JoVE Logo
Authors
Contact Us

Sign In

A subscription to JoVE is required to view this content. Sign in or start your free trial.

In This Article

  • Summary
  • Abstract
  • Introduction
  • Protocol
  • Results
  • Discussion
  • Disclosures
  • Acknowledgements
  • Materials
  • References
  • Reprints and Permissions

Summary

This protocol describes a detailed workflow for the generation and ex vivo characterization of oncolytic viruses for expression of immunomodulators, using measles viruses encoding bispecific T cell engagers as an example. Application and adaptation to other vector platforms and transgenes will accelerate the development of novel immunovirotherapeutics for clinical translation.

Abstract

Successful cancer immunotherapy has the potential to achieve long-term tumor control. Despite recent clinical successes, there remains an urgent need for safe and effective therapies tailored to individual tumor immune profiles. Oncolytic viruses enable the induction of anti-tumor immune responses as well as tumor-restricted gene expression. This protocol describes the generation and ex vivo analysis of immunomodulatory oncolytic vectors. Focusing on measles vaccine viruses encoding bispecific T cell engagers as an example, the general methodology can be adapted to other virus species and transgenes. The presented workflow includes the design, cloning, rescue, and propagation of recombinant viruses. Assays to analyze replication kinetics and lytic activity of the vector as well as functionality of the isolated immunomodulator ex vivo are included, thus facilitating the generation of novel agents for further development in preclinical models and ultimately clinical translation.

Introduction

Oncolytic viruses (OVs) are being developed as anti-cancer therapeutics that specifically replicate within and kill tumor cells while leaving healthy tissues intact. It has now become common understanding that oncolytic virotherapy (OVT), in most cases, does not rely solely on complete tumor lysis by efficient replication and spreading of the virus, but requires additional mechanisms of action for treatment success, including vascular and stromal targeting and, importantly, immune stimulation1,2,3,4. While many early OV studies used unmodified viruses, current research has profited from an improved biological understanding, virus biobanks that potentially contain novel OVs, and the possibilities offered by genetic engineering in order to create advanced OV platforms5,6,7.

Given the recent success of immunotherapy, immunomodulatory transgenes are of particular interest regarding the genetic engineering of OVs. Targeted expression of such gene products by OV-infected tumor cells reduces toxicity compared to systemic administration. Targeting is achieved either by using viruses with inherent oncoselectivity or by modifying viral tropism8. Local immunomodulation enhances the multi-faceted anti-tumor mechanisms of OVT. Furthermore, this strategy is instrumental in interrogating the interplay between viruses, tumor cells, and the host immune system. To this end, this protocol provides an applicable and adjustable workflow to design, clone, rescue, propagate, and validate oncolytic paramyxovirus (specifically measles virus) vectors encoding such transgenes.

Modulation of the immune response can be achieved by a wide variety of transgene products targeting different steps of the cancer-immunity cycle9, including enhancing tumor antigen recognition [e.g., tumor-associated antigens (TAAs) or inducers of major histocompatibility complex (MHC) class I molecules] over supporting dendritic cell maturation for efficient antigen presentation (cytokines); recruiting and activating desired immune cells such as cytotoxic and helper T cells [chemokines, bispecific T cell engagers (BTEs)]; targeting suppressive cells such as regulatory T cells, myeloid-derived suppressor cells, tumor-associated macrophages, and cancer-associated fibroblasts (antibodies, BTEs, cytokines); and preventing effector cell inhibition and exhaustion (checkpoint inhibitors). Thus, a plethora of biological agents is available. Evaluation of such virus-encoded immunomodulators regarding therapeutic efficacy and possible synergies as well as understanding of respective mechanisms is necessary to improve cancer therapy.

Negative sense single-stranded RNA viruses of the Paramyxoviridae family are characterized by several features conducive to their use as oncolytic vectors. These include a natural oncotropism, large genomic capacity for transgenes (more than 5 kb)10,11, efficient spreading including syncytia formation, and high immunogenicity12. Therefore, OV platforms based on canine distemper virus13, mumps virus14, Newcastle disease virus15, Sendai virus16,17, simian virus 518, and Tupaia paramyxovirus19 have been developed. Most prominently, live attenuated measles virus vaccine strains (MV) have progressed in preclinical and clinical development20,21. These virus strains have been used for decades for routine immunization with an excellent safety record22. Moreover, there is no risk for insertional mutagenesis due to the strictly cytosolic replication of paramyxoviruses. A versatile reverse genetics system based on anti-genomic cDNA which allows for insertion of transgenes into additional transcription units (ATUs) is available11,23,24. MV vectors encoding sodium-iodide symporter (MV-NIS) for imaging and radiotherapy or soluble carcinoembryonic antigen (MV-CEA) as a surrogate marker for viral gene expression are currently being evaluated in clinical trials (NCT02962167, NCT02068794, NCT02192775, NCT01846091, NCT02364713, NCT00450814, NCT02700230, NCT03456908, NCT00408590, and NCT00408590). Safe administration has been confirmed and cases of anti-tumor efficacy have been reported in previous studies25,26,27,28,29,30 (reviewed by Msaouel et al.31), paving the way for additional oncolytic measles viruses that have been developed and tested preclinically. MV encoding immunomodulatory molecules targeting diverse steps of the cancer-immunity cycle have been shown to delay tumor growth and/or prolong survival in mice, with evidence for immune-mediated efficacy and long-term protective immune memory in syngeneic mouse models. Vector-encoded transgenes include granulocyte-macrophage colony stimulating factor (GM-CSF)32,33, H. pylori neutrophil-activating protein34, immune checkpoint inhibitors35, interleukin-12 (IL-12)36, TAAs37, and BTEs38, which cross-link a tumor surface antigen with CD3 and thus induce anti-tumor activity by polyclonal T cells, irrespective of T cell receptor specificity and co-stimulation (Figure 1). The promising preclinical results obtained for these constructs demand further translational efforts.

Talimogene laherparepvec (T-VEC), a type I herpes simplex virus encoding GM-CSF, is the only oncolytic therapeutic approved by the United States Food and Drug Administration (FDA) and European Medicines Agency (EMA). The phase III study leading to approvals in late 2015 has not only shown efficacy at the site of intra-tumoral injection, but also abscopal effects (i.e., remissions of non-injected lesions) in advanced melanoma39. T-VEC has since entered additional trials for application in other tumor entities (e.g., non-melanoma skin cancer, NCT03458117; pancreatic cancer, NCT03086642) and for evaluation of combination therapies, especially with immune checkpoint inhibitors (NCT02978625, NCT03256344, NCT02509507, NCT02263508, NCT02965716, NCT02626000, NCT03069378, NCT01740297, and Ribas et al.40).

This demonstrates not only the potential of oncolytic immunotherapy but also the need for further research to identify superior combinations of OVT and immunomodulation. Rational design of additional vectors and their development for preclinical testing is key to this undertaking. This will also advance understanding of underlying mechanisms and has implications for the progression towards more personalized cancer treatment. To this end, this publication presents the methodology for the modification and development of paramyxoviruses for targeted cancer immunotherapy and, more specifically, of oncolytic measles viruses encoding T cell-engaging antibodies (Figure 2).

Access restricted. Please log in or start a trial to view this content.

Protocol

NOTE: [O], [P], and [M] indicate subsections applicable to: OVs in general, (most) paramyxoviruses, or MV only, respectively. [B] indicates sections specific for BTE transgenes.

1 Cloning of Immunomodulator-encoding Transgenes into Measles Virus Vectors

  1. [O] Design insert sequence.
    1. [O] Decide on an immunomodulator of interest based on literature research or on exploratory data such as genetic screens41 and derive the relevant cDNA sequence from appropriate databases such as GenBank, the European Nucleotide Archive, or the international ImMunoGeneTics information system (IMGT).
    2. [O] Add additional features to the transgene sequence (Figure 3). A preceding Kozak sequence and species-specific codon optimization can enhance expression. Signal sequences are required for secretion. Include sequences encoding N- and/or C-terminal protein tags for detection and purification42. Include restriction sites for insertion into the vector.
      NOTE: [M] Additional transcription units (ATUs) harboring MV polymerase gene start and stop signals are necessary for transgene expression from recombinant MV genomes. Suitable anti-genomic cDNA vectors, controlled by CMV promoters and containing ATUs with unique restriction sites for introduction of positive sense transgenes at defined positions, have been developed previously11. [P] Adequate positioning of the transgene is crucial, as it affects viral replication and transgene expression due to the expression gradient typical for paramyxoviruses43. Introduction into an ATU close to the 3' end of the anti-genome (i.e., in the leader position or downstream of the P gene) generally results in high transgene expression at the cost of reduced viral replication. Increased replication and lower levels of transgene expression can be expected when using the ATU downstream of the H gene. Packaging of the genome of several paramyxoviruses, including measles virus, requires binding of six nucleotides by each nucleocapsid protein44. For insertion of transgenes into such viruses, ensure that the number of nucleotides of the complete genome will be divisible by six. This is also referred to as "rule of six"45,46. If necessary, include additional nucleotides in the insert (upstream of the Kozak sequence or downstream of the stop codon) without introducing frame shifts or premature stop codons. [M] Avoid particular sequences in the transgene that are similar to MV gene start (AGGRNCMARGW) and stop (RTTAWANAAAA) signals and RNA editing sequences (AAAAAGGG). Such consensus sequences have been published (e.g., see Parks et al.47).
    3. [O] Purchase oligonucleotide of the desired sequence or assemble from available sequences using standard molecular cloning48.
      NOTE: [O] For PCR amplification of the transgene, design a forward primer including the upstream restriction site and the first 15-20 nucleotides of the insert and a reverse primer including the last 15-20 nucleotides of the insert followed by the downstream restriction site.
  2. [O] Clone insert into DNA encoding the viral (anti-)genome.
    1. [O] Clone the insert into DNA vectors or DNA anti-genomes of RNA viruses by standard molecular cloning techniques48 (i.e., enzymatic restriction followed by DNA ligation).
      1. [O] Prevent re-ligation of the vector by using non-compatible restriction sites or by de-phosphorylation prior to ligation.
      2. [O] Isolate the ligation product by agarose gel electrophoresis and subsequent gel purification using commercially available kits. In general, optimal ligation efficiency is achieved at a 3:1 molar ratio of insert to vector.
    2. [O] Transform the ligation product into competent bacteria suited for efficient recovery of large plasmids (i.e., perform heat shock of E. coli49) and identify bacterial clones harboring the correct DNA by colony PCR50.
    3. [O] Isolate amplified DNA from a single bacterial clone using commercially available DNA preparation kits. Confirm genomic integrity by control digest with appropriate restriction enzymes (e.g., HindIII for MV genomes [M]). Confirm correct insertion and integrity of the transgene by sequencing.
      NOTE: [M] For transgenes inserted in the MV H-ATU, perform Sanger sequencing with the following primers: H-9018 [forward primer, binds to MV genome position 9018 in the H open reading frame (ORF)]: 5' GTGTGCTTGCGGACTCAGAATC 3'; L-9249+ (reverse primer, binds to MV genome position 9249 in the L ORF): 5' CAGATAGCGAGTCCATAACGG 3'.

2. Rescuing Recombinant Measles Virus Particles Encoding Immunomodulators

  1. [O] Generate recombinant virus particles from (anti-)genomic DNA via transfection of virus producer cells according to the standard protocol for the respective virus. Follow guidelines for working under sterile conditions. Perform cell culture under hoods, in particular all steps involving virus in class II biological safety cabinets.
    1. [M] For rescue of measles viruses from cDNA23,24, plate MV producer (African green monkey kidney-derived Vero) cells evenly on a 6-well plate 24 h before transfection. Seed 2 x 105 cells in 2 mL Dulbecco's Modified Eagle's Medium (DMEM) containing 10% fetal bovine serum (FBS) per well to achieve 65–75% confluency at the time of transfection.
      NOTE: [P] Reduce cell numbers if the cells overgrow prior to virus-induced syncytia formation.
    2. [P] Transfect the cells with DNA encoding the viral anti-genome, required helper plasmids, and, if desired, a plasmid encoding a fluorescent reporter to assess transfection efficiency.
      1. [M] Mix 5 µg of recombinant DNA encoding the measles virus anti-genome, 500 ng each of mammalian expression plasmids encoding measles virus N and L proteins, and 100 ng each of plasmids encoding P protein and a fluorescent reporter in a total volume of 200 µL DMEM.
      2. Add 18.6 µL of liposomal transfection reagent, immediately mix by flicking the tube, and incubate for 25 min at room temperature (RT).
      3. [P] Replace the medium with 1.8 mL of DMEM, 2% FBS, 50 µg/mL kanamycin (or other antibiotics to prevent contamination) per well, then add the transfection mix dropwise to the well and swirl carefully. Incubate cells overnight at 37 °C, 5% CO2. Replace medium with 2 mL of fresh DMEM, 2% FBS, and 50 µg/mL kanamycin the next day; repeat this when medium becomes acidic.
        CAUTION: [O] Handle cells and materials according to biosafety regulations, as virus may be present from transfection through the following steps. Dispose of (potentially) infectious waste appropriately.
  2. [P] Collect and propagate virus particles.
    1. [P] Observe cells daily by microscopy for reporter gene expression and syncytia formation (Figure 4). Harvest virus when large syncytia, consisting of 20 or more cells, are visible, or when cells become too dense (i.e., when they start to grow in multiple layers, typically after 7–9 days).
      NOTE: [P] If no syncytia are observed for a given vector construct, this does not necessarily mean that the rescue has failed. As infectious virus may nevertheless be present in the sample, transfer to fresh producer cells for passaging.
    2. [P] Seed approximately 1.5 x 106 producer cells in 12 mL of DMEM with 10% FBS, on 10 cm dishes 24 h before the anticipated harvest, or 2.5 x 106 cells per plate 4–6 h prior to passaging of the virus to achieve 65-75% confluency at the time of virus inoculation.
    3. [P] To collect virus progeny, carefully scrape adherent producer cells from the plate using a cell scraper and transfer the supernatant containing cells into a centrifuge tube. Remove cell debris by centrifugation for 5 min at 2,500 x g and 4 °C.
      NOTE: Scraped cells may be transferred directly without centrifugation to maximize virus carryover at the cost of suboptimal culture conditions and potential microscopy artifacts.
      CAUTION: [O] Avoid spilling media when scraping cells. Minimize aerosol formation.
    4. [P] Prepare inoculum by mixing the cell-free supernatant from step 2.2.3 with serum-free medium to a final volume of 4 mL. Replace the medium on producer cells by the inoculum and incubate cells for at least 2 h at 37 °C and 5% CO2. Add 6 mL of DMEM with 10% FBS and incubate cells overnight before changing the medium to 12 mL of fresh DMEM with 10% FBS.
    5. [P] Observe the cells at least twice daily and harvest virus before syncytia burst (i.e., when membrane disruption becomes visible). To harvest the first passage of virus, remove supernatant from the plate, add 600 µL of serum-free medium, scrape cells with a cell lifter, and transfer to a clean tube.
      NOTE: [M] Depending on virus strain51,52 and progression of infection, transfer plates with infected cells to 32 °C to facilitate viral replication and spread. In general, MV Schwarz strains propagate well at 37 °C, while transfer of cells infected with Edmonston B strain viruses to 32 °C results in slower syncytia formation but higher titers.
      NOTE: [P] Do not allow the cell layer to dry during harvest, as this will result in reduced infectivity of viral particles. Although some virus is lost when discarding the supernatant of infected cells, higher titers can be obtained from the cell layer.
    6. [P] Immediately freeze the virus suspension in liquid nitrogen. Store at -80 °C for at least 24 h to ensure thorough freezing. Extend to several days to interrupt the procedure, if needed.
    7. Release viral particles by thawing at 37 °C. Homogenize by vortexing, and centrifuge for 5 min at 2,500 x g and 4 °C. Transfer the supernatants to labeled cryotubes and store at -80 °C.
      NOTE: [O] Store viruses in aliquot sizes adequate for later experiments, as they are preferentially thawed only once and used immediately. [P] Further freeze-thaw cycles or storage at 4 °C over several days result in significant reduction of viral titers.
    8. [P] One day prior to further passaging to achieve required amount and titer, seed 4 x 106 producer cells in 12 mL of DMEM with 10% FBS on 15 cm dishes. Inoculate with virus at a multiplicity of infection (MOI) of 0.03. Infect in 8 mL of serum-free medium per plate and change medium to DMEM with 10% FBS after incubating cells for at least 2 h. Scale up by using multiple plates.
    9. Harvest as described in step 2.2.5, when syncytia have spread across the whole cell layer. Pool the obtained suspensions in 50 mL tubes and process as described in steps 2.2.6–2.2.7.
      NOTE: [O] It is crucial to check all plates visually for bacterial and fungal contamination before harvesting. In general, check all cell lines regularly for contamination with mycoplasma or adventitious viruses by multiplex PCR.
  3. [P] Evaluate viral titers. Determine titers of virus stocks in octuplicates per aliquot using 96-well plates. Perform titration of three individual aliquots per virus rescue and use the average value to calculate the amount of virus suspension to be used in experiments.
    1. [P] Pool the producer cells, count, and adjust to 1.5 x 105 cells per mL in DMEM with 10% FBS.
    2. [P] Pipet 90 µL of DMEM with 10% FBS into each well of a 96-well plate.
    3. [P] Add 10 µL from one aliquot of the virus stock to all 8 wells in the first column of the plate and mix thoroughly by pipetting up and down at least 10 times.
    4. [P] Perform serial 10-fold dilutions of the virus. Transfer 10 µL of each well from the first to the second column using a multichannel pipet. Mix thoroughly by pipetting up and down and use fresh pipet tips for each dilution step. Discard 10 µL from each well of the last column.
      NOTE: Each 96-well plate allows for 12 serial dilution steps. [M] For MV vectors, 8 steps of 10-fold dilutions are typically sufficient, as titers above 1 x 109 cell infectious units (ciu)/mL are rarely obtained by the method of propagation described in step 2.2. [P] Control wells without virus can be used for comparison and to monitor contamination.
    5. [P] Add 100 µL of cell suspension to each well and incubate at 37 °C, 5% CO2 for 48 h. Ensure the absence of cell clumps in the suspension to achieve homogenous distribution of cells.
    6. [P] Check for syncytia using a light microscope. Count syncytia in each well of the column with the highest dilution factor containing visible syncytia.
    7. [P] Calculate the average number of syncytia per well in that column by dividing the total number of syncytia by eight. Multiply that average with the dilution factor of the respective column, starting at 102 ciu per mL for the first column53 (see Figure 5 as an example).

3. Determining Replicative and Cytotoxic Capacities of Viral Vectors Encoding Immunomodulators

  1. [O] Compare replication kinetics of the generated recombinant virus and the unmodified vector with one-step or multi-step growth curves (GCs). For one-step GCs, viral progeny are assessed following simultaneous infection of all cells (theoretically, 100% infection). Multi-step GCs start at a low percentage of infected cells to follow several rounds of virus replication.
    1. [M] For analysis of measles virus replication kinetics, seed 1 x 105 Vero cells in 1 mL of DMEM with 10% FBS per well on 12-well plates one day prior to infection. Plate at least two wells for each timepoint of interest as technical replicates.
    2. [O] Infect the cells with virus at low MOI for multi-step or at high MOI for one-step GCs [M] (0.03 and 3 for MV replication on Vero cells, respectively). Replace medium with 300 µL of serum-free medium containing the respective amount of virus and incubate at 37 °C and 5% CO2 for at least 2 h. Remove inoculum, add 1 mL of DMEM with 10% FBS, and continue incubation.
    3. [P] At relevant timepoints such as 12, 24, 36, 48, 72, and 96 h after infection, harvest viral progeny by directly scraping cells into the medium. Transfer contents from each well to an individual tube, snap-freeze in liquid nitrogen and store at -80 °C until titration.
      NOTE: [P] Replicate samples may be pooled at this step for analysis of average titers.
    4. [P] Collect samples from all timepoints. Thaw simultaneously at 37 °C for assessment of viral progeny. Vortex and pellet cell debris by centrifugation for 5 min at 2,500 x g and 4 °C.
    5. [P] Calculate average titers of each construct and timepoint as described above. Plot titers over time. Compare growth curves of vectors with and without inserted transgenes, with different transgenes, or with transgenes inserted at different positions (see Figure 6A).
  2. [O] Compare lytic activities of immunomodulator-encoding and unmodified viruses.
    1. [O] Select from possible methodologies including impedance measurements, lactate dehydrogenase (LDH) release assay, or metabolism-based colorimetric cell viability assays [e.g., 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT) and 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) assays].
      1. [M] To analyze cytotoxicity of measles virus vectors using XTT assay, seed Vero cells as described in step 3.1.1. Include replicates of a non-infected control for each timepoint.
        NOTE: [O] Performing XTT assay at different timepoints on the same sample can limit technical errors, but repeated washing and exposure to XTT reagent affects numbers of viable cells. Impedance provides an alternative readout for continuous measurements.
    2. [M] Infect Vero cells at an MOI of 1 as described in step 3.1.2.
      NOTE: [M] For infection of less permissive target cells such as some murine tumor cell lines, a higher MOI of 3 or 5 may be necessary.
    3. [O] At timepoints of interest (e.g., 12, 24, 36, 48, 72, and 96 h after infection) prepare the required amount of XTT reagent (i.e., 300 µL per well plus 10% excess). Avoid light exposure.
    4. [M] At each timepoint, remove medium from respective wells. Replace by 300 µL of XTT reagent and incubate at 37 °C in the dark. Collect supernatants when the reagent in the control wells has turned deep red, which typically takes between 15 min and 2 h, and freeze at -20 °C.
      NOTE: [O] Incubation times depend on virus construct, cell type, density, and cytopathic effect.
    5. [O] After collecting all samples, thaw simultaneously. Transfer 100 µL of each sample to a 96-well plate and measure optical absorbance at 450 nm, with 630 nm as a reference wavelength.
    6. [O] Plot timepoints (x-axis) vs. optical absorbance of samples relative to controls, indicating metabolic activity as a surrogate for cell viability (y-axis). Decreasing relative absorbance over time implies viral cytotoxicity (see Figure 6B).

4. Analyzing Activity of Virus-encoded Immunomodulators Secreted from Infected Cells

  1. [O] Isolate secreted transgene products expressed by virus-infected target cells.
    1. [P] Let virus producer cells grow to 70% confluency in T175 flasks.
    2. [P] Remove medium from cells and wash twice with 12 mL of PBS to remove serum. Inoculate cells with virus at an MOI of 0.03 in 12 mL of serum-free medium and incubate at 37 °C and 5% CO2 overnight. Replace medium with 12 mL of fresh serum-free medium.
      1. [M] For Edmonston B viruses, transfer cells from 37 to 32 °C after 40 h for another 24 h of incubation to facilitate infection and prevent premature bursting of syncytia. Depending on virus strain51,52 and syncytia progression, incubation temperatures and times may be adjusted for optimal protein yield and purity.
    3. [P] Carefully collect supernatants without detaching cells before syncytia burst. Optimally, syncytia have spread across the entire cell layer. Pool supernatants in 50 mL tubes.
      NOTE: [P] For efficient purification of the transgene product, avoid bursting of syncytia and minimize cell debris when harvesting the supernatants of infected cells.
    4. [P] Remove cell debris from the supernatant by centrifugation for 5 min at 2,500 x g and 4 °C and passing through 0.22 µm filters. Depending on the total volume of the filtrate, this can be performed using a syringe or a vacuum pump.
    5. [O] Isolate transgene product using an appropriate purification method. Purify proteins with a hexa-histidine (His) tag by affinity exchange chromatography using Ni-NTA mini spin columns38 as described here in brief (steps 4.1.5.1–4.1.5.4).
      NOTE: [O] Perform all steps fast and on ice. Pre-chill buffers and pre-cool centrifuge to 4 °C.
      1. [O] Prepare 100 mL each of buffer with PBS, 200 mM sodium chloride and imidazole at final concentrations of 10 mM (washing buffer 1, WB1), 20 mM (washing buffer 2, WB2), and 500 mM (elution buffer, EB). Adjust pH of WB1 and WB2 to 8.0 and of EB to 7.0. Depending on the protein to be purified, imidazole concentrations may have to be adjusted.
      2. [O] Equilibrate columns with 600 µL of WB1 and centrifuge at 800 x g for 2 min with an open lid.
      3. [O] Load 600 µL of filtered supernatants onto columns. Allow binding of His-tagged proteins to the column matrix by centrifugation at 200 x g for 5 min with a closed lid. Loading and binding can be repeated up to a total of 300 µg His-tagged protein per column.
      4. [O] Wash thrice with WB1 and once with WB2, or until the flow-through is colorless. Add 600 µL of buffer and spin at 800 x g for 2 min with open lid.
      5. [O] Elute protein into a fresh tube by performing two elution steps with 300 µL of EB and centrifugation for 2 min at 800 x g.
      6. [O] Desalt and concentrate product using centrifugal filters according to product size. Add PBS to a volume of 15 mL and filter via centrifugation for 10 min at 4,000 x g. Repeat until the desired purity and concentration is achieved. To increase protein concentration, reduce the final volume to approximately 200 µL by centrifugation for 40 min at 4,000 x g.
  2. [O] Confirm purity and identity of the product.
    1. [O] Quantify the amount of total protein in the isolates using standard colorimetric assays such as bicinchoninic acid (BCA) or Bradford assay54,55. [M] Typical values can range from 1–3 µg transgene product per mL supernatant of infected cells.
    2. [O] For relative quantification of protein isolates, separate via sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and perform Coomassie staining56.
    3. [O] Confirm identity of the purified products by immunoblotting using specific antibodies targeting the protein or an associated peptide tag57.
    4. [O] Analyze protein binding specificity using appropriate techniques that may include enzyme-linked immunosorbent assay (ELISA) or flow cytometry (see Figure 7). Cell binding can be confirmed using a recently described magnetic pulldown assay38.
      NOTE: [O] Use appropriate controls. In cell binding assays, include negative controls with cells not expressing the targeted molecule (as in Figure 9) and non-targeting protein surrogates (Figure 8). In flow cytometry experiments, include positive, negative and isotype controls (Figure 7).
      1. [O] Co-incubate the target cells and protein isolate to allow binding. [B] For binding analysis of BTEs to peripheral blood mononuclear cells (PBMCs) isolated from human blood58, incubate 2.5 x 106 cells with 200 ng of BTE in 100 µL of PBS with 1% FBS (binding buffer, BB) for 1 h on ice.
      2. [B] Wash cells with 1 mL of BB to remove unbound protein. Centrifuge at 300 x g for 5 min, discard supernatant, and resuspend pellet in 100 µL of BB. Add biotinylated antibody targeting either the protein of interest or an associated peptide tag and incubate on ice for 30 min. For BTEs with influenza hemagglutinin (HA) tag, use 100 ng of anti-HA-Biotin (clone 3F10).
      3. [B] Wash cells twice with 1 mL of BB and resuspend in 80 µL of BB. Add 20 µL of streptavidin-coupled magnetic microbeads and incubate for 15 min at 4 °C.
      4. [B] Wash once to remove excess beads and resuspend pellet in 500 µL of BB supplemented with 2 mM EDTA (column buffer, CB).
      5. [B] Isolate cells with columns and a magnetic stand according to the provider's manual.
        1. [B] Equilibrate by allowing 500 µL of CB to pass through the column by gravity flow.
          NOTE: [B] The column must never run dry. Pipet carefully and degas the buffers to avoid bubbles.
        2. [B] Place a clean tube under the column and apply the cell/bead suspension to the column. Wash the column three times with 500 µL of CB per wash. Collect flow-through samples of the suspension and of at least the first washing step in the tube, then store on ice.
        3. [B] Elute bead-bound cells retained by the magnetic field. To this end, remove the column from the magnetic stand, place it over a clean tube, add 1 mL of CB, and quickly push the buffer through the column into the tube using a plunger. Keep the tube on ice.
      6. [B] Centrifuge tubes containing flow-through and elution samples for 20 min at 16,000 x g and 4 °C to pellet cells. Discard supernatants and lyse cells in a radioimmunoprecipitation assay (RIPA) buffer (suggested: 75 µL). Perform SDS-PAGE56.
      7. [B] Perform immunoblotting using a suitable primary antibody. Antibodies may target the transgene product or a cellular protein (e.g., β-actin, Figure 8) to assess BTE-cell binding.
  3. [O] Assess immunological functionality of isolated immunomodulators.
    1. [O] Identify relevant assays according to the characteristics of the encoded immunomodulator. Regarding the expected immunomodulatory activity, methods assessing cell proliferation, migration, maturation, activation, or cytotoxicity may be applied.
      NOTE: [O] Cell proliferation can be analyzed by CFSE59 labeling or Ki67 staining60. Transwell or scratch experiments are available to analyze cell migration61. Maturation and activation of cells can be assessed using appropriate staining protocols for respective markers. [B] Available techniques to assess BTE-mediated cellular cytotoxicity include impedance measurements and chromium release assay. If opting for chromium release assay, observe proper safety measures when handling radioactive material.
    2. [B] As a non-radioactive alternative, the following describes in detail how to evaluate BTE-induced, cell-mediated cytotoxicity by LDH release assay (described previously in brief38).
      1. [B] Decide on conditions to be tested during the experiment (see Figure 9 as an example). Timepoints (hours to days), concentrations of the immunomodulator (pg/mL to µg/mL) and effector to target cell (E:T) ratios (between 1:50 and 50:1, for example) can be varied. Always prepare samples in triplicates.
      2. [B] Include samples without protein and without effector cells, controls for spontaneous LDH release of the single cell types (Tsp and Esp), a target cell maximum lysis control (Tmax) with detergent added before readout, a medium only control, and a volume control for Tmax.
        NOTE: [B] Required numbers of target cells and incubation times can vary. Perform initial test runs without effector cells and immunomodulators to identify optimal parameters. Include Tsp and Tmax samples and corresponding controls to assess different cell numbers and timepoints.
      3. [B] Isolate immune effector cells (e.g., by density gradient centrifugation of human blood to obtain PBMCs58 or negative selection of murine T cells from mouse splenocytes62).
      4. [B] Seed target cells according to step 4.3.2 (e.g., 5 x 10³ per well) in a U-bottom 96-well plate.
      5. [B] Add the isolated protein at desired concentrations to the respective samples. Add immune effector cells at desired ratios. Add medium to a total volume of 100 µL per well.
      6. [B] Incubate for the time frame determined in step 4.3.2, typically between 4 and 48 h (24 h for unstimulated PBMCs and 48 h for freshly isolated murine T cells; shorter incubation times can apply for prestimulated immune cells), at 37 °C and 5% CO2.
      7. [B] 45 minutes before collecting the samples, add 10 µL of 10x lysis solution to wells containing Tmax samples and the corresponding medium controls. Continue incubation.
      8. [B] Spin down cells at 250 x g for 4 min. Transfer 50 µL of each supernatant to a flat-bottom 96-well plate. Do not transfer cells to avoid cell-bound LDH.
      9. [B] Prepare substrate solution according to the manufacturer. Add 50 µL to each well and incubate at RT in the dark for 30 min or until Tmax samples turn deep red.
      10. [B] Add 50 µL of stop solution to each well. Remove air bubbles by centrifugation for 1 min at 4,000 x g, and manually with a hollow needle. Measure optical absorbance at 490 nm.
      11. [B] Calculate % specific lysis values for each sample.
        1. [B] Calculate averages for replicates of medium controls with and without lysis solution. Subtract obtained values from experimental samples and from Tmax and spontaneous release controls, respectively. Use these background-corrected values for further calculations.
        2. [B] Calculate averages for background-corrected Tmax, Tsp, and Esp controls. Using these average values, the following equation yields the percentage of specific lysis for each sample:

          figure-protocol-30870
        3. [B] Plot % specific lysis values vs. protein concentration or E:T ratio and compare to the non-targeting control samples.

Access restricted. Please log in or start a trial to view this content.

Results

Figure 1 illustrates the mechanism of action of oncolytic measles viruses encoding bispecific T cell engagers. A flowchart depicting the workflow of this protocol is presented in Figure 2. Figure 3 shows an example of a modified oncolytic measles virus genome. This provides a visual representation of the specific changes applied to the measles virus anti-genome and particular fe...

Access restricted. Please log in or start a trial to view this content.

Discussion

Oncolytic immunotherapy (i.e., OVT in combination with immunomodulation) holds great promise for cancer treatment, demanding further development and optimization of oncolytic viruses encoding immunomodulatory proteins. This protocol describes methods to generate and validate such vectors for subsequent testing in relevant preclinical models and potential future clinical translation into novel anti-cancer therapeutics.

Numerous different oncolytic virus platforms with distinct advantag...

Access restricted. Please log in or start a trial to view this content.

Disclosures

C.E. Engeland is listed as co-inventor of a patent regarding RNA Viruses for Cancer Immunovirotherapy owned by Heidelberg University. J.P.W. Heidbuechel has nothing to disclose.

Acknowledgements

These methods were established in the Virotherapy Group led by Prof. Dr. Dr. Guy Ungerechts at the National Center for Tumor Diseases in Heidelberg. We are indebted to him and all members of the laboratory team, especially Dr. Tobias Speck, Dr. Rūta Veinalde, Judith Förster, Birgit Hoyler, and Jessica Albert. This work was supported by the Else Kröner-Fresenius-Stiftung (Grant 2015_A78 to C.E. Engeland) and the German National Science Foundation (DFG, grant EN 1119/2-1 to C.E. Engeland). J.P.W. Heidbuechel receives a stipend by the Helmholtz International Graduate School for Cancer Research.

Access restricted. Please log in or start a trial to view this content.

Materials

NameCompanyCatalog NumberComments
Rapid DNA Dephos & Ligation KitRoche Life Science, Mannheim, Germany4898117001
CloneJET PCR Cloning KitThermo Fisher Scientific, St. Leon-RotK1231
AgaroseSigma-Aldrich, Taufkirchen, GermanyA9539-500G
QIAquick Gel Extraction KitQIAGEN, Hilden, Germany28704
NEB 10-beta Competent E. coliNew England Biolabs (NEB), Frankfurt/Main, GermanyC3019I
LB medium after LennoxCarl Roth, Karlsruhe, GermanyX964.1
AmpicillinCarl Roth, Karlsruhe, GermanyHP62.1
QIAquick Miniprep KitQIAGEN, Hilden, Germany27104
Restriction enzyme HindIII-HFNew England Biolabs (NEB), Frankfurt/Main, GermanyR3104S
Dulbecco's Modified Eagle's Medium (DMEM)Invitrogen, Darmstadt, Germany31966-021
Fetal bovine serum (FBS)Biosera, Boussens, FranceFB-1280/500
FugeneHDPromega, Mannheim, GermanyE2311may be replaced by transfection reagent of choice
KanamycinSigma-Aldrich, Taufkirchen, GermanyK0129
Vero cellsATCC, Manassas, VA, USACCL81
B16-CD46/ B16-CD20-CD46J. Heidbuechel, DKFZ Heidelbergavailable upon request
Granta-519DSMZ, Braunschweig, GermanyACC 342
Opti-MEM (serum-free medium)Gibco Life Technologies, Darmstadt, Germany31985070
Colorimetric Cell Viability Kit III (XTT)PromoKine, Heidelberg, GermanyPK-CA20-300-1000includes XTT reagent
Dulbecco's Phosphate-Buffered Saline (PBS)Gibco Life Technologies, Darmstadt, Germany14190-094
QIAquick Ni-NTA Spin ColumnsQIAGEN, Hilden, Germany31014
Sodium chlorideCarl Roth, Karlsruhe, Germany3957.3
ImidazoleCarl Roth, Karlsruhe, GermanyI5513-25G
Amicon Ultra-15, PLGC Ultracel-PL Membran, 10 kDaMerck, Darmstadt, GermanyUFC901024
BCA Protein Assay KitMerck Milipore71285-3
IgG from human serumSigma-Aldrich, Taufkirchen, GermanyI4506
Anti-HA-PEMiltenyi Biotech, Bergisch Gladbach, Germany130-092-257RRID: AB_871939
Mouse IgG1, kappa Isotype Control, Phycoerythrin Conjugated, Clone MOPC-21 antibodyBD Biosciences, Heidelberg, Germany555749RRID: AB_396091
Anti-HA-biotin antibody, clone 3F10Sigma-Aldrich, Taufkirchen, Germany12158167001RRID: AB_390915
Anti-Biotin MicroBeadsMiltenyi Biotech, Bergisch Gladbach, Germany130-090-485
MS ColumnsMiltenyi Biotech, Bergisch Gladbach, Germany130-042-201
MiniMACS SeparatorMiltenyi Biotech, Bergisch Gladbach, Germany130-042-102
MACS MultiStandMiltenyi Biotech, Bergisch Gladbach, Germany130-042-303
RIPA bufferRockland Immunochemicals, Gilbertsville, PA, USAMB-030-0050
CytoTox 96 Non-Radioactive Cytotoxicity AssayPromega, Mannheim, GermanyG1780includes 10x lysis solution, substrate solution (substrate mix and assay buffer), and stop solution
Cell lifterCorning, Reynosa, Mexico3008
10 cm dishesCorning, Oneonta, NY, USA430167
15 cm dishesGreiner Bio-One, Frickenhausen, Germany639160
96-well plates, U-bottomTPP, Trasadingen, Switzerland92097
96-well plates, flat bottomNeolab, Heidelberg, Germany353072
6-well platesNeolab, Heidelberg, Germany353046
12-well platesNeolab, Heidelberg, Germany353043
50 mL tubesnerbe plus, Winsen/Luhe, Germany02-572-3001
T175 cell culture flasksThermo Fisher Scientific, St. Leon-Rot159910
0.22 µm filtersMerck, Darmstadt, GermanySLGPM33RS

References

  1. Lichty, B. D., Breitbach, C. J., Stojdl, D. F., Bell, J. C. Going viral with cancer immunotherapy. Nature Reviews Cancer. 14 (8), 559-567 (2014).
  2. Cassady, K. A., Haworth, K. B., Jackson, J., Markert, J. M., Cripe, T. P. To Infection and Beyond: The Multi-Pronged Anti-Cancer Mechanisms of Oncolytic Viruses. Viruses. 8 (2), (2016).
  3. Twumasi-Boateng, K., Pettigrew, J. L., Kwok, Y. Y. E., Bell, J. C. Oncolytic viruses as engineering platforms for combination immunotherapy. Nature Reviews Cancer. , (2018).
  4. Achard, C., et al. Lighting a Fire in the Tumor Microenvironment Using Oncolytic Immunotherapy. EBioMedicine. 31, 17-24 (2018).
  5. Kelly, E., Russell, S. J. History of oncolytic viruses: genesis to genetic engineering. Molecular Therapy. The Journal of the American Society of Gene Therapy. 15 (4), 651-659 (2007).
  6. Russell, S. J., Peng, K. W., Bell, J. C. Oncolytic virotherapy. Nature Biotechnology. 30 (7), 658-670 (2012).
  7. Russell, S. J., Peng, K. W. Oncolytic Virotherapy: A Contest between Apples and Oranges. Molecular Therapy: The Journal of the American Society of Gene Therapy. 25 (5), 1107-1116 (2017).
  8. Seymour, L. W., Fisher, K. D. Oncolytic viruses: finally delivering. British Journal of Cancer. 114 (4), 357-361 (2016).
  9. Chen, D. S., Mellman, I. Oncology meets immunology: the cancer-immunity cycle. Immunity. 39 (1), 1-10 (2013).
  10. Gao, Q., Park, M. S., Palese, P. Expression of transgenes from newcastle disease virus with a segmented genome. Journal of Virology. 82 (6), 2692-2698 (2008).
  11. Billeter, M. A., Naim, H. Y., Udem, S. A. Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses. Current Topics in Microbiology and Immunology. 329, 129-162 (2009).
  12. Matveeva, O. V., Guo, Z. S., Shabalina, S. A., Chumakov, P. M. Oncolysis by paramyxoviruses: multiple mechanisms contribute to therapeutic efficiency. Molecular Therapy Oncolytics. 2, (2015).
  13. Suter, S. E., et al. In vitro canine distemper virus infection of canine lymphoid cells: a prelude to oncolytic therapy for lymphoma. Clinical Cancer Research. 11 (4), 1579-1587 (2005).
  14. Ammayappan, A., Russell, S. J., Federspiel, M. J. Recombinant mumps virus as a cancer therapeutic agent. Molecular Therapy Oncolytics. 3, 16019(2016).
  15. Schirrmacher, V. Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opinion on Biological Therapy. 15 (12), 1757-1771 (2015).
  16. Saga, K., Kaneda, Y. Oncolytic Sendai virus-based virotherapy for cancer: recent advances. Oncolytic Virotherapy. 4, 141-147 (2015).
  17. Matveeva, O. V., Kochneva, G. V., Netesov, S. V., Onikienko, S. B., Chumakov, P. M. Mechanisms of Oncolysis by Paramyxovirus Sendai. Acta Naturae. 7 (2), 6-16 (2015).
  18. Gainey, M. D., Manuse, M. J., Parks, G. D. A hyperfusogenic F protein enhances the oncolytic potency of a paramyxovirus simian virus 5 P/V mutant without compromising sensitivity to type I interferon. Journal of Virology. 82 (19), 9369-9380 (2008).
  19. Engeland, C. E., et al. A Tupaia paramyxovirus vector system for targeting and transgene expression. The Journal of General Virology. 98 (9), 2248-2257 (2017).
  20. Russell, S. J., Peng, K. W. Measles virus for cancer therapy. Current Topics in Microbiology and Immunology. 330, 213-241 (2009).
  21. Aref, S., Bailey, K., Fielding, A. Measles to the Rescue: A Review of Oncolytic Measles Virus. Viruses. 8 (10), (2016).
  22. Demicheli, V., Rivetti, A., Debalini, M. G., Di Pietrantonj, C. Vaccines for measles, mumps and rubella in children. The Cochrane Database of Systematic Reviews. (2), 004407(2012).
  23. Radecke, F., et al. Rescue of measles viruses from cloned DNA. The EMBO Journal. 14 (23), 5773-5784 (1995).
  24. Martin, A., Staeheli, P., Schneider, U. RNA polymerase II-controlled expression of antigenomic RNA enhances the rescue efficacies of two different members of the Mononegavirales independently of the site of viral genome replication. Journal of Virology. 80 (12), 5708-5715 (2006).
  25. Russell, S. J., et al. Remission of disseminated cancer after systemic oncolytic virotherapy. Mayo Clinic Proceedings. 89 (7), 926-933 (2014).
  26. Hardcastle, J., et al. Immunovirotherapy with measles virus strains in combination with anti-PD-1 antibody blockade enhances antitumor activity in glioblastoma treatment. Neuro-Oncology. 19 (4), 493-502 (2017).
  27. Dispenzieri, A., et al. Phase I trial of systemic administration of Edmonston strain of measles virus genetically engineered to express the sodium iodide symporter in patients with recurrent or refractory multiple myeloma. Leukemia. 31 (12), 2791-2798 (2017).
  28. Galanis, E., et al. Phase I trial of intraperitoneal administration of an oncolytic measles virus strain engineered to express carcinoembryonic antigen for recurrent ovarian cancer. Cancer Research. 70 (3), 875-882 (2010).
  29. Galanis, E., et al. Oncolytic measles virus expressing the sodium iodide symporter to treat drug-resistant ovarian cancer. Cancer Research. 75 (1), 22-30 (2015).
  30. Kurokawa, C., et al. Constitutive Interferon Pathway Activation in Tumors as an Efficacy Determinant Following Oncolytic Virotherapy. Journal of the National Cancer Institute. , (2018).
  31. Msaouel, P., et al. Clinical Trials with Oncolytic Measles Virus: Current Status and Future Prospects. Current Cancer Drug Targets. 18 (2), 177-187 (2018).
  32. Grote, D., Cattaneo, R., Fielding, A. K. Neutrophils contribute to the measles virus-induced antitumor effect: enhancement by granulocyte macrophage colony-stimulating factor expression. Cancer Research. 63 (19), 6463-6468 (2003).
  33. Grossardt, C., et al. Granulocyte-macrophage colony-stimulating factor-armed oncolytic measles virus is an effective therapeutic cancer vaccine. Human Gene Therapy. 24 (7), 644-654 (2013).
  34. Iankov, I. D., et al. Expression of immunomodulatory neutrophil-activating protein of Helicobacter pylori enhances the antitumor activity of oncolytic measles virus. Molecular Therapy: The Journal of the American Society of Gene Therapy. 20 (6), 1139-1147 (2012).
  35. Engeland, C. E., et al. CTLA-4 and PD-L1 Checkpoint Blockade Enhances Oncolytic Measles Virus Therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22 (11), 1949-1959 (2014).
  36. Veinalde, R., et al. Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation. Oncoimmunology. 6 (4), 1285992(2017).
  37. Hutzler, S., et al. Antigen-specific oncolytic MV-based tumor vaccines through presentation of selected tumor-associated antigens on infected cells or virus-like particles. Scientific Reports. 7 (1), 16892(2017).
  38. Speck, T., et al. Targeted BiTE expression by an oncolytic vector augments therapeutic efficacy against solid tumors. Clinical Cancer Research. , (2018).
  39. Andtbacka, R. H., et al. Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. Journal of Clinical Oncology: Official Journal of the American Society of Clinical Oncology. 33 (25), 2780-2788 (2015).
  40. Ribas, A., et al. Oncolytic Virotherapy Promotes Intratumoral T Cell Infiltration and Improves Anti-PD-1 Immunotherapy. Cell. 170 (6), 1109-1119 (2017).
  41. Patel, S. J., et al. Identification of essential genes for cancer immunotherapy. Nature. 548 (7669), 537-542 (2017).
  42. Kimple, M. E., Brill, A. L., Pasker, R. L. Overview of affinity tags for protein purification. Current Protocols in Protein Science. 73, Unit 9.9 (2013).
  43. Cattaneo, R., Rebmann, G., Baczko, K., ter Meulen, V., Billeter, M. A. Altered ratios of measles virus transcripts in diseased human brains. Virology. 160 (2), 523-526 (1987).
  44. Gutsche, I., et al. Structural virology. Near-atomic cryo-EM structure of the helical measles virus nucleocapsid. Science. 348 (6235), New York, N.Y. 704-707 (2015).
  45. Kolakofsky, D., et al. Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. Journal of Virology. 72 (2), 891-899 (1998).
  46. Kolakofsky, D., Roux, L., Garcin, D., Ruigrok, R. W. Paramyxovirus mRNA editing, the "rule of six" and error catastrophe: a hypothesis. The Journal of General Virology. 86, Pt 7 1869-1877 (2005).
  47. Parks, C. L., et al. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. Journal of Virology. 75 (2), 921-933 (2001).
  48. JoVE Science Education Database. Molecular Cloning. JoVE Science Education Database. , JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  49. JoVE Science Education Database. Bacterial Transformation: The Heat Shock Method. JoVE Science Education Database. , JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  50. Bergkessel, M., Guthrie, C. Colony PCR. Methods in Enzymology. 529, 299-309 (2013).
  51. Rota, J. S., Wang, Z. D., Rota, P. A., Bellini, W. J. Comparison of sequences of the H, F, and N coding genes of measles virus vaccine strains. Virus Research. 31 (3), 317-330 (1994).
  52. Bankamp, B., Takeda, M., Zhang, Y., Xu, W., Rota, P. A. Genetic characterization of measles vaccine strains. The Journal of Infectious Diseases. 204, Suppl 1 533-548 (2011).
  53. Dulbecco, R., Vogt, M. Plaque formation and isolation of pure lines with poliomyelitis viruses. The Journal of Experimental Medicine. 99 (2), 167-182 (1954).
  54. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical Biochemistry. 150 (1), 76-85 (1985).
  55. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry. 72, 248-254 (1976).
  56. JoVE Science Education Database. Separating Protein with SDS-PAGE. JoVE Science Education Database. , JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  57. JoVE Science Education Database. The Western Blot. JoVE Science Education Database. , JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  58. Menck, K., et al. Isolation of human monocytes by double gradient centrifugation and their differentiation to macrophages in teflon-coated cell culture bags. Journal of Visualized Experiments. (91), e51554(2014).
  59. Quah, B. J., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. Journal of Visualized Experiments. (44), (2010).
  60. Gerdes, J. Ki-67 and other proliferation markers useful for immunohistological diagnostic and prognostic evaluations in human malignancies. Seminars in Cancer Biology. 1 (3), 199-206 (1990).
  61. JoVE Science Education Database. The Transwell Migration Assay. JoVE Science Education Database. , JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  62. Lim, J. F., Berger, H., Su, I. H. Isolation and Activation of Murine Lymphocytes. Journal of Visualized Experiments. (116), e54596(2016).
  63. Ungerechts, G., et al. Moving oncolytic viruses into the clinic: clinical-grade production, purification, and characterization of diverse oncolytic viruses. Molecular Therapy Methods & Clinical Development. 3, 16018(2016).
  64. Fridman, W. H., Zitvogel, L., Sautes-Fridman, C., Kroemer, G. The immune contexture in cancer prognosis and treatment. Nature Reviews Clinical Oncology. 14 (12), 717-734 (2017).
  65. Yu, F., et al. T-cell engager-armed oncolytic vaccinia virus significantly enhances antitumor therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22 (1), 102-111 (2014).
  66. Fajardo, C. A., et al. Oncolytic Adenoviral Delivery of an EGFR-Targeting T-cell Engager Improves Antitumor Efficacy. Cancer Research. 77 (8), 2052-2063 (2017).
  67. Freedman, J. D., et al. Oncolytic adenovirus expressing bispecific antibody targets T-cell cytotoxicity in cancer biopsies. EMBO Molecular Medicine. 9 (8), 1067-1087 (2017).
  68. Wing, A., et al. Improving CART-Cell Therapy of Solid Tumors with Oncolytic Virus-Driven Production of a Bispecific T-cell Engager. Cancer Immunology Research. 6 (5), 605-616 (2018).
  69. Myers, R. M., et al. Preclinical pharmacology and toxicology of intravenous MV-NIS, an oncolytic measles virus administered with or without cyclophosphamide. Clinical Pharmacology and Therapeutics. 82 (6), 700-710 (2007).
  70. Rittner, K., Schreiber, V., Erbs, P., Lusky, M. Targeting of adenovirus vectors carrying a tumor cell-specific peptide: in vitro and in vivo studies. Cancer Gene Therapy. 14 (5), 509-518 (2007).
  71. Nakamura, T., et al. Rescue and propagation of fully retargeted oncolytic measles viruses. Nature Biotechnology. 23 (2), 209-214 (2005).
  72. Campadelli-Fiume, G., et al. Retargeting Strategies for Oncolytic Herpes Simplex Viruses. Viruses. 8 (3), 63(2016).
  73. Leber, M. F., et al. MicroRNA-sensitive oncolytic measles viruses for cancer-specific vector tropism. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19 (6), 1097-1106 (2011).
  74. Baertsch, M. A., et al. MicroRNA-mediated multi-tissue detargeting of oncolytic measles virus. Cancer Gene Therapy. 21 (9), 373-380 (2014).
  75. Ruiz, A. J., Russell, S. J. MicroRNAs and oncolytic viruses. Current Opinion in Virology. 13, 40-48 (2015).
  76. Miest, T. S., Cattaneo, R. New viruses for cancer therapy: meeting clinical needs. Nature Reviews Microbiology. 12 (1), 23-34 (2014).
  77. Phuong, L. K., et al. Use of a vaccine strain of measles virus genetically engineered to produce carcinoembryonic antigen as a novel therapeutic agent against glioblastoma multiforme. Cancer Research. 63 (10), 2462-2469 (2003).
  78. Dingli, D., et al. Image-guided radiovirotherapy for multiple myeloma using a recombinant measles virus expressing the thyroidal sodium iodide symporter. Blood. 103 (5), 1641-1646 (2004).
  79. Abate-Daga, D., et al. Oncolytic adenoviruses armed with thymidine kinase can be traced by PET imaging and show potent antitumoural effects by ganciclovir dosing. PLoS One. 6 (10), 26142(2011).
  80. Ungerechts, G., et al. Lymphoma chemovirotherapy: CD20-targeted and convertase-armed measles virus can synergize with fludarabine. Cancer Research. 67 (22), 10939-10947 (2007).
  81. Ketzer, P., et al. Artificial riboswitches for gene expression and replication control of DNA and RNA viruses. Proceedings of the National Academy of Sciences of the United States of America. 111 (5), 554-562 (2014).
  82. Freedman, J., et al. Targeting T-cells to human cancer associated fibroblasts using an oncolytic virus expressing a FAP-specific T-cell engager. Keystone Symposia & Digitell, Inc. , (2018).
  83. Nishio, N., et al. Armed oncolytic virus enhances immune functions of chimeric antigen receptor-modified T cells in solid tumors. Cancer Research. 74 (18), 5195-5205 (2014).
  84. Bressy, C., Benihoud, K. Association of oncolytic adenoviruses with chemotherapies: an overview and future directions. Biochemical Pharmacology. 90 (2), 97-106 (2014).
  85. Wennier, S. T., Liu, J., McFadden, G. Bugs and drugs: oncolytic virotherapy in combination with chemotherapy. Current Pharmaceutical Biotechnology. 13 (9), 1817-1833 (2012).
  86. Fillat, C., Maliandi, M. V., Mato-Berciano, A., Alemany, R. Combining oncolytic virotherapy and cytotoxic therapies to fight cancer. Current Pharmaceutical Design. 20 (42), 6513-6521 (2014).
  87. Li, H., Peng, K. W., Russell, S. J. Oncolytic measles virus encoding thyroidal sodium iodide symporter for squamous cell cancer of the head and neck radiovirotherapy. Human Gene Therapy. 23 (3), 295-301 (2012).
  88. Opyrchal, M., et al. Effective radiovirotherapy for malignant gliomas by using oncolytic measles virus strains encoding the sodium iodide symporter (MV-NIS). Human Gene Therapy. 23 (4), 419-427 (2012).
  89. Mansfield, D., et al. Oncolytic Vaccinia virus and radiotherapy in head and neck cancer. Oral Oncology. 49 (2), 108-118 (2013).
  90. Miest, T. S., et al. Envelope-chimeric entry-targeted measles virus escapes neutralization and achieves oncolysis. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19 (10), 1813-1820 (2011).
  91. Santiago, D. N., et al. Fighting Cancer with Mathematics and Viruses. Viruses. 9 (9), (2017).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Explore More Articles

ParamyxovirusesTumor targeted ImmunomodulationCancer ImmunotherapyOncolytic VectorsReverse Genetic SystemRecombinant Immunomodulatory VectorsMeasles Vaccine VectorBispecific T Cell EngagerTransfectionVirus PropagationSyncytia FormationFluorescent ReporterDMEM Culture Medium

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Contact Us

Recommend to library

JoVE NEWSLETTERS

Research

Education

Authors

Librarians

ABOUT JoVE

Copyright © 2025 MyJoVE Corporation. All rights reserved