JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Neuroscience

Investigation of Activated Mouse Olfactory Sensory Neurons via Combined Immunostaining and in situ Hybridization

Published: April 11th, 2021

DOI:

10.3791/62150

1Department of Genetics, Evolution, Microbiology and Immunology, Institute of Biology, University of Campinas, 2Graduate Program in Genetics and Molecular Biology, Institute of Biology, University of Campinas

This protocol combines in situ hybridization with immunofluorescence to identify olfactory and vomeronasal receptor genes expressed in olfactory sensory neurons after activation by chemical stimuli in the mouse.

Animals rely on chemical communication to convey and perceive relevant environmental information, ranging from assessment of food quality to detection of available mating partners or threats. In mice, this task is executed primarily by the olfactory system and its underlying subsystems, including the main and accessory olfactory systems. Both have peripheral organs populated by sensory neurons expressing G-protein coupled receptors able to bind chemical cues that reach the nasal cavity. Even though the molecular characteristics of these receptors is well understood, little is known about their cognate specific ligands. The method described here combines in situ hybridization detection of olfactory or vomeronasal receptors with immunodetection of phosphorylated ribosomal protein S6 (pS6) - a marker of neuronal activation. This protocol was devised to identify neurons activated after a single event of exposure to purified or complex chemical stimuli detected by the olfactory organs. Importantly, this technique allows the investigation of neurons triggered in biologically relevant contexts. Ideally, this method should be used to probe the molecular biology of the olfactory system and to study olfactory behaviors.

Chemosignaling is the most widespread form of communication in animals. In mammals, detection of chemical cues is mediated mainly through olfaction and is paramount for finding food, locating possible mating partners, and avoiding potential predators1,2,3. The mouse olfactory system is further divided into different subsystems, each with their own anatomical, physiological and molecular properties4. Among these, the main olfactory system (MOS) and accessory olfactory system (AOS) are the most widely studied and better characterized.

.css-f1q1l5{display:-webkit-box;display:-webkit-flex;display:-ms-flexbox;display:flex;-webkit-align-items:flex-end;-webkit-box-align:flex-end;-ms-flex-align:flex-end;align-items:flex-end;background-image:linear-gradient(180deg, rgba(255, 255, 255, 0) 0%, rgba(255, 255, 255, 0.8) 40%, rgba(255, 255, 255, 1) 100%);width:100%;height:100%;position:absolute;bottom:0px;left:0px;font-size:var(--chakra-fontSizes-lg);color:#676B82;}

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Animal procedures were carried out in accordance with Animal Protocol #1883-1, approved by the University of Campinas (Institute of Biology's Institutional Animal Care and Use Committee - Committee for Ethics in Animal Use in Research), which follows the guidelines established by the federal National Council for Animal Experimentation Control (CONCEA).

1. Material preparation

  1. Prepare 1 L of 3% H2O2 (v/v) in 1x PBS. Dilute 100 mL 10× PBS and 100 mL of .......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

The current protocol aims at obtaining microscopy images in which the experimenter's gene of interest and the neuronal activity marker pS6 are fluorescently labeled. The described method involves Tyramide Signal Amplification, which produces clear and strong labeling with little to no background. pS6 immunostaining appears as cytoplasmic fluorescent signal that usually fills the entire neuronal cell body, whereas in situ hybridization signal for olfactory receptor neurons shows as cytoplasmic staining. pS6 i.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

The protocol described here reliably identifies sensory neurons activated by chemical cues in the olfactory system through a combination of in situ detection of OR or VR receptors with immunodetection of pS6, an indirect marker of neuronal activity. The experimenter must take extra caution to maintain histology integrity and perform all steps before hybridization under RNase-free conditions. Failure to do so may cause mRNA degradation and compromise riboprobe labeling. Care must be exercised during dissection of.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

We thank GAG Pereira and JA Yunes for resources, APF Ferreira and WO Bragança for administrative and technical help, and the Life Sciences Core Facility (LaCTAD-UNICAMP) staff for help with confocal microscopy. This work was supported by the Sao Paulo Research Foundation (FAPESP; grant numbers 2009/00473-0 and 2015/50371-0 to F.P.), by PRP/UNICAMP (grant numbers 2969/16, 725/15, 348/14, and 315/12 to F.P.), by FAPESP fellowships to V.M.A.C. (2014/25594-3, 2012/21786-0, 2012/01689-0), T.S.N. (2012/04026-1), and by Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) fellowship to T.S.N.

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
10x phosphate-buffered saline (PBS) Thermo Fisher Scientific AM9625 n/a
20x amplification diluent (reaction buffer from Alexa Fluor 555 Tyramide SuperBoost kit) Thermo Fisher Scientific B40923 or B40922 refered to as Amplification Buffer A in working solutions for tyramide-Alexa 488 or tyramide-Alexa 555 signal amplification
20x SSC Merck (Calbiochem) 8310-OP n/a
30% Bovine Serum Albumin (BSA) Merck (Sigma-Aldrich) A9576 n/a
30% hydrogen peroxyde (H2O2) Merck (Sigma-Aldrich) H1009 n/a
Acetic anhydride Merck (Sigma-Aldrich) 320102 n/a
Agarose Merck (Sigma-Aldrich) A9539 n/a
Amplification diluent (from TSA Biotin kit) Akoya Biosciences (Perkin Elmer) SAT700001EA refered to as Amplification Buffer B in working solution for tyramide-biotin signal amplification
Anti-pS6 (Ser 244/247) rabbit polyclonal antibody Thermo Fisher Scientific Cat# 44-923G, RRID:AB_2533798 n/a
Blocking buffer 1x (from Alexa Fluor 488 Tyramide SuperBoost kit) Thermo Fisher Scientific B40923 or B40922 refered to as blocking solution B in the tyramide signal development step
Blocking reagent (from TSA Biotin kit) Akoya Biosciences (Perkin Elmer) SAT700001EA refered to as blocking reagent A in the formulation for TNB buffer
DAPI nuclear stain Thermo Fisher Scientific D1306 n/a
Denhardt's solution (50x) Merck (Sigma-Aldrich) D9905 n/a
Deoinized formamide Merck (Sigma-Aldrich) F9037 n/a
Dextran sulfate solution (50%) Merck (Chemicon) S4030 n/a
Ethylene-diamine-tetraacetic acid (EDTA) Merck (Sigma-Aldrich) E9884 n/a
Hoechst 33342 nuclear stain Thermo Fisher Scientific H1399 n/a
Hydrochloric acid (HCl) Merck (Sigma-Aldrich) 320331 n/a
Olfactory stimuli n/a Papes et al. (2010), Carvalho et al. (2015), Nakahara er al. (2016), Carvalho et al. (2020) n/a
Paraformaldehyde Merck (Sigma-Aldrich) P6148 n/a
Peroxidase-conjugated anti-digoxigenin antibody (Fab fragments) Merck (Roche) 11207733910; RRID:AB_514500 refered to as peroxidase-conjugated anti-DIG antibody
Peroxidase-conjugated anti-rabbit secondary antibody (polyHRP-conjugated goat anti-rabbit reagent from Alexa Fluor 488 Tyramide SuperBoost kit) Thermo Fisher Scientific B40922 n/a
Peroxidase-conjugated streptavidin (from TSA biotin kit) Akoya Biosciences (Perkin Elmer) SAT700001EA n/a
ProLong Gold antifade mountant Thermo Fisher Scientific P36934 refered to as anti-fading mounting medium
RNase-free ultrapure water Thermo Fisher Scientific 10977015 n/a
Sodium chloride (NaCl) Merck (Sigma-Aldrich) S9888 n/a
Sodium dodecyl sulfate (SDS) Merck (Sigma-Aldrich) 436143 n/a
Sodium hydroxide (NaOH) Merck (Sigma-Aldrich) S8045 n/a
Sucrose Merck (Sigma-Aldrich) S0389 n/a
Triethanolamine Merck (Sigma-Aldrich) T58300 n/a
Triton X-100 Merck (Sigma-Aldrich) X100 n/a
Trizma hydrochloride (Tris-Cl) Merck (Sigma-Aldrich) T5941 n/a
Tween-20 Merck (Sigma-Aldrich) 822184 n/a
Tyramide-Alexa 488 conjugate (from Alexa Fluor 488 Tyramide SuperBoost kit) Thermo Fisher Scientific B40922 n/a
Tyramide-Alexa 555 conjugate (from Alexa Fluor 555 Tyramide SuperBoost kit) Thermo Fisher Scientific B40923 n/a
Tyramide-Biotin conjugate (from TSA Biotin kit) Akoya Biosciences (Perkin Elmer) SAT700001EA n/a
Yeast tRNA Merck (Roche) 10109495001 n/a
Critical Commercial Assays and Animals
Alexa Fluor 488 Tyramide SuperBoost kit Thermo Fisher Scientific B40922 n/a
Alexa Fluor 555 Tyramide SuperBoost kit Thermo Fisher Scientific B40923 n/a
DIG RNA Labeling Kit (SP6/T7) Merck (Roche) 11175025910 n/a
High Sensitivity RNA ScreenTape Analysis reagents (buffer, ladder, and tape) Agilent 5067-5580, 5067-5581, and 5067-5579 refered to as automated electrophoresis system
Mouse: C57BL/6J inbred strain Jackson Laboratories Stock No: 000664; RRID:IMSR_JAX:000664) n/a
ProbeQuant G-50 Micro Columns Cytiva Biosciences 28903408 refered to as gel filtration-based purification kit
QIAquick gel extraction kit Qiagen 28506 refered to as mini column-based gel-purification kit
RNeasy MinElute cleanup kit Qiagen 74204 refered to as mini column-based RNA purification kit
TSA Biotin kit Akoya Biosciences (Perkin Elmer) SAT700001EA n/a
Oligonucleotides
5’ – AAACTTCATCCTTACAGAATGG
CAG – 3’
Integrated DNA Technologies n/a Olfr692
5’ – ACTGGCTTTGGGACAGTGTGAC – 3’ Integrated DNA Technologies n/a
5’- GGTAATATCTCCATTATCCTAGTT
TCCC – 3’
Integrated DNA Technologies n/a Olfr124
5’ – TTGACCCAAAACTCCTTTGTTAG
TG – 3’
Integrated DNA Technologies n/a
5’ – ATGGGAGCTCTAAATCAAACAA
GAG – 3’
Integrated DNA Technologies n/a Olfr1509
5’ – TAGAAAACCGATACCACCTTGTC
G – 3’
Integrated DNA Technologies n/a
5’ – TACATCCTGACTCAGCTGGGGA
ACG – 3’
Integrated DNA Technologies n/a Olfr1512
5’ – GGGCACATAGTACACAGTAACA
ATAGTC – 3’
Integrated DNA Technologies n/a
5’ – GAGGAAGCTCACTTTTGGTTTG
G – 3’
Integrated DNA Technologies n/a Olfr78
5’ – CAGCTTCAATGTCCTTGTCACA
G – 3’
Integrated DNA Technologies n/a
5’ – TGGGTTGGAGGCTTATCATACC
TG – 3’
Integrated DNA Technologies n/a Olfr691
5’ – AAGAACAACACAGAGTCTTGAT
GTC – 3’
Integrated DNA Technologies n/a
5’ – AGAAGTAACTAACACCACTCAT
GGC – 3’
Integrated DNA Technologies n/a Olfr638
5’ – TTAGTGCACCTTTCTTTGCAAC – 3’ Integrated DNA Technologies n/a
5’ – TAACAGCTCTTCCCATCCCCTG
TTC – 3’
Integrated DNA Technologies n/a Olfr569
5’ – TAGGGTTGAGCATGGGAGGAAC
AAGC – 3’
Integrated DNA Technologies n/a
5’ – CACTGGATCAACTCTAGCAGCA
CTG – 3’
Integrated DNA Technologies n/a Vmn2r1
5’ – CTGCCCTTCTTGACATCTGCTG
AG – 3’
Integrated DNA Technologies n/a
5’ – ATCGGATCCACTGCTTTAGCATT
TCTTACAGGACAG – 3’
Integrated DNA Technologies n/a Vmn2r2
5’ – ATCCTCGAGTCATGCCTCTCCAT
AAGCAAGGAATTCCAC – 3'
Integrated DNA Technologies n/a
5’ – TAGGAAGCTATTTGCCTTGTTTC
CAC – 3’
Integrated DNA Technologies n/a Vmn2r13
5’ – AGGAGATTTTACCAACCAGATTC
CAG – 3’
Integrated DNA Technologies n/a
5’ – CTCTAAGAACAGCAGTAAAATGG
ATCT – 3’
Integrated DNA Technologies n/a Vmn2r89
5’ – ATGGGAATGACCAACTTAGGTGC
A – 3’
Integrated DNA Technologies n/a
5’ – ATCCCATGGCTGAGAACATGTGC
TTCTGGAG – 3’
Integrated DNA Technologies n/a Vmn2r118
5’ – ATCCTCGAGTCAGTCTGCATAAG
CCAGATATGTCAC – 3’
Integrated DNA Technologies n/a
5’ – ATCGGATCCGCTGATTTTATTTCT
CCCAGATGCTTTTGG – 3’
Integrated DNA Technologies n/a Vmn2r116
5’ – ATCCTCGAGTCATGGTTCTTCAT
AGCTGAGAAATACAAC – 3’
Integrated DNA Technologies n/a
5’ – TGGGTGTCTTCTTTCTCCTCAA
GA – 3’
Integrated DNA Technologies n/a Vmn2r28
5’ – GGTGACCCATATTCTCTGTATAA
CTGT – 3’
Integrated DNA Technologies n/a
5’ – GATGTTCATTTTCATGAGAGTCT
TCC – 3’
Integrated DNA Technologies n/a Vmn2r41
5’ – CATTTGTGGATGACATCACAATT
TGG – 3’
Integrated DNA Technologies n/a
5’ – TTTATGGCAAATTTCACTGATCCC
G – 3’
Integrated DNA Technologies n/a Vmn2r46
5’ – AGTGGGTCTTTCTTAGAAAGGAG
TG – 3’
Integrated DNA Technologies n/a
5’ – ACATGAACCAGAATTTGAAGCAG
GC – 3’
Integrated DNA Technologies n/a Vmn2r69
5’ – GCCAAGAAAGCTACAGTGAAAC
C – 3’
Integrated DNA Technologies n/a
5’ – AGGTGAAGAAATGGTATTCTTCC
AG – 3’
Integrated DNA Technologies n/a Vmn2r58
ACTGTGGCCTTGAATGCAATAACT – 3’ Integrated DNA Technologies n/a
5’ – TTCCTAAAGAACACCCTACTGA
AGCATCG – 3’
Integrated DNA Technologies n/a Vmn2r90
5’ – CATATTCCACAGAAGAGAAGT
TGGAC – 3’
Integrated DNA Technologies n/a
5’ – TTGAGGTGAGAGTCAACAGT
TTAGAC – 3’
Integrated DNA Technologies n/a Vmn2r107
5’ – CCCTTGTTGCACAAAATGAT
GATGTGA – 3’
Integrated DNA Technologies n/a
5’ – ATCCCATGGAGTCAGAGTAT
CTACTACACCATGATGG – 3’
Integrated DNA Technologies n/a Vmn2r83
5’ – ATCCTCGAGTCAATCATTAT
AGTCCAGAAAGGTGACAG – 3’
Integrated DNA Technologies n/a
Recombinant DNA
pGEM-T-Easy vector Promega A1360 reccommended PCR cloning vector
Other materials
1mL syringes Fisher Scientific 14-829-10F n/a
Conical tubes (15 mL and 50 mL) Fisher Scientific 14-432-22, 14-959-49B n/a
Coplin jars Fisher Scientific 12-567-099, 07-200-81 n/a
Cryostat Leica Biosystems CMS 1850 n/a
Dissecting tools and forceps Roboz RS-6802, RS-8124, RS-7110, RS-5111 n/a
Dry bath n/a n/a n/a
Electrophoresis equipment Fisher Scientific 09-528-110B n/a
Fine point paintbrushes Winsor & Newton 10269097 n/a
Fluorescence or confocal microscope Leica Microsystems TCS SP5II n/a
Heated plate Fisher Scientific HP88850200 n/a
Humidified chamber (if used at higher temperatures, it will need to be sealed inside a plastic Tupperware container) Thermo Fisher Scientific 22-045-034 n/a
Lint-free laboratory Kimwipes Kimberly-Clark 34120 refered to as lint-free laboratory tissue paper
Microcentrifuge Eppendorf 5401000013 n/a
Mouse cages InnoVive M-BTM, MVX1 n/a
PCR Thermocycler Thermo Fisher Scientific 4375786 n/a
Pipette p1000, p200, and p20 disposable tips Fisher Scientific 02-707-408, 02-707-411, 02-707-438 n/a
Plastic histology embedding mold Thermo Fisher Scientific 22-19 n/a
Qubit 4 Fluorometer Thermo Fisher Scientific Q33238 refered to as highly sensitive fluorometric method
Razor blades or scalpels Fisher Scientific 12-640 n/a
RNA tapestation or BioAnalyzer Agilent 4200 TapeStation System or 2100 Bioanalyzer Instrument n/a
RNase-free glass or plastic graduated cylinders and beakers Fisher Scientific 10-462-833, 02-555-25B, 02-555-25D n/a
Stereomicroscope Leica Microsystems M80 n/a
SuperFrost Plus microscope slides Thermo Fisher Scientific 12-550-15 referred to as positively charged microscope slides
Parafilm Bemis Company PM999 refered to as thermoplastic laboratory film
Water bath Thermo Fisher Scientific TSCIR19 n/a

  1. Stowers, L., Holy, T. E., Meister, M., Dulac, C., Koentges, G. Loss of sex discrimination and male-male aggression in mice deficient for TRP2. Science. 295 (5559), 1493-1500 (2002).
  2. Chamero, P., et al. Identification of protein pheromones that promote aggressive behaviour. Nature. 450 (7171), 899-902 (2007).
  3. Papes, F., Logan, D. W., Stowers, L. The vomeronasal organ mediates interspecies defensive behaviors through detection of protein pheromone homologs. Cell. 141 (4), 692-703 (2010).
  4. Munger, S. D., Leinders-Zufall, T., Zufall, F. Subsystem organization of the mammalian sense of smell. Annual review of physiology. 71, 115-140 (2009).
  5. Chess, A., et al. Allelic inactivation regulates olfactory receptor gene expression. Cell. 78, 823-834 (1994).
  6. Mombaerts, P. Genes and ligands for odorant, vomeronasal and taste receptors. Nature Reviews Neuroscience. 5, 263-278 (2004).
  7. Malnic, B., Hirono, J., Sato, T., Buck, L. B. Combinatorial receptor codes for odors. Cell. 96 (5), 713-723 (1999).
  8. Dulac, C., Axel, R. A novel family of genes encoding putative pheromone receptors in mammals. Cell. 83 (2), 195-206 (1995).
  9. Herrada, G., Dulac, C. A novel family of putative pheromone receptors in mammals with a topographically organized and sexually dimorphic distribution. Cell. 90 (4), 763-773 (1997).
  10. Martini, S., Silvotti, L., Shirazi, A., Ryba, N. J. P., Tirindelli, R. Co-Expression of Putative Pheromone Receptors in the Sensory Neurons of the Vomeronasal Organ. J. Neurosci. 21 (3), 843-848 (2001).
  11. Silvotti, L., Moiani, A., Gatti, R., Tirindelli, R. Combinatorial co-expression of pheromone receptors, V2Rs. Journal of Neurochemistry. 103 (5), 1753-1763 (2007).
  12. Ishii, T., Mombaerts, P. Expression of nonclassical class I major histocompatibility genes defines a tripartite organization of the mouse vomeronasal system. Journal of Neuroscience. 28 (10), 2332-2341 (2008).
  13. Saraiva, L. R., et al. Hierarchical deconstruction of mouse olfactory sensory neurons: From whole mucosa to single-cell RNA-seq. Scientific Reports. 5, (2015).
  14. Hanchate, N. K., et al. Single-cell transcriptomics reveals receptor transformations during olfactory neurogenesis. Science. 350, 1251-1255 (2015).
  15. Matsunami, H. Functional expression of mammalian odorant receptors. Chemical Senses. 30, 95-96 (2005).
  16. Isogai, Y., et al. Molecular organization of vomeronasal chemoreception. Nature. 478 (7368), 241-245 (2011).
  17. Xu, L., Li, W., Voleti, V., Zou, D. J., Hillman, E. M. C., Firestein, S. Widespread receptor-driven modulation in peripheral olfactory coding. Science. 368 (6487), (2020).
  18. Pfister, P., et al. Article Odorant Receptor Inhibition Is Fundamental to Odor Encoding Odorant Receptor Inhibition Is Fundamental to Odor Encoding. Current Biology. , 1-14 (2020).
  19. de March, C. A., Titlow, W. B., Sengoku, T., Breheny, P., Matsunami, H., McClintock, T. S. Modulation of the combinatorial code of odorant receptor response patterns in odorant mixtures. Molecular and Cellular Neuroscience. 104, 103469 (2020).
  20. Nakahara, T. S., Carvalho, V. M. A., Souza, M. A. A., Trintinalia, G. Z., Papes, F. Detection of Activated Mouse Neurons with Temporal Resolution via Dual c-Fos Staining. STAR Protocols. 1 (3), 100153 (2020).
  21. Nakahara, T. S., et al. Detection of pup odors by non-canonical adult vomeronasal neurons expressing an odorant receptor gene is influenced by sex and parenting status. BMC biology. 14 (1), 12 (2016).
  22. Carvalho, V. M. A., et al. Lack of spatial segregation in the representation of pheromones and kairomones in the mouse medial amygdala. Frontiers in Neuroscience. 9, 1-19 (2015).
  23. Carvalho, V. M. A., et al. Representation of Olfactory Information in Organized Active Neural Ensembles in the Hypothalamus. Cell Reports. 32 (8), 108061 (2020).
  24. Papes, F., Nakahara, T. S., Camargo, A. P. Behavioral assays in the study of olfaction: a practical guide. Methods in Molecular Biology, v1820: Olfactory receptors. , 289-388 (2018).
  25. Jiang, Y., Gong, N. N., Hu, X. S., Ni, M. J., Pasi, R., Matsunami, H. Molecular profiling of activated olfactory neurons identifies odorant receptors responding to odors in vivo. Nature Neuroscience. 18, 1446-1454 (2015).
  26. Von Der Weid, B., et al. Large-scale transcriptional profiling of chemosensory neurons identifies receptor-ligand pairs in vivo. Neuroscience. 18 (10), (2015).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved