Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing

Summary

We provide a protocol for isolation of microglia from different dissected regions of an adult mouse brain hemisphere, followed by semi-automated library preparation for deep single-cell RNA sequencing of full-length transcriptomes. This method will help to elucidate functional heterogeneity of microglia in health and disease.

Abstract

As resident macrophages in the central nervous system, microglia actively control brain development and homeostasis, and their dysfunctions may drive human diseases. Considerable advances have been made to uncover the molecular signatures of homeostatic microglia as well as alterations of their gene expression in response to environmental stimuli. With the advent and maturation of single-cell genomic methodologies, it is increasingly recognized that heterogenous microglia may underlie the diverse roles they play in different developmental and pathological conditions. Further dissection of such heterogeneity can be achieved through efficient isolation of microglia from a given region of interest, followed by sensitive profiling of individual cells. Here, we provide a detailed protocol for the rapid isolation of microglia from different brain regions in a single adult mouse brain hemisphere. We also demonstrate how to use these sorted microglia for plate-based deep single-cell RNA sequencing. We discuss the adaptability of this method to other scenarios and provide guidelines for improving the system to accommodate large-scale studies.

Introduction

Microglia, representing 5%−10% of all neural cells, are resident macrophages scattered throughout the central nervous system (CNS)¹. Protected behind blood-brain barrier, typical microglia in a healthy adult brain contain many fine processes that rapidly extend and retract to interact with neurons and other glial cells in the parenchyma. Microglia can also adopt the amoeboid morphology associated with increased phagocytic function during specific developmental stages or upon immune challenges in injury and disease^1,2,3,

Protocol

All procedures involving rodents conformed to Stanford University guidelines, which comply with national and state laws and policies. All animal procedures were approved by Stanford University's Administrative Panel on Laboratory Animal Care.

NOTE: All solution and buffer compositions are provided in Table of Materials.

1. Preparation on the Day of Cell Isolation

1. Prepare the following reagents and chill them on ice: medi.......

Discussion

Microglia actively interact with other cell types in the CNS, and they are very sensitive to environmental stimuli. In order to minimize inflammatory responses and aberrant changes in their gene expression during the isolation process, this protocol has been streamlined from a previously published method⁹, and it is now suitable to isolate microglia from multiple regions of a single mouse brain hemisphere in parallel. The tissues and reagents are kept at cold temperature and experiments are perfor.......

Materials

Name	Company	Catalog Number	Comments
5 M Betaine	Sigma-Aldrich	Cat# B0300-5VL
10 mM dNTP mix	Thermo Fisher Scientific	Cat# R0192
0.5 M EDTA, pH 8.0	Thermo Fisher Scientific	Cat# 15575020
10X Hanks' Balanced Salt Solution	Thermo Fisher Scientific	Cat# 14185-052
1 M HEPES	Thermo Fisher Scientific	Cat# 15630080
1X KAPA HIFI Hotstart Master Mix	Kapa Biosciences	Cat# KK2602
5 mL Round Bottom Polystyrene Tube, with Cell Strainer Cap	Corning	Cat# 352235
AATI, High Sensitivity NGS Fragment Analysis Kit (1 bp – 6,000 bp)	Advanced Analytical	Cat# DNF-474-1000
Bovine Serum Albumin	Sigma Aldrich	Cat# A8806
DNase I	Worthington	Cat# LS002007	Working solution: 12500 units/ml
DTT, Molecular Grade	Promega	Cat# P1171
ERCC RNA Spike-In Mix	Thermo Fisher Scientific	Cat# 4456740
Fetal Bovine Serum	Thermo Fisher Scientific	Cat# 10437-028
Illumina XT Index Kit v2 Set A (96 indexes)	Illumina	Cat# FC-131-2001
Illumina XT Index Kit v2 Set B (96 indexes)	Illumina	Cat# FC-131-2002
Illumina XT Index Kit v2 Set C (96 indexes)	Illumina	Cat# FC-131-2003
Illumina XT Index Kit v2 Set D (96 indexes)	Illumina	Cat# FC-131-2004
Lambda Exonuclease (5 U/μl)	New England BioLabs	Cat# M0262S
Mouse Fc block	BD Pharmingen	Cat# 553142
Myelin removal beads	Miltenyl Biotec	Cat# 130-096-433
Nextera XT DNA Sample Prep Kit	Illumina	Cat# FC-131-1096
NextSeq 500/550 High Output Kit v2.5 (150 Cycles)	Illumina	Cat# 20024907
PBS (10X), pH 7.4	Thermo Fisher Scientific	Cat# 70011044
PCRClean DX beads	Aline Biosciences	Cat# C-1003-50
Propidium Iodide	Thermo Fisher Scientific	Cat# P3566	Staining: 1:1000
Qubit dsDNA HS Assay Kit	Thermal Fisher Scientific	Cat# Q32851
Rat monoclonal anti mouse/human CD11b, Brilliant Violet 421 (clone M1/70)	BioLegend	Cat# 101236; RRID: AB_11203704	Staining: 1:300
Rat monoclonal anti mouse CD45, PE/Cy7 (clone 30-F11)	Thermo Fisher Scientific	Cat# 25-0451-82; RRID: AB_469625	Staining: 1:300
Recombinant RNase Inhibitor	Takara Bio	Cat# 2313B
SMARTScribe Reverse Transcriptase (100 U/μl)	Clontech	Cat# 639538	Containing 5x First strand buffer
Oligonucleotides
0.1 μM ISPCR Oligo: 5' - AAGCAGTGGTATCAA CGCAGAGT-3'			(Picelli et al., 2014)
Oligo-dT30VN primer: 5' - AAGCAGTGGTATCAACGCA GAGTACT 30 VN-3'			(Picelli et al., 2014)
TSO 5' - AAGCAGTGGTATCAACGCAGA GTACATrGrG+G-3' ("r" is forribobases and "+" is for an LNA base)			(Picelli et al., 2014)
Solutions
FACS buffer			Recipe: sterile-filtered 1% FBS, 2 mM EDTA, 25 mM HEPES in 1X PBS
MCS buffer			Recipe: sterile-filtered 0.5% BSA, 2 mM EDTA in 1X PBS
Medium A			Recipe: 15 mM HEPES, 0.5% glucose in 1X HBSS without phenol red
Plates
384-well Rigi-Plate PCR Microplates, Axygen Scientific	VWR	89005-556
Hard-shell 96-well PCR plates	Bio-Rad	HSP9631
Others
Dumont #55 forceps	Fine Science Tools	11295-51
Dounce homogenizer, 2 ml	Wheaton	357422
Large depletion column	Miltenyi Biotec	130-042-901
Large selection column	Miltenyi Biotec	130-042-401
MACS MultiStand	Miltenyi Biotec	130-042-303
QuadroMACS Separator	Miltenyi Biotec	130-090-976
RNAzap	Thermo Fisher Scientific	AM9780
Strainer (70 μm)	Falcon	352350
Equipment
BD FACSAria II	BD Biosciences	http://www.bdbiosciences.com/
Bioanalyzer	Agilent	2100
Fragment Analyzer	Agilent	5300
Mosquito HTS nanoliter pipetting robot	TTP Labtech	https://www.ttplabtech.com/
Qubit 4 Fluorometer	Thermo Fisher Scientific	Q33226