hyaloid plexus vessels out from the retina.When all vessels are removed, place the retinas in the two milliliter micro-centrifuge tubes filled with 500 microliters of one x ice-cold PBS. Remove excess PBS from the two milliliter micro-centrifuge tube with a pipette leaving about 100 microliters of PBS in the tube to completely cover the retinal tissue. Then add 500 microliters of the freshly prepared digestion solution to the tube.Use a P1000 pipetta and pipette tip to pipette up and down the retinal tissue in the digestion solution five times. When done, incubate the digestion mixture in a 37 degrees Celsius water bath for 20 minutes with pipetting the digestion mixture up and down every five minutes as explained before. After incubation, the retinal tissue will dissolve into a single cell suspension turning the digestion mixture cloudy.Next, pellet the cells by centrifugation at 375g for five minutes at four degrees Celsius. Following centrifugation, remove the PBS from the washed cell pellet by pipetting and then immunostain the cells by resuspending the pellet in 100 microliters of antibody staining solution per 0.5 times 10 to the sixth cells. Incubate the single cell suspension with the antibody staining solution for 30 minutes on ice in the dark with tapping the tube every 10 minutes to gently mix the cells.For fluorescence-activated cell sorting, pellet the cells by centrifugation at 375g for five minutes at four degrees Celsius. After removing the supernatant, wash and pellet the cells in 500 microliters of PBS as described before. And then resuspend the cells in 300 microliters of fluorescence-activated cell sorting or FACS buffer by gently mixing with the pipetta.Next, add propidium iodide or PI as a viability marker to the sample tubes containing the FACS buffer to get a final concentration of 0.5 micrograms per milliliter. Use a pipette to transfer the cell suspensions through a cell strainer snap cap containing a 35 micron filter into a five milliliter test tube. After filtration, keep the FACS tube on ice in the dark and then transfer the tube to the cell sorter.Turn on the FACS instrument and the computer and open the FACS software to run and operate the FACS instrument. Perform routine quality control tests. Load the control stain samples into the FACS instrument to adjust the axes.Start with IgG antibody only cells to generate and adjust forward scatter and side scatter. Then CD31 antibody only to generate and adjust CD31. And then CD45 antibody only to generate and adjust CD45.Record the data from the control samples. Next, load the stained sample cells into the FACS instrument and run the sample. Gait the cells based on forward scatter or FSC and side scatter or SSC parameters.Gait cells by FSCA and FSCH to identify cell doublets and only collect single cells. Gait cells by PI and SSCA to identify viable cells. Make a CD31+CD45-gait with controls Make a CD31+CD45-gait with controls and gait the cells by CD31 and CD45.Insert a collection tube with 250 microliters of FACS buffer in the instrument. Next, start sorting cells that are CD31+CD45-into the installed collection tube. Keep the collection tubes on ice for further analysis.The samples can be processed for next-generation sequencing applications. In the study, varying the digestion time affected the cell yield and viability percentage. The digestion time of 20 minutes resulted in an optimal yield with a low percentage of non-viable endothelial cells.Subsequent propidium iodide staining demonstrated that the isolated endothelial cells stayed viable for 60 minutes after isolation. Cell population purity was assessed by quantitative PCR or qPCRR analysis of the expression of endothelial cell genes showing strong enrichment for endothelial cell genes in the CD31+CD45-population. Purifying RNA from the isolated endothelial cells converting and amplifying cDNA through library preparation and sequencing The cDNA library resulted in more than 16, 000 genes identified in nine independent samples.A drop-off in transcripts per million reads or TPM was observed in genes below this threshold. The single cell RNA sequencing of the isolated retinal endothelial cells through the 10x Genomics pipeline resulted in a median of 1, 171 genes per cell, 15, 247 total genes detected, and a median of 2, 255 unique molecular identifier or UMI counts per cell in 917 cells. The critical steps in this protocol are retinal tissue isolation and tissue digestion, which should be performed accurately as described to optimize cell yield and viability.The isolated endothelial cells can be used in advanced sequencing techniques such as whole-transcriptome RNA sequencing, single cell RNA sequencing, chromatin immunoprecipitation sequencing, and assay for transposase-accessible chromatin sequencing. The use of this optimized method in combination with next-generation sequencing methods and by computational approaches can further elucidate the mechanisms of interconnected signaling pathways that regulate vascular developments.

Research

JoVE Journal

Developmental Biology

Efficient Derivation of Retinal Pigment Epithelium Cells from Stem Cells

No cure has been discovered for age-related macular degeneration  (AMD), the leading cause of vision loss in people over the age of 55. AMD is complex ...

Murine Dermal Fibroblast Isolation by FACS

Fibroblasts are the principle cell type responsible for secreting extracellular matrix and are a critical component of many organs and tissues. Fibroblast ...

Isolation of Murine Embryonic Hemogenic Endothelial Cells

The specification of hemogenic endothelial cells from embryonic vascular endothelium occurs during brief developmental periods within distinct tissues, ...

Isolation of Endothelial Progenitor Cells from Human Umbilical Cord Blood

The existence of endothelial progenitor cells (EPCs) in peripheral blood and its involvement in vasculogenesis was first reported by Ashara and ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

Preparation of Small RNA Libraries for Sequencing from Early Mouse Embryos

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs ...

Isolation of Endocardial and Coronary Endothelial Cells from the Ventricular Free Wall of the Rat Heart

It has been shown that endocardial endothelial cells (EECs) and coronary endothelial cells (CECs) differ in origin, development, markers, and functions. ...

Isolation of Murine Spermatogenic Cells using a Violet-Excited Cell-Permeable DNA Binding Dye

Isolation of meiotic spermatocytes is essential to investigate molecular mechanisms underlying meiosis and spermatogenesis. Although there are established ...