The authors wish to acknowledge the many Alexandrov lab members who have contributed to the development of the LTE systems over the last 10 years, in particular Sergey Mureev who pioneered the system and developed the SITS ribosome entry site. Figure 1 was created by Biorender.com and reproduced under licence.

This protocol includes detailed media recipes and steps that involve culturing, centrifuging, measuring GFP fluorescence using a multimode platereader, measuring culture OD600nm, and assessing lysate Abs280nm. It also covers the setup and imaging of SDS-PAGE protein gels. The materials required or suggested for this protocol are listed in the Materials spreadsheet. It&#39;s important to note that typical laboratory resources such as media components, centrifuges, tubes, spectrophotometers, and gel e...

Streamlined Protocol for Leishmania Translational Extract (LTE) Production

<ol>
	<li>Nirenberg, M. W., Matthaei, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+dependence+of+cell-free+protein+synthesis+in+E.coli+upon+naturally+occurring+or+synthetic+polyribonucleotides.">The dependence of cell-free protein synthesis in E.coli upon naturally occurring or synthetic polyribonucleotides.</a> Proc Natl Acad Sci USA. 47 (10), 1588-1602 (1961).</li><li>Caschera, F., Noireaux, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+2.3+mg/ml+of+protein+with+an+all+Escherichia+coli+cell-free+transcription-translation+system.">Synthesis of 2.3 mg/ml of protein with an all Escherichia coli cell-free transcription-translation system.</a> Biochimie. 99, 162-168 (2014).</li><li>Kelwick, R., Webb, A. J., MacDonald, J. T., Freemont, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+Bacillus+subtilis+cell-free+transcription-translation+system+for+prototyping+regulatory+elements.">Development of a Bacillus subtilis cell-free transcription-translation system for prototyping regulatory elements.</a> Metab Eng. 38, 370-381 (2016).</li><li>Ezure, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-free+protein+synthesis+system+prepared+from+insect+cells+by+freeze-thawing.">Cell-free protein synthesis system prepared from insect cells by freeze-thawing.</a> Biotechnol Prog. 22 (6), 1570-1577 (2006).</li><li>Harbers, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wheat+germ+systems+for+cell-free+protein+expression.">Wheat germ systems for cell-free protein expression.</a> FEBS Letters. 588 (17), 2762-2773 (2014).</li><li>Kobs, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selecting+the+cell-free+protein+expression+system+that+meets+your+experimental+goals.">Selecting the cell-free protein expression system that meets your experimental goals.</a> Promega Corporation. 21, 6-9 (2008).</li><li>Kovtun, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Leishmania+cell-free+protein+expression+system.">Leishmania cell-free protein expression system.</a> Methods. 55 (1), 58-64 (2011).</li><li>Basile, G., Peticca, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+protein+expression+in+Leishmania+tarentolae.">Recombinant protein expression in Leishmania tarentolae.</a> Mol Biotechnol. 43 (3), 273-278 (2009).</li><li>Mureev, S., Kovtun, O., Nguyen, U. T., Alexandrov, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species-independent+translational+leaders+facilitate+cell-free+expression.">Species-independent translational leaders facilitate cell-free expression.</a> Nat Biotechnol. 27 (8), 747-752 (2009).</li><li>Gambin, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+fluorescence+reveals+the+oligomerization+and+folding+steps+driving+the+prion-like+behavior+of+ASC.">Single-molecule fluorescence reveals the oligomerization and folding steps driving the prion-like behavior of ASC.</a> J Mol Biol. 430 (4), 491-508 (2018).</li><li>Sierecki, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+mapping+of+interactions+between+human+SNX-BAR+proteins+measured+in+vitro+by+AlphaScreen+and+single-molecule+spectroscopy.">Rapid mapping of interactions between human SNX-BAR proteins measured in vitro by AlphaScreen and single-molecule spectroscopy.</a> Mol Cell Proteomics. 13 (9), 2233-2245 (2014).</li><li>Sierecki, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanomolar+oligomerization+and+selective+co-aggregation+of+alpha-synuclein+pathogenic+mutants+revealed+by+single-molecule+fluorescence.">Nanomolar oligomerization and selective co-aggregation of alpha-synuclein pathogenic mutants revealed by single-molecule fluorescence.</a> Sci Rep. 6, 37630 (2016).</li><li>Leitao, A., Bhumkar, A., Hunter, D. J. B., Gambin, Y., Sierecki, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unveiling+a+selective+mechanism+for+the+inhibition+of+alpha-synuclein+aggregation+by+beta-synuclein.">Unveiling a selective mechanism for the inhibition of alpha-synuclein aggregation by beta-synuclein.</a> Int J Mol Sci. 19 (2), 334 (2018).</li><li>Gambin, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+analysis+reveals+self+assembly+and+nanoscale+segregation+of+two+distinct+cavin+subcomplexes+on+caveolae.">Single-molecule analysis reveals self assembly and nanoscale segregation of two distinct cavin subcomplexes on caveolae.</a> Elife. 3, e01434 (2013).</li><li>Ve, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+of+TIR-domain-assembly+formation+in+MAL-+and+MyD88-dependent+TLR4+signaling.">Structural basis of TIR-domain-assembly formation in MAL- and MyD88-dependent TLR4 signaling.</a> Nat Struct Mol Biol. 24 (9), 743-751 (2017).</li><li>Guo, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subunit+organisation+of+in+vitro+reconstituted+HOPS+and+CORVET+multisubunit+membrane+tethering+complexes.">Subunit organisation of in vitro reconstituted HOPS and CORVET multisubunit membrane tethering complexes.</a> PLoS One. 8 (12), e81534 (2013).</li><li>Ruehrer, S., Michel, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+Leishmania+tarentolae+cell-free+extracts+for+the+synthesis+of+human+solute+carriers.">Exploiting Leishmania tarentolae cell-free extracts for the synthesis of human solute carriers.</a> Mol Membr Biol. 30 (4), 288-302 (2013).</li><li>Varasteh Moradi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+Interactions+among+cell-free+expressed+Zika+virus+proteins.">Mapping Interactions among cell-free expressed Zika virus proteins.</a> J Proteome Res. 19 (4), 1522-1532 (2020).</li><li>Gagoski, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-free+pipeline+for+discovery+of+thermotolerant+xylanases+and+endo-1,4-beta-glucanases.">Cell-free pipeline for discovery of thermotolerant xylanases and endo-1,4-beta-glucanases.</a> J Biotechnol. 259, 191-198 (2017).</li><li>Ergun Ayva, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+performance+parameters+of+artificial+allosteric+protein+switches.">Exploring performance parameters of artificial allosteric protein switches.</a> J Mol Biol. 434 (17), 167678 (2022).</li><li>Lau, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+biosensor+for+real-time+interaction+dynamics+of+host+proteins+with+HIV-1+capsid+tubes.">Fluorescence biosensor for real-time interaction dynamics of host proteins with HIV-1 capsid tubes.</a> ACS Appl Mater Interfaces. 11 (38), 34586-34594 (2019).</li><li>Ryan, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+antiinflammatory+biologics+shaped+by+parasite-host+coevolution.">Novel antiinflammatory biologics shaped by parasite-host coevolution.</a> Proc Natl Acad Sci USA. 119 (36), e2202795119 (2022).</li><li>McMahon, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+intracellular+cavin+target+proteins+reveals+cavin-PP1alpha+interactions+regulate+apoptosis.">Identification of intracellular cavin target proteins reveals cavin-PP1alpha interactions regulate apoptosis.</a> Nat Commun. 10 (1), 3279 (2019).</li><li>Sierecki, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cell-free+approach+to+accelerate+the+study+of+protein-protein+interactions+in+vitro.">A cell-free approach to accelerate the study of protein-protein interactions in vitro.</a> Interface Focus. 3 (5), 20230018 (2013).</li><li>Johnston, W. A., Moradi, S. V., Alexandrov, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adaption+of+the+Leishmania+cell-free+expression+system+to+high-throughput+analysis+of+protein+interactions.">Adaption of the Leishmania cell-free expression system to high-throughput analysis of protein interactions.</a> Methods Mol Biol. 2025, 403-421 (2019).</li><li>Jung, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-free+formation+and+interactome+analysis+of+caveolae.">Cell-free formation and interactome analysis of caveolae.</a> J Cell Biol. 217 (6), 2141-2165 (2018).</li><li>Fontaine, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+domain+analysis+of+SOX18+transcription+factor+using+a+single-chain+variable+fragment-based+approach.">Functional domain analysis of SOX18 transcription factor using a single-chain variable fragment-based approach.</a> MAbs. 10 (4), 596-606 (2018).</li><li>Overman, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pharmacological+targeting+of+the+transcription+factor+SOX18+delays+breast+cancer+in+mice.">Pharmacological targeting of the transcription factor SOX18 delays breast cancer in mice.</a> Elife. 6, e21221 (2017).</li><li>Kubala, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+farnesyltransferase+alpha+subunit+regulates+vacuolar+protein+sorting-associated+protein+4A+(Vps4A)--dependent+intracellular+trafficking+through+recycling+endosomes.">Mammalian farnesyltransferase alpha subunit regulates vacuolar protein sorting-associated protein 4A (Vps4A)--dependent intracellular trafficking through recycling endosomes.</a> Biochem Biophys Res Commun. 468 (4), 580-586 (2015).</li><li>Han, S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cortactin+scaffolds+Arp2/3+and+WAVE2+at+the+epithelial+zonula+adherens.">Cortactin scaffolds Arp2/3 and WAVE2 at the epithelial zonula adherens.</a> J Biol Chem. 289 (11), 7764-7775 (2014).</li><li>Das Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Class+IIa+histone+deacetylases+drive+toll-like+receptor-inducible+glycolysis+and+macrophage+inflammatory+responses+via+pyruvate+kinase+M2.">Class IIa histone deacetylases drive toll-like receptor-inducible glycolysis and macrophage inflammatory responses via pyruvate kinase M2.</a> Cell Rep. 30 (8), 2712-2728.e8 (2020).</li><li>Leit&#227;o, A. D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selectivity+of+protein+interactions+along+the+aggregation+pathway+of+&#945;-synuclein.">Selectivity of protein interactions along the aggregation pathway of &#945;-synuclein.</a> BioRxiv. , (2021).</li><li>Gagoski, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+benchmarking+of+four+cell-free+protein+expression+systems.">Performance benchmarking of four cell-free protein expression systems.</a> Biotechnol Bioeng. 113 (2), 292-300 (2016).</li><li>Johnston, W. A., Alexandrov, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+eukaryotic+cell-free+lysate+from+Leishmania+tarentolae.">Production of eukaryotic cell-free lysate from Leishmania tarentolae.</a> Methods Mol Biol. 1118, 1-15 (2014).</li><li>Hunter, D. J. B., Bhumkar, A., Giles, N., Sierecki, E., Gambin, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unexpected+instabilities+explain+batch-to-batch+variability+in+cell-free+protein+expression+systems.">Unexpected instabilities explain batch-to-batch variability in cell-free protein expression systems.</a> Biotechnol Bioeng. 115 (8), 1904-1914 (2018).</li></ol>

Protocols for creating LTE have been published over the past decade7 and have undergone periodic updates25,34. However, newcomers to the technique often encounter a steep learning curve, resulting in delays in achieving high-quality and high-yield protein expression. Similar challenges have been reported by other research groups working with LTE35, particularly concerning significant batch-to-batch variations. The v...

In the 1960s, cell-free protein expression systems played a pivotal role in uncovering the genetic code1. However, prokaryotic cell-free protein expression systems, mainly based on E. coli, currently dominate both laboratory and commercial applications. While E. coli-based systems offer advantages such as cost-effectiveness, scalability, and high expression yields, they face challenges when producing multi-domain proteins in their active forms and facilitating the assembly of protein complexes2,3. In the present day, commonly used forms of eukaryotic Cell-Free Protein Synthesis (CFPS) include wheat germ extract (WGE), rabbit reticulocyte lysate (RRL), and insect cell lysate (ICL)4,5,6. This work introduces an alternative eukaryotic cell-free system that is both straightforward and scalable, based on the unicellular flagellate parasite Leishmania tarentolae.
Leishmania tarentolae can be cultivated easily in flasks using cost-effective media and can also be scaled up in bioreactors to achieve higher cell density. The presence of endogenous mRNAs in cell lysate, which might otherwise compete with introduced messages, can be neutralized using antisense oligonucleotides targeting the conserved Leishmania mRNA splice leader sequence7. Unlike its close relative Leishmania major, which causes human disease, L. tarentolae infects the moorish gecko (Tarentolae mauritanica), making it suitable for cultivation in PC2 laboratory environments without the need for special precautions. It has previously been used as a transgenic organism for in vivo protein expression8.
To facilitate template priming in cell-free systems, universal sequences have been designed based on polymeric RNA structures that enhance translational initiation9. These species-independent translation sequences (SITS) are applicable to both prokaryotic and eukaryotic cell-free systems and are suitable for introducing genetic information into LTE. While this protocol does not provide a detailed explanation of vector construction for LTE cell-free protein expression, optimization and quality control require suitable vectors containing fluorophore fusions of the desired proteins of interest downstream of the SITS site. For this purpose, appropriate LTE vectors have been deposited with the Addgene gene repository, such as the pCellFree_G03 vector, which encodes an N-terminal eGFP fusion to the desired protein of interest using Gateway cloning sites.
LTE has proven its value in a wide range of applications requiring protein expression, including the analysis of protein self-assembly10,16, production of human integral membrane proteins17, research on antiviral drug candidates18, the development of biotechnologically useful enzymes19, prototyping protein biosensors20,21, and the study of biologics from hookworms22. LTE has also been instrumental in mapping Protein-Protein interaction networks in the fields of virology and cellular structures21,32. LTE has been benchmarked to perform similarly to other eukaryotic cell-free systems in expressing full-length, monodispersed, and non-aggregated proteins33, all while offering more cost-effective and scalable production.
This protocol provides techniques for cultivating and disrupting the host organism, preparing lysate, and supplementing a feeding solution (FS) for coupled transcription/translation protein expression. Additionally, it includes a protocol for optimizing production batches. In the initial version of the Leishmania cell-free system, undesired batch-to-batch variation was observed in expression levels, the fraction of full-length proteins, and the presence of protein aggregates, leading to the disposal of batches34. Subsequent protocol improvements were made to address this issue25. The current protocol builds upon these improvements, allowing individual batches to be optimized for peak protein expression and size. It achieves this by closely controlling cell-disrupter loading (measured as optical density at 600 nm; OD600nm) and normalizing the resulting lysate output using absorbance at 280 nm (Abs280nm). Furthermore, it incorporates a method for partially supplementing the lysate with rNTP and magnesium during manufacturing, with subsequent optimization of these feed solution components during test expressions. Although this optimization is presented as an option in the protocol, it is strongly recommended by the authors.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr >
			<td >PD-10 SuperDex 25 Columns</td>
			<td >Cytiva</td>
			<td >17085101</td>
			<td >Gel filtration columns</td>
		</tr>
		<tr >
			<td >Nitrogen Cavitation cell disrupter</td>
			<td >Parr Industries</td>
			<td >4635 or 4639</td>
			<td>Cell Disrupter</td>
		</tr>
		<tr >
			<td >Bovine derived Hemin</td>
			<td >Sigma-Aldrich</td>
			<td >H5533</td>
			<td>Culture additive</td>
		</tr>
		<tr >
			<td >Penicillin/Streptomycin 10000U/ml</td>
			<td >Thermo-Fisher</td>
			<td >15140122</td>
			<td>Antibiotic mix</td>
		</tr>
		<tr >
			<td >Optiplate 384</td>
			<td >Perkin-Elmer</td>
			<td >6007290</td>
			<td>Multiwell plate for 10ul expressions</td>
		</tr>
		<tr >
			<td >Oligonucleotide</td>
			<td >IDT synthesis</td>
			<td ></td>
			<td>&#160;Oligo with sequence CAATAAAGTACAGAAACTGATAC TTATATAGCGTT</td>
		</tr>
		<tr >
			<td >Creatine Phosphokinase</td>
			<td >Sigma-Aldrich</td>
			<td >9001-15-4</td>
			<td>Enzyme</td>
		</tr>
		<tr >
			<td >Tecan Spark</td>
			<td >Tecan</td>
			<td ></td>
			<td >or similar Multimode Platereader</td>
		</tr>
		<tr >
			<td >Chemidoc MP Imager</td>
			<td >Biorad</td>
			<td ></td>
			<td>or similar SDS-PAGE gel Imager</td>
		</tr>
		<tr >
			<td >4-12% Bis-Tris Gels</td>
			<td >Invitrogen</td>
			<td >NW04125</td>
			<td>SDS-PAGE gels</td>
		</tr>
		<tr >
			<td >Biophotometer</td>
			<td >Eppendorf</td>
			<td ></td>
			<td >or similar Cuvette Specrophotometer</td>
		</tr>
		<tr >
			<td >Nanodrop One</td>
			<td >Thermofisher</td>
			<td ></td>
			<td>Nanodrop spectrophotometer</td>
		</tr>
		<tr >
			<td >Avanti JXN-26 centrifuge</td>
			<td >Beckman Coulter</td>
			<td ></td>
			<td>or similar centrifuge, with rotors/tubes rated 10K and 50K g</td>
		</tr>
		<tr >
			<td >5424R microcentrifuge</td>
			<td >Eppendorf</td>
			<td ></td>
			<td>or similar microcentrifuge, with 1.5ml microcentrifuge tubes</td>
		</tr>
		<tr >
			<td >Flask Incubator Inova S44i</td>
			<td >Eppendorf</td>
			<td ></td>
			<td>or similar flask incubator shaker suitable for 5L Flasks</td>
		</tr>
		<tr >
			<td >5L glass culture flasks</td>
			<td ></td>
			<td ></td>
			<td>Baffled glass flasks for culture growth</td>
		</tr>
		<tr >
			<td >Bactotryptone</td>
			<td >BD</td>
			<td >211705</td>
			<td>Growth medium</td>
		</tr>
		<tr >
			<td >Yeast Extract</td>
			<td >Merck</td>
			<td >VM930053</td>
			<td>Growth medium</td>
		</tr>
		<tr >
			<td >Glycerol</td>
			<td ></td>
			<td ></td>
			<td>Any analytical grade</td>
		</tr>
		<tr >
			<td >Glucose</td>
			<td ></td>
			<td ></td>
			<td>Any analytical grade</td>
		</tr>
		<tr >
			<td >KH2PO4</td>
			<td ></td>
			<td ></td>
			<td>Any analytical grade</td>
		</tr>
		<tr >
			<td >K2HPO4</td>
			<td ></td>
			<td ></td>
			<td>Any analytical grade</td>
		</tr>
		<tr >
			<td >UltraPure water</td>
			<td >Invitrogen</td>
			<td >10977-015</td>
			<td>Or output from any MilliQ-type water dispenser</td>
		</tr>
	</tbody>
</table>

production and optimization of lte, a leishmania tarentolae derived cell-free protein expression system for recombinant protein production

This protocol outlines the production and optimization of a eukaryotic Cell-Free Protein Expression System (CFPS) derived from the unicellular flagellate Leishmania tarentolae, referred to as Leishmania Translational Extract or LTE. Although this organism originally evolved as a parasite of geckos, it can be cultivated easily and inexpensively in flasks or bioreactors. Unlike Leishmania major, it is non-pathogenic to humans and does not require special laboratory precautions. Another advantage of using Leishmania for CFPS is that the addition of a single antisense oligonucleotide to the CFPS, targeting a conserved splice leader sequence on the 5'-end of all protein-coding RNAs, can suppress endogenous protein expression. We provide procedures for cell disruption and lysate processing, which have been simplified and improved compared to previous versions. These procedures start with simple flask cultures. Additionally, we explain how to introduce genetic information using vectors containing species-independent translation initiation sites (SITS) and how to perform straightforward batch optimization and quality control to ensure consistent protein expression quality.

Author Spotlight: Protein Production Using the LTE Eukaryotic Cell-Free Protein Expression System

Production and Optimization of LTE, a Leishmania tarentolae Derived Cell-Free Protein Expression System for Recombinant Protein Production

Our cell-free protein expression system, which typically requires a cold chain for transport, now has a pioneering freeze-dried version. This version remains stable at ambient temperatures, making it the first eukaryotic system available in this format. This simplifies transportation to labs and field applications.The current experimental challenges of cell-free protein production include optimizing reaction conditions to ensure that recombinant proteins are properly folded and active. Although the cost-effectiveness of cell-free techniques versus conventional in vivo protein expression remains a significant challenge, the simplicity of our eukaryotic LTE cell-free system to produce helps alleviate this. The LTE cell-free system facilitates swift reconstitution and analysis of protein networks and biosynthetic pathways.Its integration with technologies like AlphaLISA and in vivo assays enables functional analysis of complex systems, including the protein interaction network of SARS-CoV-2 and the hookworm secretome. The LTE cell-free system enables rapid, cost-effective production of hard-to-express proteins in a multiplex format. It offers easy optimization for protein synthesis, excelling in producing complex or toxic proteins.The system is scalable and provides consistent batch-to-batch quality.

The purpose of cell-free protein expression is to produce full-length proteins in a folded, active form suitable for a wide range of applications. LTE (Leishmania tarentolae extract) has previously been compared to other prokaryotic and eukaryotic cell-free expression systems, demonstrating a high capacity to avoid truncation and aggregation when operating optimally, particularly in comparison to E. coli-based cell-free expression33. However, this was previously accompanied by si...

Leishmania Translational Extract (LTE) is a eukaryotic cell-free protein expression system derived from the single-celled parasite, Leishmania tarentolae. This optimized protocol makes LTE simple and cost-effective to manufacture. It is suitable for various applications focused on the multiparallel expression and study of complex eukaryotic proteins and their interactions.

This protocol outlines the production and optimization of a eukaryotic Cell-Free Protein Expression System (CFPS) derived from the unicellular flagellate ...

production-optimization-lte-leishmania-tarentolae-derived-cell-free