The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.
The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. The potential throughput of this assay has, however, been limited by the need to individually clone and assay the activity of each sequence on interest using protein fluorescence or enzymatic activity as a proxy for regulatory activity. Advances in high-throughput DNA synthesis and sequencing technologies have recently made it possible to overcome these limitations by multiplexing the construction and interrogation of large libraries of reporter constructs. This protocol describes implementation of a Massively Parallel Reporter Assay (MPRA) that allows direct comparison of hundreds of thousands of putative regulatory sequences in a single cell culture dish.
Büyük ölçekte paralel Raportör Tahliller (MPRA) DNA dizilerinin 1- 7 yüz binlerce binlerce transkripsiyonel düzenleyici faaliyetlerinin birden fazla mesaj göndermiş ölçümüne izin verir. En genel bir uygulamasında, çoklayıcı bir açık okuma çerçevesinin alt tanıtıcı bir dizi etiketi içeren bir sentetik raportör gene, ilgilenilen her sekansı birleştirilmesi ile elde edilir (ORF, Şekil 1). Transfeksiyon, RNA izolasyonu ve raportör gen transkriptlerinin 3 'uçları arasında derin dizilemesi sonra, birleştirilen dizilerin relatif aktiviteleri, bunların belirlenmesi etiketlerin görece bolluğu sonucu çıkarılabilir.
MPRA Şekil 1. Genel Bakış. MPRA raportör bir kütüphane sentetik varsayımsal düzenleme sekansları şekilde birleştirilmesi yoluyla yapılandırılır konstruktlarıtanımlayıcı bir dizi etiketi ve ardından (örneğin, lusiferaz, GFP ve gibi) bir "etkisiz" ORF oluşmaktadır raportör genler. Kütüphane kültürlenmiş hücrelerin bir popülasyonunun içine transfekte edilir topluca ve kopyalandığı raportör mRNA, daha sonra elde edilir. Derin sıralama muhabiri mRNAların ve nakledilen plazmidlerden arasında her etiket yineleme sayısını saymak için kullanılır. Plazmid sayısı ilgili düzenleyici dizi aktivitesini belirlemek için de kullanılabilir fazla mRNA oranı sayar. Melnikov izni ile uyarlanmıştır, ve ark 2.
MPRA ilgi konusu bir lokus üzerinde yeni bir düzenleyici elemanlar için tek tek gen düzenleme elemanlarının 1) geniş mutajenezi, 2) tarama dahil olmak üzere deney tasarımları çeşitli adapte edilebilir, 3) farazi bir dizi doğal genetik farklılaşmasının etkisinin test edilmesi uyarıcının veya susturucular ve sentetik düzenleyici elemanlar 4) yarı-rasyonel mühendislik. Lidizi varyantlarının braries dejenere oligonükleotidler 1,4, birleştirici ligasyon 8 ve genomik DNA 5 parçalanma oligonükleotid mikrodiziler kütüphane programlanabilir 2,3,6,7 üzerinde sentezi (en küçük kareler), montaj dahil olmak üzere çeşitli yöntemler kullanılarak elde edilebilir.
Bu protokol, promotör bir kütüphanesinin yapımını da tarif eder varyantlarının en küçük kareler ve pMPRA1 ve pMPRAdonor1 vektörleri (sırasıyla Addgene kimlikleri 49349 ve 49352; http://www.addgene.org) kullanılarak kültürlenmiş memeli hücrelerine ve daha sonra kantitatif olarak bu kütüphanenin geçici transfeksiyon ilişkili etiketleri derin sıralama (Etiket-Dizi) tarafından promotör faaliyetleri. Bu protokolün önceki sürümleri (2013) Araştırma 23, 800-811 Melnikov ve ark. Nature Biotechnology 30, 271-277 (2012) ve Kheradpour ve ark. Genome bildirilen araştırmada kullanılmıştır.
1. Dizi Tasarımı ve Sentezi
MPRA_SfiI_F | GCTAAGGGCCTAACTGGCCGCTTCACTG |
MPRA_SfiI_R | GTTTAAGGCCTCCGTGGCCGACGCTCTTC |
TAGseq_P1 | AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATCT |
TAGseq_P2 | CAAGCAGAAGACGGCATACGAGAT [index] GT GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGG |
Tablo 1. Primer dizileri. [Index] çoğullanmış dizileme için kullanılan bir 6 ila 8 nt endeksi diziyi temsil eder. Farklı endeksleri ile en az 8 TagSeq-P2 primerler edinin. TümPrimerlerin HPLC veya PAGE ile arındırılmalıdır.
Reaktif | 1x Hacmi (ul) |
Herculase II Füzyon DNA Polimeraz | 0.5 |
5x Herculase II Reaksiyon Tamponu | 10 |
dNTP (10 mM) | 1.25 |
BSA (20 mg / ml) | 1.25 |
Astar MPRA_SfiI_F (25 uM) | 0.25 |
Astar MPRA_SfiI_R (25 uM) | 0.25 |
EKK şablonu (1-10 attomol) | değişir |
Nükleazlar içermeyen su | 50 |
Oligonükleotit sentezi kütüphanelerinin Şekil 2. hazırlanması a.) Üç farklı ham oligonükleotid sentezi kütüphaneleri (EKK)% 10 TBE-Üre poliakrilamid jelleri üzerinde çalıştırın. Tam uzunlukta oligonükleotitlerin (*) karşılık gelen bantları görsel ve kütüphanelerden 1 den kesilmiş ve 2. Library 3 SAYFA arıtma müdahale kontaminatlar edilebilir. Bu durumda ise, bir agaroz jel üzerinde, aynı oligonükleotid kütüphane çalışmasının açık ve emülsiyon PCR amplifikasyonu PCR amplifikasyonu. Ürünler, b) doğrudan devam edin. Karmaşık oligonükleotid kütüphanelerin PCR sık kimerik ürünler ve daha yüksek ve daha düşük bantları gibi görünebilir diğer eserler oluşturur. Emülsiyon PCR, bu eserler en aza indirebilirsiniz.
2. Kütüphane İnşaatı
3. Transfection, Perturbasyon, ve RNA İzolasyonu
4. Etiket-Sıra
Reaktif | 1x Hacmi (ul) |
mRNA numunesi (400-700 ng toplam) | 8 |
Oligo 0DT (50 uM) | 1 |
dNTP (10 mM) | 1 |
Reaktif | 1x Hacmi (ul) |
10x SuperScriptTM III RT Tampon | 2 |
MgCI2 (25mM) | 4 |
DTT (0.1 M) | 2 |
RNaseOut (40 U / ml) | 1 |
Üst Simge III (200 U / ml) | 1 |
Tablo 4. cDNA sentez reaksiyon karışımı.
Reaktif | 1x Hacmi (ul) |
2x PfuUltra II HotStart PCR Master Mix | 25 |
Astar TagSeq_P1 (25 uM) | 0.5 |
Astar TagSeq_P2 (25 uM) | 0.5 |
Şablon (mRNA, cDNA ya da plazmid DNA karışımı) | değişir |
Nükleazlar içermeyen su | 50 |
Tablo 5. Etiket-Dizi PCR reaksiyon karışımı.
MPRA yüksek çözünürlüklü, transkripsiyonel düzenleyici elemanlarının dizi-etki ilişkileri kantitatif diseksiyon kolaylaştırır. Başarılı bir MPRA deney tipik olarak transfekte kitaplığı (Şekil 3A) dizilerin çoğunluğu için yüksek ölçüde tekrarlanabilir ölçümleri sağlayacaktır. Zayıf tekrarlanabilirlik (Şekil 3B) gözlenirse, bu durum, test dizileri arasında 1) düşük bir mutlak aktivitesi, ya da 2) düşük transfeksiyon verimi birine, geri kazanılan RNA örnekleri raportör mRNA, çok düşük bir konsantrasyonda bir göstergesidir.
Şekil 4, analiz etmek sureti ile üretilen bir temsili "bilgi izi" 1,2 gösterir ~ ya da Sendai virüsü maruz kalmadan HEK293 hücrelerinde insan IFNB geninin üst akışında bir 145 bp dizisinin rastgele 37000 varyantları. Promotör TATA-kutu ve bilinen yakın güçlendirici 10 açık bilgi açısından zengin Regi olarak tanımlanabilirbir virüs-bağlı bir şekilde ortaya koymuşlardır.
Şekil 3. Etiket-Dizi tekrarlanabilirlik. Yüksek (A) ve düşük (B) tekrarlanabilirlik ile iki bağımsız çoğaltmak transfeksiyonlann Etiket-Sıra verilerden örnekler gösteren Dağılım araziler. İkincisi arsa iki çoğaltır sadece birinde yüksek mRNA sayıları ile birçok Aykırı etiketleri gösterir. Bu tür yapılar, tipik olarak, raportör mRNA'ların konsantrasyonu nedeniyle raportör yapılan arasında düşük mutlak aktiviteler, veya düşük transfeksiyon verimi için, ya da kantitatif PCR amplifikasyonu için çok düşük olduğunu göstermektedir.
Insan IFNB transkripsiyon başlama alanı ile yakın arttırıcının Şekil 4. bilgi izi. yukan insan IFNB geninin bir 145 nükleotid (nt) bölgesi yaklaşık 37,000 rastgele varyantları, (A) ve Sendai virüsü (B) maruz kalmayan HEK293 hücrelerinde MPRA kullanılarak tahlil edilmiştir. Mavi çubuk her pozisyondaki raportör çıkışı ile nükleotid arasındaki karşılıklı bilgileri gösterir. Proksimal arttırıcı ve TATA kutusu viral enfeksiyon üzerinde yüksek bilgi içeriği bölgeleri olarak öne çıkıyor.
MPRA is a flexible and powerful tool for dissection of sequence-activity relationships in gene regulatory elements. The success of MPRA experiments depend on at least three factors: 1) careful design of the sequence library, 2) minimization of artifacts during amplification and cloning, and 3) high transfection efficiency.
The possible lengths of the variable regions in the reporter constructs are largely determined by the synthesis or cloning technology used. Standard OLS is generally limited to about 200 nt, but this protocol is compatible with inserts up to at least 1,000 nt. Note that variable regions that are highly repetitive or contain strong secondary structures may end up underrepresented due to PCR and cloning biases. The length of the tags that identify each of the variable regions should be 10-20 nt and the collection of tags should ideally be designed such there are at least two nucleotide differences between any pair. Tags that contain the seed sequences of known microRNA or other factors that might influence mRNA stability should also be avoided when possible.
A key parameter in the design of MPRA experiments is the total number of distinct reporter constructs to be included in the library (the design complexity, denoted CD). In practice, CD is limited by the number of cultured cells that can be transfected. As a rule of thumb, the total number of transfected cells should be at least 50-100 times greater than CD. For example, if 20 million cells can be transfected with a transfection efficiency of 50%, then CD should be no more than ~200,000. Note that CD is equal to the number of distinct regulatory sequence variants multiplied by the number of distinct tags per sequence. The more distinct tags are linked to each regulatory sequence, the more accurate the estimate of the activity of that sequence can be made (because measurements from distinct tags can be averaged), but the fewer distinct variants can be assayed in one experiment. The optimal choice depends on the experimental design. In a simple “promoter bashing” experiment, where a mathematical model will be fitted to the aggregated measurements, a single tag per variant is usually sufficient. In a screen for single-nucleotide polymorphisms that cause changes in regulatory activities, it may be necessary to use 20 or more tags per allele to obtain statistically robust results, because comparing each pair of alleles requires a separate hypothesis test.
If the sequences to be assayed are not expected to contain transcription start sites, a constant promoter can also be added in the same fragment. For example, pMPRAdonor2 (Addgene ID 49353) includes a minimal TATA-box promoter that is useful when the upstream variable region is expected to have significant enhancer activity, while pMPRAdonor3 (Addgene ID 49354) includes a modified, strong SV40 viral promoter that is useful when the variable region is expected to contain silencer activity or other negative regulatory elements.
Raw OLS products often contain a significant fraction of truncated oligonucleotides. These may interfere with accurate PCR amplification of the designed sequences, particularly when there is significant homology between them. Using PAGE purification to remove truncated synthesis products and emulsion PCR to minimize amplification artifacts are effective techniques for ensuring high library quality. If either step is impractical, it is imperative to minimize the number of PCR cycles used at each amplification step. Selection and expansion of the cloned library in liquid culture is generally sufficient to maintain the design complexity, but if recombination-prone vectors are to be used or significant representation bias is observed, the recovered cells can instead be plated directly onto large LB agar plates, expanded as individual colonies and then scraped off for DNA isolation. It is also important to consider the potential impact of synthesis errors, which are typically found at a rate of 1:100-500 in OLS. Full-length sequencing of the reporter constructs prior to transfection is recommended to identify and correct for such errors.
It is not necessary to introduce reporter constructs into every cell in the transfected culture, but transfection efficiencies below ~50% may lead to poor signal to noise ratios. It is advisable to optimize transfection conditions prior to performing MPRA experiments in a new cell type. When working with hard-to-transfect cell types, MPRA signals can be boosted by pre-selecting transfected cells. The pMPRA vector series includes variants that constitutively express a truncated cell surface marker that can be used to physically enrich for transfected cells prior to RNA isolation (for example, Addgene IDs 49350 and 49351).
Yazarlar hiçbir rakip mali çıkarlarının olmadığını beyan ederim.
Bu çalışma Ödülü Numarası R01HG006785 altında Ulusal Sağlık Enstitüleri Ulusal İnsan Genomu Araştırma Enstitüsü tarafından desteklenmiştir.
Name | Company | Catalog Number | Comments |
Oligonucleotide library synthesis | Agilent, CustomArray or other OLS vendors | custom | If using OLS construction method |
pMPRA1 | Addgene | 49349 | MPRA plasmid backbone |
pMPRAdonor1 | Addgene | 49352 | luc2 ORF donor plasmid |
TE 0.1 Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0) | Generic | n/a | OLS buffer |
Novex TBE-Urea Gels, 10% | Life Technologies | EC6875BOX | PAGE purification of OLS products |
Novex TBA-Urea Sample Buffer | Life Technologies | LC6876 | PAGE purification of OLS products |
SYBR Gold Nucleic Acid Gel Stain | Life Technologies | S-11494 | PAGE purification of OLS products |
Micellula DNA Emulsion & Purification Kit | EURx/CHIMERx | 3600-01 | Library amplification by emulsion PCR |
Herculase II Fusion DNA Polymerase | Agilent | 600675 | Polymerase for emulsion PCR |
SfiI | New England Biolabs | R0123S | Library cloning with pMPRA vectors |
KpnI-HF | New England Biolabs | R3142S | Library cloning with pMPRA vectors |
XbaI | New England Biolabs | R0145S | Library cloning with pMPRA vectors |
T4 DNA Ligase (2,000,000 units/ml) | New England Biolabs | M0202T | Library cloning with pMPRA vectors |
One Shot TOP10 Electrocomp E. coli | Life Technologies | C4040-50 | Library cloning with pMPRA vectors |
LB agar and liquid media with carbenicllin | Generic | n/a | Growth media for cloning |
E-Gel EX Gels 1% | Life Technologies | G4010-01 | Library verification and purification |
E-Gel EX Gels, 2% | Life Technologies | G4010-02 | Library verification and purification |
MinElute Gel Extraction Kit | Qiagen | 28604 | Library and backbone purification |
EndoFree Plasmid Maxi Kit | Qiagen | 12362 | Library DNA isolation |
Cell culture media | n/a | n/a | Experiment-specific |
Transfection reagents | n/a | n/a | Experiment-specific |
MicroPoly(A)Purist Kit | Life Technologies | AM1919 | mRNA isolation |
TURBO DNA-free Kit | Life Technologies | AM1907 | Plasmid DNA removal |
SuperScript III First-Strand Synthesis System | Life Technologies | 18080-051 | cDNA synthesis |
PfuUltra II Hotstart PCR Master Mix | Agilent | 600850 | Polymerase for Tag-Seq PCR |
Primers (see text) | IDT | custom | PAGE purify Tag-Seq primers |
Bu JoVE makalesinin metnini veya resimlerini yeniden kullanma izni talebi
Izin talebiThis article has been published
Video Coming Soon
JoVE Hakkında
Telif Hakkı © 2020 MyJove Corporation. Tüm hakları saklıdır