Preparation of Neutrally-charged, pH-responsive Polymeric Nanoparticles for Cytosolic siRNA Delivery

Summary

Methods to prepare and characterize the physicochemical properties and bioactivity of neutrally-charged, pH-responsive siRNA nanoparticles are presented. Criteria for successful siRNA nanomedicines such as size, morphology, surface charge, siRNA loading, and gene silencing are discussed.

Abstract

The success of siRNA as a targeted molecular medicine is dependent upon its efficient cytosolic delivery to cells within the tissue of pathology. Clinical success for treating previously ‘undruggable’ hepatic disease targets with siRNA has been achieved. However, efficient tumor siRNA delivery necessitates additional pharmacokinetic design considerations, including long circulation time, evasion of clearance organs (e.g., liver and kidneys), and tumor penetration and retention. Here, we describe the preparation and in vitro physicochemical/biological characterization of polymeric nanoparticles designed for efficient siRNA delivery, particularly to non-hepatic tissues such as tumors. The siRNA nanoparticles are prepared by electrostatic complexation of siRNA and the diblock copolymer poly(ethylene glycol-b-[2-(dimethylamino)ethyl methacrylate-co-butyl methacrylate]) (PEG-DB) to form polyion complexes (polyplexes) where siRNA is sequestered within the polyplex core and PEG forms a hydrophilic, neutrally-charged corona. Moreover, the DB block becomes membrane-lytic as vesicles of the endolysosomal pathway acidify (< pH 6.8), triggering endosomal escape and cytosolic delivery of siRNA. Methods to characterize the physicochemical characteristics of siRNA nanoparticles such as size, surface charge, particle morphology, and siRNA loading are described. Bioactivity of siRNA nanoparticles is measured using luciferase as a model gene in a rapid and high-throughput gene silencing assay. Designs which pass these initial tests (such as PEG-DB-based polyplexes) are considered appropriate for translation to preclinical animal studies assessing the delivery of siRNA to tumors or other sites of pathology.

Introduction

Because siRNAs inhibit the translation of proteins from mRNA sequences, they can theoretically be used to drug all known pathologies^1,2,3,4,5. However, the use of siRNA in medicine is limited by the comprehensively poor pharmacokinetic profile of siRNA molecules^6,7. When injected intravenously, siRNAs are rapidly cleared through the kidneys and/or degraded by nucleases^8,9. Due to its large s....

Protocol

1. Preparation and characterization of si-NPs

1. si-NP preparation
   1. Dissolve polymer in 10 mM citric acid buffer (pH 4.0) at 3.33 mg/mL. Polymer can first be dissolved at 10x concentration in ethanol to ensure dissolution.
      NOTE: Polymer can be dissolved at lower concentrations, but use at concentrations above 3.33 mg/mL can prevent homogenous NP formation.
   2. Add siRNA (50 μM in diH₂O) to result in N⁺:P^- ratio of 10. Mix polymer and siRNA solutions.......

Discussion

The si-NPs described here are formed by electrostatic association of anionic siRNA and cationic polymers into polyion complexes (polyplexes). Electrostatic complexing of siRNA and the cationic DB block of PEG-DB polymers is facilitated by mixing at low pH (4.0). At pH 4.0, DMAEMA is highly protonated, and consequently the DB block is highly charged. This ensures that the polymers dissolve as unimers in solution as opposed to forming micelles and that DB complexes efficiently with siRNA. Subsequently, the pH of solution i.......

Materials

Name	Company	Catalog Number	Comments
0.45 mm pore-size syringe filters	Thermo Fisher Scientific	F25133	17 mm diameter, PTFE membrane
0-14 pH test strips	Millipore Sigma	P4786
10x TAE buffer	Thermo Fisher Scientific/Invitrogen	AM9869
6-7.7 pH test strips	Millipore Sigma	P3536
96-well black walled plates	Corning	3603	Tissue-culture treated
Agarose Powder	Thermo Fisher Scientific/Invitrogen	16500
Citric acid monohydrate	Millipore Sigma	C1909
dibasic sodium phosphate dihydrate	Millipore Sigma	71643
D-luciferin	Thermo Fisher Scientific	88294	Monopotassium Salt
DMEM	Gibco	11995065	High glucose and pyruvate
Ethanol	Millipore Sigma	459836
ethidium bromide	Thermo Fisher Scientific/Invitrogen	15585011
FBS	Gibco	26140079
loading dye	Thermo Fisher Scientific/Invitrogen	R0611
Luciferase siRNA	IDT	N/A	Antisense Strand Sequense: GAGGAGUUCAUUAUCAGUGCAAUUGUU Sense Strand Sequense: CAAUUGCACUGAUAAUGAACUCCT*C* *DNA bases
MDA-MB-231 / Luciferase (Bsd) stable cells	GenTarget Inc	SC059-Bsd	Luciferase-expressing cells sued to assess si-NP bioactivity
monobasic sodium phosphate monohydrate	Millipore Sigma	S9638
Scarmbled siRNA	IDT	N/A	Antisense Strand Sequense: AUACGCGUAUUAUACGCGAUUAACGAC Sense Strand Sequense: CGUUAAUCGCGUAUAAUACGCGUA*T* *DNA bases
square polystyrene cuvettes	Fisher Scientific	14-955-129	4.5 mL capacity
TEM grids	Ted Pella, Inc.	1GC50	PELCO Center-Marked Grids, 50 mesh, 3.0mm O.D., Copper
Trisodium citrate dihydrate	Millipore Sigma	S1804
uranyl acetate	Polysciences, Inc.	21447-25