JoVE Logo
Authors
Contact Us

Sign In

A subscription to JoVE is required to view this content. Sign in or start your free trial.

In This Article

  • Summary
  • Abstract
  • Introduction
  • Protocol
  • Results
  • Discussion
  • Disclosures
  • Acknowledgements
  • Materials
  • References
  • Reprints and Permissions

Summary

A CRISPR/sgRNA library has been applied to interrogating protein-coding genes.However, the feasibility of a sgRNA library to uncover the function of a CTCF boundary in gene regulation remains unexplored. Here, we describe a HOX loci specific sgRNA library to elucidate the function of CTCF boundaries in HOX loci.

Abstract

CCCTC-binding factor (CTCF)-mediated stable topologically associating domains (TADs) play a critical role in constraining interactions of DNA elements that are located in neighboring TADs. CTCF plays an important role in regulating the spatial and temporal expression of HOX genes that control embryonic development, body patterning, hematopoiesis, and leukemogenesis. However, it remains largely unknown whether and how HOX loci associated CTCF boundaries regulate chromatin organization and HOX gene expression. In the current protocol, a specific sgRNA pooled library targeting all CTCF binding sites in the HOXA/B/C/D loci has been generated to examine the effects of disrupting CTCF-associated chromatin boundaries on TAD formation and HOX gene expression. Through CRISPR-Cas9 genetic screening, the CTCF binding site located between HOXA7/HOXA9 genes (CBS7/9) has been identified as a critical regulator of oncogenic chromatin domain, as well as being important for maintaining ectopic HOX gene expression patterns in MLL-rearranged acute myeloid leukemia (AML). Thus, this sgRNA library screening approach provides novel insights into CTCF mediated genome organization in specific gene loci and also provides a basis for the functional characterization of the annotated genetic regulatory elements, both coding and noncoding, during normal biological processes in the post-human genome project era.

Introduction

Recent genome interaction studies revealed that the human nuclear genome forms stable topologically associating domains (TADs) that are conserved across cell types and species. The organization of the genome into separate domains facilitates and restricts interactions between regulatory elements (e.g., enhancers and promoters). The CCCTC-binding factor (CTCF) binds to TAD boundaries and plays a critical role in constraining interactions of DNA elements that are located in neighboring TADs1. However, genome wide CTCF binding data revealed that although CTCF mostly interacts with the same DNA-sites in different cell types, it often functions as a chromatin barrier at a specific site in one cell type but not in the other, suggesting that CTCF functions together with other activities in the formation of chromatin boundaries2. What remains unknown is whether the boundary elements (CTCF-binding sites) are directly linked to the biological function of CTCF, and how these links occur. Therefore, we hypothesize that specific CTCF binding sites in the genome directly regulate the formation of TADs and control promoter/enhancer interactions within these domains or between neighboring domains. The completion of the human and mouse genome sequencing projects and subsequent epigenetic analyses have uncovered new molecular and genetic signatures of the genome. However, the role of specific signatures/modifications in gene regulation and cellular function, as well as their molecular mechanism(s), have yet to be fully understood.

Multiple lines of evidence support that the CTCF-mediated TADs represent functional chromatin domains3,4,5. Although CTCF mostly interacts with the same DNA-sites in different cell types, genome wide CTCF ChIP-seq data revealed that CTCF often functions as a chromatin barrier in one cell type but not in the other2. CTCF plays an essential role during development by mediating genome organization4,6,7. Disruption of CTCF boundaries impaired enhancer/promoter interactions and gene expression, leading to developmental blockage. This suggests that CTCF mediated TADs are not only structural components, but also regulatory units required for proper enhancer action and gene transcription5,8,9.

HOX genes play critical roles during embryonic development and they are temporally and spatially restricted in their expression patterns. The HOXA locus forms two stable TADs separating anterior and posterior genes by a CTCF-associated boundary element in both hESCs and IMR90 cells1. Recent reports demonstrated that HoxBlinc, a HoxB locus associated lncRNA, mediates the formation of CTCF directed TADs and enhancer/promoter interactions in the HOXB locus. This leads to anterior HOXB gene activation during ESC commitment and differentiation10. Furthermore, at specific gene loci including the HOXA locus, alteration of CTCF mediated TAD domains changed lineage specific gene expression profiles and was associated with the development of disease states11,12. The evidence supports a primary function for CTCF in coordinating gene transcription and determining cell identity by organizing the genome into functional domains.

Despite its role in the embryonic development, during hematopoiesis, HOX genes regulate hematopoietic stem and progenitor cell (HS/PC) function. This is done by controlling the balance between proliferation and differentiation10,13,14,15. The expression of HOX genes is tightly regulated throughout the specification and differentiation of hematopoietic cells, with highest expression in HS/PCs. HOX gene expression gradually decreases during maturation, with its lowest levels occurring in differentiated hematopoietic cells16. HOX gene dysregulation is a dominant mechanism of leukemic transformation by dysregulating self-renewal and differentiation properties of HS/PCs leading to leukemic transformation17,18. However, the mechanism of establishing and maintaining normal vs. oncogenic expression patterns of HOX genes as well as associated regulatory networks remains unclear.

CRISPR-Cas9 sgRNA library screening has been widely used to interrogate protein-coding genes19 as well as non-coding genes, such as lncRNA20 and miRNA21 in different species. However, the cost to use the CRISPR-Cas9 sgRNA library to identify new genomic targets remains high, because high-throughput genome sequencing is often applied to verify the sgRNA library screening. Our sgRNA screening system is focused on the specific genome loci and evaluates the targeting sgRNAs through one-step RT-PCR according to the marker gene expression, such as HOXA9. Additionally, Sanger sequencing confirmed that the sgRNA was integrated into the genome, and Indel mutations can be detected to identify the sgRNA targeting site. Through the loci-specific CRISPR-Cas9 genetic screening, the CBS7/9 chromatin boundary has been identified as a critical regulator for establishing oncogenic chromatin domain and maintaining ectopic HOX gene expression patterns in AML pathogenesis12. The method can be widely applied to identify not only specific function of CTCF boundary in embryonic development, hematopoiesis, leukemogenesis, but also CTCF boundary as potential therapeutic targets for future epigenetic therapy.

Access restricted. Please log in or start a trial to view this content.

Protocol

​1. CTCF sgRNALibrary Design Using an Online Tool

  1. Design the sgRNA targeting CTCF binding sites in the human HOX loci using the genetic perturbation platform (GPP) designer tool (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design).
  2. Synthesize a total of 1,070 sgRNAs consisting of sgRNAs targeting 303 random targeting genes, 60 positive controls, 500 non-Human-targeting controls, and 207 CTCF elements or lncRNA targeting genes (Figure 1, Table 1). Each targeting DNA element is targeted by 5-10 different sgRNAs.

2. sgRNA Library Cloning

  1. Clone the synthesized oligonucleotides into the CRISPR lentiviral backbone vector (lentiCRISPRv2).
    1. Digest the LentiCRISPRv2 vector with BsmBI restriction enzyme at 37 °C for 2 h.
    2. Look for the presence of the larger band (around 12,873 bp) on the gel after BsmBI digestion, and then purify it with the gel extraction kit.
      NOTE: A 2kb small filler piece is also present on the gel after digestion, but this should be ignored.
    3. Ligate the synthesized oligonucleotides and digested LentiCRISPR vector with 150 ng of digested LentiCRISPR DNA, 1 µL of 10 µM oligos, 2 µL of 10x T4 ligase buffer, 1 µL of T4 ligase, and then incubate them at 16 °C overnight.
  2. Transform the lentiviral CRISPR/sgRNA library into electro-competent cells for amplification.
    1. Prepare the electroporator at 1.8 kV, 200 Ω and 25 µF. Then pre-warm the recovery SOC media in a 37 °C water bath, and pre-warm LB ampicillin antibiotic plates at 37 °C.
    2. Thaw the competent cells on ice for 10 min.
    3. Prepare 1.5 mL micro-centrifuge tubes and 1 mm electroporation cuvettes on ice.
    4. Mix 1 µL of a 10 ng/µL library plasmid DNA into 25 µL of competent cells in a 1.5 mL micro-centrifuge tube, and gently mix by flicking the bottom of the tube a few times manually.
    5. Once the cuvette is cold enough, transfer the DNA/competent cell mixture to it. Tap twice on the countertop and wipe any water droplets from the exterior of cuvette with a tissue paper. Then place the cuvette in the electroporation module and press pulse.
    6. Immediately add 975 µL of 37 °C pre-warmed SOC media. Mix by pipetting up and down and transfer to a 15 mL tube.
    7. Rotate and incubate at 37 °C for 1 h.
    8. Dilute 100 µL cells into 900 µL of SOC media and place 100 µL on a LB ampicillin antibiotic agar plate. Incubate overnight at 37 °C.
  3. Extract the plasmid DNA from the combined colonies using a maxi-prep column as detailed in the manufacturer's protocol.
    1. Scrape all the colonies from the LB agar plate and inoculate a starter culture of 2 mL of LB ampicillin antibiotic medium and incubate overnight at 37 °C with vigorous shaking (~200 x g).
    2. Dilute the starter culture 1:500 into 100 mL of LB ampicillin medium and incubate at 37 °C for 12-16 h with vigorous shaking (~200 x g).
    3. Harvest the bacterial cell pellet by centrifugation at 6,000 x g for 15 min at 4 °C.
    4. Re-suspend the bacterial pellet in 10 mL of suspension buffer.
    5. Lyse the suspended pellet with 10 mL of the lysis buffer, and vigorously invert 4-6 times. Incubate the lysate for 5 min at room temperature.
    6. Neutralize the lysate with 10 mL of chilled Neutralization Buffer. Mix by gently inverting the tubes 4-6 times and incubate it for 20 min on ice.
    7. Spin down at 13,500 x g for 30 min at 4 °C. Promptly transfer the supernatant containing the plasmid DNA to a new tube.
    8. Repeat step 2.3.7, and promptly transfer the supernatant containing the plasmid DNA to a new tube.
    9. Equilibrate the column by applying 10 mL of equilibration buffer and allow the column to empty by gravity flow.
    10. Add the supernatant to the column and allow it to enter the resin by gravity flow.
    11. Wash the column with 2x 30 mL of washing buffer.
    12. Elute the DNA with 15 mL of elution buffer.
    13. Precipitate the DNA with 10.5 mL of room-temperature isopropanol to the eluted DNA. Mix and spin down immediately at 15,000 x g for 30 min at 4 °C, and gently decant the supernatant.
    14. Wash the DNA pellet with 5 mL of 70% ethanol, centrifuge DNA pellet at 15,000 x g for 10 min and discard the clear supernatant.
    15. Repeat step 2.5.14 twice more.
    16. Centrifuge DNA pellet at 15,000 x g for 10 min, and gently decant the supernatant without disturbing the DNA pellet.
    17. Air-dry the pellet for 5-10 min, and dissolve the DNA in a required volume of buffer (TE buffer, pH 8.0).

3. The High Titer sgRNA Library Lentivirus Generation

  1. Cell preparation: Culture HEK293T cells in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% (vol/vol) fetal bovine serum (FBS) and 1% (vol/vol) penicillin-streptomycin (PS) antibiotic in T-25 flasks. Place them in the incubator at 37 °C and 5% CO2.
  2. Package lentivirus: Co-transfect HEK293T cells with 20 µg of purified library vectors from step 2, 15 µg of the package plasmid (psPAX2) and 10 µg of the envelope plasmid (pMD2.G) for 48 h before harvesting the viruses.
  3. Virus collection: After 48 h, collectthe virus supernatant and filter the virus supernatant through a 0.45 µm low protein binding PVDF membrane.
  4. Virus concentration: Concentrate the lentiviral supernatant by 50-fold using the concentrator and test the virus MOI in step 5.
  5. Virus storage: Aliquot the concentrated viruses and store in a -80 °C freezer.

4. Optimized Puromycin Concentration

  1. Leukemia cell culture: Culture MOLM13 AML cells in RPMI 1640 supplemented with 10% (vol/vol) fetal bovine serum (FBS) and 1x penicillin-streptomycin (PS) antibiotics in a T-125 flask. Place them in an incubator at 37 °C and 5% CO2.
    NOTE: Cells are typically passed every 4-5 d at a split ratio of 1:4 or 1:6, never allowing cells to reach more than 70% confluency.
  2. Set up MOLM13 cells in a 12-well plate with a density of 1.0 x 104 cell/mL, at a total volume of 2 mL per well (2.0 x 104 cells).
  3. Time-course assay: Treat MOLM13 cells with puromycin for 7 days in increasing concentrations (0.1 µg/mL, 0.2 µg/mL, 0.5 µg/mL, 1.0 µg/mL and 2.0 µg/mL)
    1. Set up MOLM13 cells without puromycin treatment on day 0 and set up 3 replicate wells without puromycin treatment as a control from day 0 to day 7.
    2. Treat MOLM13 cells with 0.1 µg/mL, 0.2 µg/mL, 0.5 µg/mL, 1.0 µg/mL and 2.0 µg/mL, separately, with each experimental condition containing 3 replicate wells.
    3. Count the live cell ratio and make a survival curve from day 0 to day 7 containing all conditions.
  4. Survival curve: Stain cells with Trypan blue and count viability daily to obtain the survival curves for each puromycin concentration.
  5. Optimizing minimal puromycin concentration: Determine the minimal puromycin concentration through Trypan blue staining, in which all MOLM13 cells are killed between 5-7 days.

5. Titration of Lentiviral Library in MOLM13 Leukemia Cells

  1. AML cells preparation: Collect MOLM13 AML cells with the transduction medium (RPMI 1640, 10% FBS, 1% PS, and 8.0 µg/mL coating medium) at a density of 1.5 x 106 cells /mL.
  2. Place MOLM13 cells in the 12-well plate with 1.5 x 106 cells in each well.
  3. Thaw the lentivirus: Remove the concentrated lentivirus from the -80 °C freezer and thaw it on ice.
  4. Mix MOLM13 cells with a different dose of the concentrated lentivirus in separate wells, including 0, 1, 2.5, 5, 7.5 and 10 µL (total 6 groups).
  5. Immediately centrifuge these mixtures at 1,000 x g for 2 h at 33 °C and transfer the 12-well plates back to the incubator at 37 °C and 5% CO2 for 4 h.
  6. After 4 h, spin down the infected cells at 400 x g for 5 min at room temperature.
  7. Gently aspirate the supernatant without disturbing the cell pellet, and re-suspend the transduced cells with fresh media (RPMI 1640, 10% FBS and 1% PS), and then transfer them to T-25 flasks and incubate at 37 °C for 48 h without puromycin.
  8. After 48 h, split these cells into 2 flasks (2 groups): an experimental group treated with 1 µg/mL puromycin for 5 days, and a control group without puromycin treatment for 5 days.
  9. Carry out puromycin selection for 5 days with 1 µg/mL puromycin according to the step 4 until all the non-transduced control cells are dead. Exchange for fresh media every 2 days.
  10. Measure the optimized MOI value for transduction by dividing the number of live cells treated with puromycin with the number of cells without puromycin treatment.

6. Transduction of the Pooled CRISPR-Cas9 KO Library

  1. Transduction with lentivirus: Infect 1.5 x 106 MOLM13 cells with 0.3 MOI of sgRNA pooled lentivirus in medium (RPMI 1640, 10% FBS, 1% PS, and 8 µg/mL coating medium) in 6-well plate and use the cells without the lentivirus infection as a control.
  2. Immediately centrifuge the 6-well plate at 1,000 x g for 2 h at 33 °C to spinfect the cells and transfer the plates back to the incubator at 37 °C and 5% CO2 for 4 h.
  3. Spin down the infected cells at 400 x g for 5 min at room temperature.
  4. Gently aspirate supernatant without disturbing the cell pellet, and re-suspend the transduced cells with fresh media (RPMI 1640, 10% FBS and 1% PS), and then transfer them to T-25 flasks and incubate at 37 °C for 48 h without puromycin.
  5. After 48 h, treat cells with 1 µg/mL puromycin for 5 days. Exchange for fresh media after 2 days and keep at an optimal cell density.
  6. Seed the single clone in 96-well plates with limiting dilution methods and incubate these single clones at 37 °C and 5% CO2. Culture them for 3-4 weeks.
  7. After a single cell grows up into a population, transfer half of the cells into 24-well plates for further culture under puromycin selection and verify these clones in the next step. Keep the rest of the cells.

7. Screening of the Pooled CRISPR-Cas9 KO Library with One-step RT-qPCR

  1. Determine the effectiveness of the sgRNA integrated clone screening by evaluating the expression of the marker gene HOXA9 with one step reverse-transcriptase polymerase chain reaction (one-step RT-qPCR).
    NOTE: HOXA9 are highly expressed in MOLM13 AML cells in leukemogenesis22,23.
  2. Count the sgRNA integrated MOLM13 cell and transfer 1 x 104 cells per well to a 96-well PCR plate.
  3. Centrifuge the tube at 1,000 x g for 5 min, and then thoroughly remove and discard the supernatant with a pipet without disturbing the cell pellet.
  4. Wash cells with 125 µL of PBS buffer, and centrifuge the tube at 1,000 x g for 5 min. Then remove 120 µL of the supernatant using a pipette and retain approximately 5 µL of PBS in each well.
  5. Add 50 µL of the cell lysis master mix containing 48 µL of cell lysis buffer, 1 µL of proteinase K solution (10 mg/mL) and 1 µL of DNase solution (1 mg/mL) to each well. Then pipet up and down 5 times to re-suspend the cell pellet.
  6. Incubate the mix for 10 min at room temperature, followed by 5 min at 37 °C, and then 75 °C for 5 min.
  7. Store the cell lysate at -80 °C freezer.
  8. The preparation of one-step RT-qPCR reaction: Thaw the one-step reaction mix and other reaction components to 4 °C. Then spin down briefly to collect solutions at the bottom of tubes, and place on ice without light. Mix and spin gently.
  9. Add 1 µL of cell lysate to the PCR wells with the RT-qPCR reaction mix, including 1 µL of the marker gene's forward primer (300 nM) and reverse primer (300 nM), 0.125 µL of reverse transcriptase (10 U/µL), and 5 µL of one-step reaction mix (2x).
  10. Seal wells with optically transparent film, and gently vortex and mix the reaction components.
  11. Place the 96-well PCR plate on a real-time PCR instrument.
  12. Run the reverse transcription reaction for 10 min at 50 °C, followed by polymerase inactivation and DNA denaturation for 1 min at 95 °C.
  13. Perform RT-PCR with 40 cycles of PCR reaction: denaturation for 15 s at 95 °C, annealing/extension and plate fluorescence reading for 20 s at 60 °C, and then melt curve analysis at 65-95 °C via 0.5 °C increments at 2-5 s/step.
  14. Set up upregulated, downregulated and no change groups according to the expression levels of HOXA9 gene by comparison to the control, separately. Use β-actin gene as a housekeeping gene control.

8. Verification of Integrated sgRNAs Positive Clones through Genotyping and Sanger Sequence

  1. Verify the HOXA9 decreased expression clones through Sanger sequencing and perform PCR with 50-100 ng MOLM13 genome DNA, 5 µL polymerase reaction buffer (10x), 1 µL forward primer (10 µM) (AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG) and 1 µL reverse primer (10 µM) (TCTACTATTCTTTCCCCTGCACTGTTGTGGGCGATGTGCGCTCTG), 1 µL dNTP (10mM), 1 unit polymerase (5 U /µL). Perform the PCR reaction with the initial denaturation at 94 °C for 30 s, and then more denaturation at 94 °C for 20 s, annealing at 56 °C for 20 s, extension at 68 °C for 20 s (total 30 cycles), final extension at 68 °C for 10 min, and then holding at 4 °C.
  2. Extract and purify the PCR products (size 285 bp) with a PCR Purification Kit.
  3. Ligate the purified PCR products into the T vector with 2 µL T4 ligation buffer (10x), 50 ng T vector DNA (50 ng/µL), 25 ng purified PCR DNA (285 bp), 1 µL T4 ligase (3 units/µL), and place the ligation mix into an incubator at 16 °C overnight.
  4. Transfer the ligation mix into DH5α competent cell, grow on a LB ampicillin antibiotic agar plate, and incubate overnight at 37 °C.
  5. Pick the single clones from the LB plate and verify them by genotyping and Sanger sequencing.

9. Detection of sgRNAs Induced Indel Mutation by Nuclease Digestion Assay

  1. Detect the sgRNA integrated single clone induced Indel rates by a nuclease test assay.
  2. Separately prepare PCR amplicons with 50-100 ng Indel mutant (test) and wild-type (WT, reference) DNA as PCR template, 5 µL polymerase reaction buffer (10x), 1 µL dNTP (10mM), 1 unit polymerase (5 U/µL), 1 µL forward primer (10 µM)( 5'-GAGATGGCGGCGCGGAAG-3'), and 1 µL reverse primer (10 µM) (5'-AAATATAGGGCGGCTGTTCACT-3'). The PCR reaction was performed with initial denaturation at 98 °C for 30 s, and then denaturation at 98 °C for 20 s, annealing at 56 °C for 20 s, extension at 72 °C for 30 s (total 30 cycles), and final extension at 72 °C for 10 min, and holding at 4 °C.
  3. Set up the heteroduplex mixture group with 200 ng of the "reference" (20 ng/µL) and 200 ng of "test" (20 ng/µL) PCR amplicons in 0.2 mL PCR tube, and the homoduplex mixture group with only 400 ng of "reference" PCR amplicons as a control.
  4. Separately incubate the heteroduplex and homoduplex mixture at 95 °C for 5 min in a 1 L beaker filled with 800 mL of water and then cool down gradually to room temperature to anneal and form heteroduplex or homoduplexes.
  5. Separately digest 400 ng of the annealed heteroduplex and homoduplex mixture with 1 µL indel mutation detection nuclease (2.5 U/µL) and 2 µL nuclease reaction buffer (10x) at 42 °C for 60 min.
  6. Analyze the digested samples with agarose gel electrophoresis, the heteroduplex mixture DNA should be cut into small fragments (70-250 bp), and the homoduplex DNA (320 bp) should not be cut.

Access restricted. Please log in or start a trial to view this content.

Results

CRISPR-Cas9 technology is a powerful research tool for functional genomic studies. It is rapidly replacing conventional gene editing techniques and has high utility for both genome-wide and individual gene-focused applications. Here, the first individually cloned loci-specific CRISPR-Cas9-arrayed sgRNA library contains 1,070 sgRNAs consisting of sgRNAs targeting 303 random targeting genes, 60 positive controls, 500 non-Human-targeting controls, and 207 CTCF elements or lncRNA targeting ge...

Access restricted. Please log in or start a trial to view this content.

Discussion

Protein-coding gene related sgRNA libraries have been applied in a functional screening system to identifying genes and networks regulating specific cellular functions through sgRNA enrichment24,25,26,27,28. Several non-coding region related sgRNA libraries were also shown in gene-specific functional screens for distal and proximal regulating elements, includi...

Access restricted. Please log in or start a trial to view this content.

Disclosures

We have no conflicts of interest related to this report.

Acknowledgements

The authors also thank Nicholas Cesari for editing the manuscript. The work was supported by grants from National Institute of Health (S.H., R01DK110108, R01CA204044).

Access restricted. Please log in or start a trial to view this content.

Materials

NameCompanyCatalog NumberComments
Lipofectamine 3000 reagentThermo Fisher ScientificL3000-008
Proteinase KThermo Fisher Scientific25530049
PuromycinThermo Fisher ScientificA1113802
Stbl3 cells Life Technologies C737303
HEK293TATCCCRL-3216
MOLM-13DSMZACC 554
lentiCRISPRv2Addgene52961
pMD2.GAddgene12259
psPAX2Addgene12260
pGEM®-T Easy Vector Systems PromegaA137A
T4 ligase New England Biolabs M0202S
QIAquick Gel Extract kitQIAGEN28706
QIAuick PCR purification kitQIAGEN28106
SingleShot™ SYBR® Green One-Step KitBio-Rad Laboratories1725095
QIAGEN Plasmid Maxi KitQIAGEN12163
Dulbecco’s Modified Eagle Medium Thermo Fisher Scientific 11965084
RPMI 1640 Thermo Fisher Scientific11875093
Fetal bovine serum (FBS) Thermo Fisher Scientific10-082-147
Penicillin/streptomycin/L-glutamine Life Technologies 10378016
Lenti-X Concentrator Clontech631232
Trypan Blue SolutionThermo Fisher Scientific15250061
PolybreneSanta Cruz Biotechnologysc-134220
Phosphate Buffered Saline (PBS) Genessee Scientific 25-507
TAE buffer Thermo Fisher Scientific FERB49
Surveyor® Mutation Detection KitsIntegrated DNA Technologies706020
Biorad Universal Hood II Gel Doc SystemBio-Rad170-8126
Centrifuge 5424 REppendorf5404000138
Digital Dry Baths/Block HeatersThermo Fisher Scientific88870002
TSX Series Ultra-Low FreezersThermo Fisher ScientificTSX40086V
Forma™ Steri-Cult™ CO2 IncubatorsThermo Fisher Scientific3308
Herasafe™ KS, Class II Biological Safety CabinetThermo Fisher Scientific51022484
Sorvall™ Legend™ XT/XF Centrifuge SeriesThermo Fisher Scientific75004506
Fisherbrand™ Isotemp™ Water BathsThermo Fisher ScientificFSGPD02
Thermo Scientific™ Locator™ Plus Rack and Box SystemsThermo Fisher Scientific13-762-353
CFX96 Touch Real-Time PCR Detection SystemBio-Rad1855195
MiniAmp™ Thermal CyclerApplied Biosystems technologyA37834
Thermo Scientific™ Owl™ EC300XL2 Compact Power SupplyThermo Fisher Scientific7217581
Thermo Scientific™ Owl™ EasyCast™ B1 Mini Gel Electrophoresis SystemsThermo Fisher Scientific09-528-178
VWR® Tube Rotator and RotisseriesVWR International10136-084
VWR® Incubating Mini ShakerVWR International12620-942
Analytical Balance MS104TS/00METTLER TOLEDO30133522
DS-11 FX and DS-11 FX+ SpectrophotometerDeNovix Inc.DS-11 FX

References

  1. Dixon, J. R., et al. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature. 485 (7398), 376-380 (2012).
  2. Cuddapah, S., et al. Global analysis of the insulator binding protein CTCF in chromatin barrier regions reveals demarcation of active and repressive domains. Genome research. 19 (1), 24-32 (2009).
  3. Phillips, J. E., Corces, V. G. CTCF: master weaver of the genome. Cell. 137 (7), 1194-1211 (2009).
  4. Tang, Z., et al. CTCF-Mediated Human 3D Genome Architecture Reveals Chromatin Topology for Transcription. Cell. 163 (7), 1611-1627 (2015).
  5. Lupianez, D. G., et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell. 161 (5), 1012-1025 (2015).
  6. Dowen, J. M., et al. Control of cell identity genes occurs in insulated neighborhoods in mammalian chromosomes. Cell. 159 (2), 374-387 (2014).
  7. Phillips-Cremins, J. E., et al. Architectural protein subclasses shape 3D organization of genomes during lineage commitment. Cell. 153 (6), 1281-1295 (2013).
  8. Narendra, V., Bulajic, M., Dekker, J., Mazzoni, E. O., Reinberg, D. CTCF-mediated topological boundaries during development foster appropriate gene regulation. Genes & Development. 30 (24), 2657-2662 (2016).
  9. Narendra, V., et al. CTCF establishes discrete functional chromatin domains at the Hox clusters during differentiation. Science. 347 (6225), 1017-1021 (2015).
  10. Deng, C., et al. HoxBlinc RNA Recruits Set1/MLL Complexes to Activate Hox Gene Expression Patterns and Mesoderm Lineage Development. Cell Reports. 14 (1), 103-114 (2016).
  11. Patel, B., et al. Aberrant TAL1 activation is mediated by an interchromosomal interaction in human T-cell acute lymphoblastic leukemia. Leukemia. 28 (2), 349-361 (2014).
  12. Luo, H., et al. CTCF boundary remodels chromatin domain and drives aberrant HOX gene transcription in acute myeloid leukemia. Blood. 132 (8), 837-848 (2018).
  13. Dou, D. R., et al. Medial HOXA genes demarcate haematopoietic stem cell fate during human development. Nature Cell Biology. 18 (6), 595-606 (2016).
  14. Lawrence, H. J., et al. Loss of expression of the Hoxa-9 homeobox gene impairs the proliferation and repopulating ability of hematopoietic stem cells. Blood. 106 (12), 3988-3994 (2005).
  15. Deng, C., et al. USF1 and hSET1A mediated epigenetic modifications regulate lineage differentiation and HoxB4 transcription. PLOS Genetics. 9 (6), e1003524(2013).
  16. Rawat, V. P., Humphries, R. K., Buske, C. Beyond Hox: the role of ParaHox genes in normal and malignant hematopoiesis. Blood. 120 (3), 519-527 (2012).
  17. Alharbi, R. A., Pettengell, R., Pandha, H. S., Morgan, R. The role of HOX genes in normal hematopoiesis and acute leukemia. Leukemia. 27 (5), 1000-1008 (2013).
  18. Rice, K. L., Licht, J. D. HOX deregulation in acute myeloid leukemia. Journal of Clinical Investigation. 117 (4), 865-868 (2007).
  19. Bassett, A. R., Kong, L., Liu, J. L. A genome-wide CRISPR library for high-throughput genetic screening in Drosophila cells. Journal of Genetics and Genomics. 42 (6), 301-309 (2015).
  20. Zhu, S., et al. Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library. Nature Biotechnology. 34 (12), 1279-1286 (2016).
  21. Kurata, J. S., Lin, R. J. MicroRNA-focused CRISPR-Cas9 library screen reveals fitness-associated miRNAs. RNA. 24 (7), 966-981 (2018).
  22. Collins, C. T., Hess, J. L. Role of HOXA9 in leukemia: dysregulation, cofactors and essential targets. Oncogene. 35 (9), 1090-1098 (2016).
  23. Kroon, E., Thorsteinsdottir, U., Mayotte, N., Nakamura, T., Sauvageau, G. NUP98-HOXA9 expression in hemopoietic stem cells induces chronic and acute myeloid leukemias in mice. The EMBO Journal. 20 (3), 350-361 (2001).
  24. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nature Biotechnology. 32 (3), 267-273 (2014).
  25. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343 (6166), 84-87 (2014).
  26. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343 (6166), 80-84 (2014).
  27. Zhou, J., et al. Dual sgRNAs facilitate CRISPR/Cas9-mediated mouse genome targeting. The FEBS Journal. 281 (7), 1717-1725 (2014).
  28. Sanjana, N. E., et al. High-resolution interrogation of functional elements in the noncoding genome. Science. 353 (6307), 1545-1549 (2016).
  29. Rajagopal, N., et al. High-throughput mapping of regulatory DNA. Nature Biotechnology. 34 (2), 167-174 (2016).
  30. Korkmaz, G., et al. Functional genetic screens for enhancer elements in the human genome using CRISPR-Cas9. Nature Biotechnology. 34 (2), 192-198 (2016).
  31. Rezaei, N., et al. FMS-Like Tyrosine Kinase 3 (FLT3) and Nucleophosmin 1 (NPM1) in Iranian Adult Acute Myeloid Leukemia Patients with Normal Karyotypes: Mutation Status and Clinical and Laboratory Characteristics. Turkish Journal of Haematology. 34 (4), 300-306 (2017).
  32. Yaragatti, M., Basilico, C., Dailey, L. Identification of active transcriptional regulatory modules by the functional assay of DNA from nucleosome-free regions. Genome Research. 18 (6), 930-938 (2008).
  33. Wilken, M. S., et al. DNase I hypersensitivity analysis of the mouse brain and retina identifies region-specific regulatory elements. Epigenetics Chromatin. 8, 8(2015).
  34. Narlikar, L., Ovcharenko, I. Identifying regulatory elements in eukaryotic genomes. Briefings in Functional Genomics and Proteomics. 8 (4), 215-230 (2009).
  35. Hnisz, D., et al. Activation of proto-oncogenes by disruption of chromosome neighborhoods. Science. 351 (6280), 1454-1458 (2016).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Explore More Articles

CRISPRSgRNA LibraryCTCF Binding SitesGenetic ScreeningNoncoding ElementsHOX Gene RegulationEmbryonic DevelopmentLeukemiaLentivirus PackagingHEK293 T CellsMOLM13 CellsPuromycin TreatmentMOI ValueTransduction

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Contact Us

Recommend to library

JoVE NEWSLETTERS

Research

Education

Authors

Librarians

ABOUT JoVE

Copyright © 2025 MyJoVE Corporation. All rights reserved