A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
Early development is dependent on maternally-inherited products, and the role of many of these products is currently unknown. Herein, we described a protocol that uses CRISPR-Cas9 to identify maternal-effect phenotypes in a single generation.
Early development depends on a pool of maternal factors incorporated into the mature oocyte during oogenesis that perform all cellular functions necessary for development until zygotic genome activation. Typically, genetic targeting of these maternal factors requires an additional generation to identify maternal-effect phenotypes, hindering the ability to determine the role of maternally-expressed genes during development. The discovery of the biallelic editing capabilities of CRISPR-Cas9 has allowed screening of embryonic phenotypes in somatic tissues of injected embryos or "crispants," augmenting the understanding of the role zygotically-expressed genes play in developmental programs. This article describes a protocol that is an extension of the crispant method. In this method, the biallelic editing of germ cells allows for the isolation of a maternal-effect phenotype in a single generation, or "maternal crispants." Multiplexing guide RNAs to a single target promotes the efficient production of maternal crispants, while sequence analysis of maternal crispant haploids provides a simple method to corroborate genetic lesions that produce a maternal-effect phenotype. The use of maternal crispants supports the rapid identification of essential maternally-expressed genes, thus facilitating the understanding of early development.
A pool of maternally deposited products (e.g., RNAs, proteins, and other biomolecules) is necessary for all early cellular processes until the embryo's zygotic genome is activated1. The premature depletion of these products from the oocyte is typically embryonic lethal. Despite the importance of these genes in development, the role of many maternally-expressed genes is currently unknown. Advancement in gene-editing technology in zebrafish, such as CRISPR-Cas9, enables the targeting of maternally-expressed genes2,3,4. However, the identification of a maternal-effect phenotype requires an extra generation when compared to a zygotic phenotype, thus requiring more resources. Recently, the biallelic editing capability of CRISPR-Cas9 has been used to screen for embryonic phenotypes in somatic tissues of injected (F0) embryos, known as "crispants"5,6,7,8,9,10. The crispant technique permits resource-efficient screening of candidate genes in somatic cells, facilitating understanding of specific aspects in development. The protocol described in this paper allows for the identification of maternal-effect phenotypes, or "maternal crispants," in a single generation11. This scheme is attainable by multiplexing guide RNAs to a single gene and promoting biallelic editing events in the germline. These maternal crispant embryos can be identified by gross morphological phenotypes and undergo primary characterization, such as labeling for cell boundaries and DNA patterning11. Combined analysis of the observable phenotype and basic molecular characterization of the induced INDELs allows for the prediction of the targeted gene's role in early development.
In zebrafish, during the first 24 h post-fertilization (hpf), a small group of cells develops into the primordial germ cells, a precursor to the germline12,13,14,15. In clutches laid by F0 females, the proportion of maternal crispant embryos recovered depends on how many germ cells contain a biallelic editing event in the targeted gene. In general, the earlier the editing event occurs in the embryo, the higher the probability of CRISPR-Cas9 mutations being observed in the germline. In most cases, the phenotypes of maternal crispant embryos come from the loss of function in the two maternal alleles present in the developing oocyte. As the oocyte finishes meiosis, one of the maternal alleles is extruded from the embryo via the polar body, while the other allele becomes incorporated into the maternal pronucleus. The sequencing of multiple maternal crispant haploids will represent a mixture of the mutations (insertions and/or deletions (INDELs)) present in the germline that contribute to the phenotype11.
The following protocol describes the necessary steps to create CRISPR-Cas9 mutations in maternal-effect genes and identify the corresponding phenotype using a maternal crispant approach (Figure 1). Section one will explain how to effectively design and create guide RNAs, while sections two and three contain critical steps for creating maternal crispants by microinjection. After injecting the CRISPR-Cas9 mixture, injected embryos are screened for somatic edits via PCR (section four). Once the injected F0 embryos develop and reach sexual maturity, the F0 females are crossed to wild-type males, and their offspring are screened for maternal-effect phenotypes (section five). Section six includes instructions on making maternal crispant haploids that can be combined with Sanger sequencing to identify the CRISPR-Cas9-induced INDELs. In addition, the Discussion contains modifications that can be made to the protocol to increase the sensitivity and power of this method.
Access restricted. Please log in or start a trial to view this content.
In studies leading to the development of this protocol, all zebrafish housing and experiments were approved by the University of Wisconsin-Madison Institutional Animal Care and Use Committee (IACUC-M005268-R2).
1. Synthesis of Guide RNAs
NOTE: Zygotic crispants have been created using a single guide RNA or multiplexing multiple guide RNAs to a single target5,6,7,8,9,10. The multiplexing of guide RNAs increases the percentage of embryos showing a zygotic crispant phenotype10. Due to this increased frequency of embryos exhibiting a phenotype, maternal crispants are created by multiplexing four guide RNAs to a single gene. A more detailed protocol on using CHOPCHOP to design guide RNAs and an annealing method to synthesize guide RNAs for zebrafish can be found elsewhere16,17,18,19,20.
2. Preparing reagents and materials for microinjection
NOTE: In zebrafish, the injection of Cas9 mRNA can create zygotic crispants. However, studies have shown that Cas9 protein is more efficient in creating INDELs in injected embryos16,25. This protocol uses Cas9 protein to generate maternal crispants because this protein does not experience the same lag in activity as injected Cas9 mRNA. In theory, this should increase the probability of a biallelic mutation early in development resulting in an increased chance of a more extensive section of the germline being affected. Other protocols and resources detailing how to prepare for microinjections can be found elsewhere24,26.
3. Microinjection of CRISPR-Cas9 cocktail into a one-cell zebrafish embryo to generate maternal crispants
NOTE: More resources for microinjection into zebrafish embryos can be found elsewhere24,26,27. Injecting the CRISPR-Cas9 mixture into the developing blastodisc of one-cell embryos may increase the probability of creating maternal crispants. The mixture can also be injected into the yolk sac up to the 2-cell stage. However, mixtures injected into the yolk depend on ooplasmic streaming to reach the blastodisc, so CRISPR-Cas9 injected into the yolk could decrease the cutting efficiency of the CRISPR-Cas928.
4. Screening for somatic INDELs in F0 injected embryos
NOTE: Other methods for identifying INDELs, such as T7 endonuclease I assay or high-resolution melting analysis, can be used when determining if the embryos contain somatic INDELs 30.
5. Identification of maternal-effect phenotypes in maternal crispant embryos
NOTE: Once the injected F0 females have reached sexual maturity, their germline cells have the potential to generate a mixture of maternal crispant and wild-type embryos. Even though this mixture allows for internal controls for fertilization and developmental timing, it is still beneficial to set up a wild-type incross as an external control in case a clutch from F0 female contains only maternal crispant embryos.
6. Sequencing alleles in maternal crispant haploids
NOTE: Maternal crispant haploids contain a single allele in the targeted locus, allowing for the identification of INDELs in the target gene via Sanger sequencing. Maternal crispant haploids embryos can also be analyzed using next-generation sequencing assays. Embryos that show a maternal crispant phenotype are expected to carry a lesion in at least one of the four target sites (See Discussion).
Access restricted. Please log in or start a trial to view this content.
The experimental approach described in this protocol allows for the identification of maternal effect phenotypes in a rapid, resource-efficient manner (Figure 1).
Generating maternal crispants:
When designing the four guide RNAs to target a single candidate maternal-effect gene, special consideration should be given to where the guide RNAs will bind to DNA. In general, they should all be clustered together with minimal to no overlapping regi...
Access restricted. Please log in or start a trial to view this content.
The protocol presented in this manuscript allows for the identification and primary molecular characterization of a maternal-effect phenotype in a single generation instead of the multiple generations required for both forward and reverse genetic techniques. Currently, the role of many maternally expressed genes is unknown. This lack of knowledge is partly due to the extra generation required to visualize a phenotype when identifying maternal-effect genes. In the past, the rapid identification of maternal-effect genes in...
Access restricted. Please log in or start a trial to view this content.
The authors declare no competing financial interests.
We thank past and current Pelegri lab animal husbandry staff members for their care of the aquatic facility. We are also grateful for the comments and insight on the manuscript by Ryan Trevena and Diane Hanson. Funding was provided by NIH grant to F.P. (GM065303)
Access restricted. Please log in or start a trial to view this content.
Name | Company | Catalog Number | Comments |
1 M Tris-HCl (pH 8.4) | Invirogen | 15568025 | For PCR mix |
1.5 mL Eppendorf Tubes | Any Maker | ||
10 mM dNTPs | Thermo Fischer Scientific | 18427013 | Synthesis of gRNA |
100 BP ladder | Any Maker | For gel electrophoresis | |
100% RNAse free ethanol | Any Maker | ||
100% RNAse free ethanol | Any Maker | ||
100ml Beaker | Any Maker | For IVF | |
5 M Ammonium Accetate | Thermo Fischer Scientific | Found in the MEGAshortscript T7 Transcription Kit | Synthesis of gRNA |
70% Ethanol | Synthesis of gRNA (70 mL of ethanol + 30 mL of nuclease free water) | ||
Borosil 1.0 mm OD x 0.5 mm ID | FHC INC | 27-30-1 | for Microinjection |
Bulk Pharma Sodium Bicarbonate 35 pounds | Bulk Reef Supply | 255 | Fish supplies |
CaCl2 | MiliporeSigma | C7902 | |
Cas9 Protein with NLS | PNABio | CP01 | |
ChopChop | https://chopchop.cbu.uib.no/ | ||
Constant oligonucleotide | Integrated DNA Technologies (IDT) | AAAAGCACCGACTCGGTGCCAC TTTTTCAAGTTGATAACGGACTA GCCTTATTTTAACTTGCTATTTC TAGCTCTAAAAC | |
Depression Glass Plate | Thermo Fischer Scientific | 13-748B | For IVF |
Dissecting Forceps | Dumont | SS | For IVF |
Dissecting Scissors | Fine Science Tools | 14091-09 | For IVF |
Dissecting Steroscope( with transmitted light source) | Any Maker | For IVF | |
DNA Clean & Concentrator -5 | Zymo Research | D4014 | Synthesis of gRNA |
DNA Gel Loading Dye (6x) | Any Maker | For gel electrophoresis | |
EconoTaq DNA Polymerase | Lucigen | 30032-1 | For PCR mix |
Electropheresis Power Supply | Any Maker | For gel electrophoresis | |
Ensemble | https://useast.ensembl.org/index.html | ||
Eppendorf Femtotips Microloader Tips for Femtojet Microinjector | Thermo Fischer Scientific | E5242956003 | for Microinjection |
Ethanol (200 proof, nuclease-free) | Any Maker | ||
FemtoJet 4i | Eppendorf | 5252000021 | for Microinjection |
Fish Net | Any Maker | Fish supplies | |
Frozen Brine Shrimp | Brine Shrimp Direct | Fish supplies | |
General All Purpose Agarose | Any Maker | For gel electrophoresis | |
Gene-Specific oligonucleotide | Integrated DNA Technologies (IDT) | TAATACGACTCACTATA- N20 -GTTTTAGAGCTAGAAATAGCAAG | |
Gloves | Any Maker | ||
Ice Bucket | Any Maker | ||
Instant Ocean salt | Any Maker | Fish supplies | |
Invitrogen UltraPure Ethidium Bromide, 10 mg/mL | Thermo Fischer Scientific | 15-585-011 | |
KCl | MiliporeSigma | P5405 | |
KH2PO4 | MiliporeSigma | 7778-77-0 | |
Kimwipes | Thermo Fischer Scientific | 06-666 | |
Male & Female zebrafish | |||
MEGAshortscript T7 Transcription Kit | Thermo Fischer Scientific | AM1354 | Synthesis of gRNA |
Methylene Blue | Thermo Fischer Scientific | AC414240250 | For E3 |
MgCl2 | MiliporeSigma | 7791-18-6 | For PCR mix |
MgSO2·7H2O | MiliporeSigma | M2773 | |
Microinjection plastic mold | World Precision Instruments | Z-Molds | for Microinjection |
Micromanipulator | Any Maker | for Microinjection | |
Micropipeters | Any Maker | ||
Micropipette Puller | Sutter | P-87 | for Microinjection |
Micropipetter tips with filters (all sizes) | Any Maker | ||
Micropippetter tips without filters ( all sizes) | Any Maker | ||
Microwave | Any Maker | ||
Mineral Oil | MiliporeSigma | m5904-5ml | for Microinjection |
MS-222 ( Tricaine-D) | Any Maker | FDA approved | |
Na2HPO4 | MiliporeSigma | S3264 | |
NaCl | MiliporeSigma | S5886 | |
NaHC03 | MiliporeSigma | S5761 | |
Nanodrop | Any Maker | ||
NaOH | MiliporeSigma | 567530 | |
Nonstick, RNase-free Microfuge Tubes, 1.5 mL | Ambion | AM12450 | Synthesis of gRNA |
nuclease-free water | Any Maker | ||
Paper Towel | Any Maker | ||
Pastro Pipettes | Any Maker | ||
PCR Strip Tubes | Any Maker | ||
Petri Plates 100 mm diameter | Any Maker | ||
Phenol Red solution | MiliporeSigma | P0290 | for Microinjection |
Plastic Pestals | VWR | 47747-358 | For IVF |
Plastic Spoon | Any Maker | For IVF | |
Premium Grade Brine Shrimp Eggs | Brine Shrimp Direct | Fine Mesh | |
RNA Gel Loading Dye | found in MEGAshortscript T7 Transcription Kit | For gel electrophoresis | |
RNAse AWAY | Thermo Fischer Scientific | 21-402-178 | |
Scale | Any Maker | ||
Sharpie | Any Maker | ||
Spatula | Any Maker | ||
Sterile H2O | Any Maker | For PCR mix | |
T4 DNA Polymerase | NEB | M0203 | Synthesis of gRNA |
Tape | Any Maker | ||
TBE (Tris-Borate-EDTA) 10x | Any Maker | For gel electrophoresis | |
Tea Stainer | Amazon | IMU-71133W | Fish supplies |
Thermo Scientific Owl 12-Tooth Comb, 1.0/1.5 mm Thick, Double Sided for B2 | Thermo Fischer Scientific | B2-12 | For gel electrophoresis |
Thermo Scientific Owl EasyCast B2 Mini Gel Electrophoresis Systems | Thermo Fischer Scientific | 09-528-110B | For gel electrophoresis |
Thermocycler | Any Maker | ||
Thermocycler | Any Maker | ||
Transilluminator | Any Maker | ||
UV lamp | UVP | Model XX-15 (Cat NO. UVP18006201) | For IVF |
UV safety glasses | Any Maker | For IVF | |
Wash Bottle | Thermo Fischer Scientific | S39015 | Fish supplies |
Zebrafish mating boxes | Aqua Schwarz | SpawningBox1 | Fish supplies |
1.5ml Eppendorf Tubes | Fisher Scientific | 05-402-11 | |
10 Molar dNTPs | Thermo Fischer Scientific | 18427013 | |
100 BP ladder | Thermo Fischer Scientific | 15628019 | |
100% RNAse free ethanol | any maker | ||
5m Ammonium Accetate | Thermo Fischer Scientific | ||
70% Ethanol | 70ml ethanol and 30 ml of nuclease free water | ||
Accessories for Horizontal Gel Box | Fisher Scientific | 0.625 mm | |
Agarose | any maker | ||
CaCl2 | Sigma | 10043-52-4 | |
CaCl2, dihydrate | Sigma | 10035-04-8 | E3 Medium |
Capillary Tubing | Cole-Parmer | UX-03010-68 | for injection needles |
Cas9 Protein | Thermo Fischer Scientific | A36496 | |
ChopChop | https://chopchop.cbu.uib.no/ | ||
Computer | any maker | ||
Dissecting Forcepts | any maker | ||
Dissecting Microscope | any maker | ||
Dissecting Scissors | any maker | ||
DNA Clean & Concentrator -5 | Zymo Research | D4014 | |
DNA Gel Loading Dye (6X) | Thermo Fischer Scientific | R0611 | |
EconoTaq DNA Polymerase | Lucigen | 30032-1 | |
Ensemble | https://useast.ensembl.org/index.html | ||
Eppendorf Microloader PipetteTips | Fischer Scientific | 10289651 | 20 microliters |
Ethanol (200 proof, nuclease-free) | any maker | ||
Ethidium Bromide | Thermo Fischer Scientific | 15585011 | |
Fish Net | any maker | fine mesh | |
Frozen Brine Shrimp | LiveAquaria | CD-12018 | fish food |
Gel Comb (0.625mm) | any maker | ||
Gel Electropheresis System | any maker | ||
Gene-Specific oligonucleotide | Integrated DNA Technologies (IDT) | ||
Glass Capilary Needle | Grainger | 21TZ99 | https://www.grainger.com/product/21TZ99?ef_id=Cj0KCQjw8Ia GBhCHARIsAGIRRYpqsyA3-LUXbpZVq7thnRbroBqQTbrZ_a88 VVcI964LtOC6SFLz4ZYaAhZzEAL w_wcB:G:s&s_kwcid=AL!2966!3! 264955916096!!!g!438976 780705!&gucid=N:N:PS:Paid :GGL:CSM-2295:4P7A1P:20501 231&gclid=Cj0KCQjw8IaGBh CHARIsAGIRRYpqsyA3-LUXbp ZVq7thnRbroBqQTbrZ_a88VVcI 964LtOC6SFLz4ZYaAhZzEALw _wcB&gclsrc=aw.ds |
Glass Dishes | any maker | ||
Gloves | any maker | ||
Hank's Final Working Solution | Combine 9.9 ml of Hank's Premix with 0.1 ml HS Stock #6 | ||
Hank's Premix | combine the following in order: (1) 10.0 ml HS #1, (2) 1.0 ml HS#2, (3) 1.0 ml HS#4, (4) 86 ml ddH2O, (5) 1.0 ml HS#5. Store all HS Solotions at 4C | ||
Hanks Solution | |||
Hank's Solution | https://www.jove.com/pdf-materials/51708/jove-materials-51708-production-of-haploid-zebrafish-embryos-by-in-vitro-fertilization | ||
Hank's Stock Solution #1 | 8.0 g NaCl, 0.4 g KCl in 100 ml ddH2O | ||
Hank's Stock Solution #2 | 0.358 g Na2HPO4 anhydrous; 0.60 g K2H2PO4 in 100 ml ddH2O | ||
Hank's Stock Solution #4 | 0.72 g CaCl2 in 50 ml ddH2O | ||
Hank's Stock Solution #5 | 1.23 g MgSO47H2O in 50 ml ddH20 | ||
Hank's Stock Solution #6 | 0.35g NaHCO3 in 10.0 ml ddH20; make fresh day of use | ||
HCl | Sigma | 7647-01-0 | |
Ice Bucket | any maker | ||
Instant Ocean salt | any maker | for fish water | |
In-Vitro Transcription Kit Mega Short Script | Thermo Fischer Scientific | AM1354 | |
Invitrogen™ UltraPure™ DNase/RNase-Free Distilled Water | Fisher Scientific | 10-977-023 | |
KCl | Sigma | 7447-40-7 | E3 Medium |
KH2PO4 | Sigma | 7778-77-0 | |
Kimwipes | Fisher Scientific | 06-666 | |
Male and Female zebrafish | |||
Mega Short Script T7 Transciption Kit | Thermo Fischer Scientific | AM1354 | |
methylene blue | Fisher Scientific | AC414240250 | E3 Medium |
MgSO2-7H2O | Sigma | M2773 | |
Microimicromanipulator | |||
Microinjection plastic mold | World Precision Instruments | Z-Molds | |
Microinjector | |||
Microneedle Slide | |||
Micropipeter (1-10) with tips | any maker | need filtered p10 tips | |
Micropipetter (20-200) with tips | any maker | ||
Micropippetter (100-1000) with tips | any maker | ||
Microplastic slide | |||
Microwave | any maker | ||
MiliQ Water | any maker | ||
mineral oil | sigma-aldrich | m5904-5ml | |
Na2HPO4 | Sigma | ||
NaCl | Sigma | S9888 | |
NaHC02 | Sigma | 223441 | |
Nanodrop | |||
NaOH | Sigma | 567530 | |
Narrow Spatula | any maker | ||
Needle Puller | Sutter | P-97 | |
Paper Towel | any maker | ||
Pastro Pipettes | Fisher Scientific | 13-678-20A | |
PCR primer flanking guide site | Integrated DNA Technologies (IDT) | ||
PCR primers flanking guide RNA cut site | Integrated DNA Technologies (IDT) | Standard desalted | |
PCR Strip Tubes | Thermo Fischer Scientific | AB0771W | |
Petri Dishes | Fisher Scientific | FB0875714 | 10 cm diameter 100mm x 15mm |
Phenol Red | Fisher Science | S25464 | https://www.fishersci.com/shop/products/phenol-red-indicator-solution-0-02-w-v-2/S25464 |
Pipette Tips | any maker | 10ul, 200ul and 1000ul tips | |
Plastic Pestals | Fisher Scientific | 12-141-364 | |
Plastic Spoon | any maker | ||
Primer Guide Site | Integrated DNA Technologies (IDT) | ||
Razor Blade | Uline | H-595B | |
RNA gel Loading Dye | in megashort script kit(in vitro transciption kit) | ||
RNAse away | Fisher | 21-402-178 | |
RNAse free polypropylene microcentrifuge tubes | Thermo Fischer Scientific | AM12400 | https://www.thermofisher.com/order/catalog/product/AM12400#/AM12400 |
RNAse free water | Fisher Scientific | 10-977-023 | |
Scale | any maker | ||
Sharpie | any maker | ||
Sodium bicarbonate (cell culture tested) | Sigma | S5761 | fish water |
Sodium Bromide Solotion | Sigma | E1510 | |
Software for sanger sequencing Analysis | |||
Spectrophotometer | |||
Sterlie H2O | any brand | ||
T4 DNA Polymerase | NEB | M0203S | https://www.neb.com/products/m0203-t4-dna-polymerase#Product%20Information |
Tape | any brand | ||
TBE (Tris-Borate-EDTA) 10X | Thermo Fischer Scientific | B52 | https://www.thermofisher.com/order/catalog/product/B52#/B52 |
Tea Stainer | amazon | IMU-71133W | avaible in most kitchen stores |
Thermocycler | |||
Transfer Pipette | Uline | S-24320 | |
Transilluminator | |||
Tricaine | fisher scientific | NC0872873 | |
Tris HCl 7.5 | Thermo Fischer Scientific | 15567027 | |
Universal Primer | Integrated DNA Technologies (IDT) | AAAAGCACCGACTCGGTGCCAC TTTTTCAAGTTGATAACGGACTAG CCTTATTTTAACTTGCTATTTCTA GCTCTAAAAC | |
UV lamp | UVP | ||
UV safety glasses | any maker | ||
Wash Bottle | fisher scientific | S39015 | |
Zebrafish mating boxes | any maker | ||
PCR Buffer Recipe | Add 171.12mL sterile H20; 0.393 mL 1M MgCl2; 2.616mL 1M MgCl2; 2.618 mL 1M Tris-HCl (pH 8.4) 13.092mL 1M KCl; 0.262 mL 1% Gelatin. Autoclave for 20 minutes then chill the solotion on ice. Next add 3.468 mL 100mg/mL BSA; 0.262 mL dATP (100mM), 0.262mL dCTP (100mM); 0.262 mL dGTP (100mM); 0.262 mL dTTP (100mL). Alliquote into sterile eppendorf tubes |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved