Paul Blainey, Jong-Bong Lee ve Samir Hamdan uzanan DNA testinin geliştirilmesi yardımıyla oldu. Bu çalışma, Charles Richardson (GM54397) ve Antoine van Oijen (GM077248) Sağlık hibe Ulusal Sağlık Enstitüleri tarafından desteklenmektedir.

1. DNA replikasyonu Şablonu Reaksiyon için DNA replikasyon çatal oluşturmak için oligonükleotidler tavlama tarafından değiştirilmiş Lineerleştirilmiş λ DNA. Ayrıca, biotin λ DNA iplikçik sonuna kadar bağlı olduğu ve bir digoxigenin benzer parçaları aynı iplikçik 1 diğer ucuna takılı. Malzemeler: bakteriyofaj λ DNA Oligonükleotidler: biotinlenmiş çatal kol (A: 5&#39;-biotin-AAAAAAAAAAAAAAAAGAGTACTGTACGATCTAGCATCAATCACAGGGTCAGGTTCGTTATTGTCCAACTTGCTGTCC-3 &#39;), λ-tamamlayıcı çatal kol (B: 5&#39;-GGGCGGCGACCTGGACAGCAAGTTG GACAATCTCGTTCTATCACTAATTCACTAATGCAGGGAGGATTTCAGATATGGCA-3&#39;), çatal astar (C: 5 &#39; -TGCCATATCTGAAATCCTCCCTGC-3 &#39;), λ-tamamlayıcı digoxigenin sonunda (D: 5&#39;-AGGTCG CCGCCCAAAAAAAAAAAA digoxigenin-3&#39;), T4 DNA ligaz, T4 polinükleotid kinaz, Isı bloğu. <ol><li> T4 Polinükleotid Kinaz kullanarak, B ve D oligonükleotidler 5 &#39;uçları Phosphorylate. </li><li> A ve B oligonükleotidler 10 kat daha fazla ve T4 DNA ligaz tamponu oligonükleotid C 100 kat daha fazla ekleyerek bir adım λ DNA oligonükleotidler A, B, ve C Tavlama. </li><li> 65 ° C ısı bloğu karışımı ısıtın. Isıtmalı, ısı bloğu kapatın ve düzgün oligonükleotidler tavlama yavaş soğutma izin. </li><li> T4 DNA ligaz karışıma ekleyin ve 2 saat oda sıcaklığında inkübe edin. T4 DNA ligaz oligonükleotidler A ve B, ve λ DNA doğru birleştirilmesi katalize. </li><li> Son olarak, T4 DNA ligaz tamponu l DNA saygı oligonükleotid D 100 kat daha fazla ekleyerek DNA replikasyonu şablonu oligonükleotid D tavlama. </li><li> 45 ° C 30 dakika, ısıtma bloğu ve oda sıcaklığına kadar soğumasını yavaş ısıtma bloğu kapatarak karışımı inkübe edin. </li><li> Son DNA replikasyonu şablonu artık kullanıma hazır. Biz 4 1.4 nM konsantrasyonda şablonu depolamak ° C&#39;de birkaç hafta boyunca. </li></ol> 2. Boncuk Boncuk digoxigenin özgüllüğü ile Fab parçası Fonksiyonlu. Daha sonra DNA replikasyonu şablon 2 eklenebilir. Malzemeler: Tosyl aktif boncuk, α-digoxigenin Fab parçası, A Buffer: 0,1 M H3BO3 pH 9.5, Tampon B: 0,1 M PBS pH 7.4,% 0.1 w / v BSA, Tampon C: 0.2 M Tris-HCl, pH 8.5 (25 ° C),% 0.1 w / v BSA, Manyetik Ayırıcı, Rotator. <ol><li> Boncuk stok solüsyonu süspanse edin ve Eppendorf tüp içine küçük bir kısım aktarmak. Tüp çözüm temizler kadar manyetik ayırıcı ve inkübe bir yuvaya yerleştirin, sonra pipetleme tarafından süpernatant kaldırmak. </li><li> Tosyl antikor kaplin grupları etkinleştirmek hangi bir tampon ekleyin. Pipetleme tarafından yavaşça karıştırın ve manyetik ayırıcı ile tampon kaldırmak. </li><li> Tampon A, tekrar Fab parçası ve tekrar süspansiyon boncuk ekleyin, iyice karıştırın ve 37 ° C kullanarak rotator 16-24 saat inkübe edin. Inkübasyondan sonra, ayrı boncuk manyetik ayırıcı ve tampon kaldırmak. </li><li> 5 dakika boyunca tampon B ve 4 ° C&#39;de inkübe ekleyerek boncuk yıkayın. Manyetik ayırıcı kullanarak tampon çıkarın. Yıkama iki kez tekrarlayın. </li><li> Ücretsiz tosyl grupları engellemek için 4 saat süreyle inkübe ° C 37 ° tampon C ve ekleyin. Ayrı boncuk manyetik ayırıcı ve tampon çıkarın. </li><li> Tampon B ve kullanmak için kısım iki kez yıkayın. Boncuk 4 saklanabilir ° C için önemli kalite kaybı (bizim stok solüsyonu içeren 1 - 2x10 9 boncuk / ml) olmadan en az 1 yıl veya daha uzun. </li></ol> 3. Fonksiyonlu lameller DNA cam lamel ek izin vermek için, cam, daha sonra biotinlenmiş PEG moleküllere birleştiğinde bir aminosilane, ilk işlevselleştirildiyse. Bu kaplama yüzeyi 3,4 ile non-spesifik etkileşimler, DNA ve çoğaltma proteinler azaltmaya yardımcı olur . Malzemeler: Cam lamelleri, Boyama kavanoz, 3-aminopropyltriethoxysilane, metoksi-PEG5k-NHS ester, Biotin-PEG5k-NHSester, Aseton, 1M KOH, Etanol, Fırın, Banyo sonikatör <ol><li> Cam kavanoz boyama ve etanol ile kavanoz dolum onları yerleştirerek lamelleri iyice temizleyin. Kavanoz yıkayın ve 1 M KOH ile doldurun, 30 dakika boyunca sonikasyon. Hem yıkar tekrarlayın. </li><li> Ilk işlevsellik tepki için, tüm su izlerini kaldırılması gerekir. 10 dakika aseton ve sonikasyon kavanozları doldurun. Aseton ile boşaltın ve yeniden doldurun. </li><li> 2% v / v aseton silan reaktif bir çözüm hazırlayın. Boyama kavanoz ekleyin ve 2 dakika boyunca ajitasyon. Bu reaksiyon çiftler cam aminosilane alkoksi grup, bir sonraki kaplin adım için bir reaktif amin bırakarak. Büyük bir su fazlalığı ile reaksiyon Quench. </li><li> 110 pişirme lamelleri Kuru °; C fırında 30 dakika. </li><li> 100 mM NaHCO 3 pH 8.2 50:1 metoksi: biotin PEG karışımı hazırlayın. Amaç yaklaşık% 0.2 w / v biotinlenmiş PEG. </li><li> Pipet 100 mcL kuru Silanlanmış lamel ve yer üstünde başka bir lamel üzerine PEG karışımı. Bir cam lamel spacer dahil lamelleri ayrılması sağlayacaktır. </li><li> 3 saat PEG çözüm lamelleri inkübe edin, sonra her çift lamelleri ayrı ve suyla iyice yıkayın. Sadece bir kez yan PEG ile kaplı olacak gibi lamelleri yan Fonksiyonlu tutmak için dikkatli olun. </li><li> Lamelleri desikatöre vakum altında ve hava deposu ile kurulayın. Yüzeyler en az ayda bir sabit kalır, bu yüzden onlarca lamelleri bir toplu yapılan ve gerektiği gibi kullanılabilir. </li></ol> 4. Akış Odası Hazırlık Deney Fonksiyonlu lamel, çift taraflı bant, kuvars slayt ve boru ile yapılan basit bir akış odası kullanılarak yapılır. Bir akış odasının her biri tek-molekül deney 2,4 için hazırlanmıştır . Malzemeler: Çift taraflı bant, jilet, boru, çabuk kuruyan, epoksi delikli kuvars slayt, işlevselleştirildiyse lamel, streptavidin çözümü (1 mg / mL PBS içinde 25 mcL), boru, engelleme tampon (5X: 20 mM Tris, pH 7.5, 2 mM EDTA, 50 mM NaCl, 0.2 mg / ml BSA,% 0.005 Tween-20), çalışma tampon (1X: 20 mM Tris-HCl, pH 7.5, 2 mM EDTA, 50 mM NaCl). <ol><li> Karıştırma ve engelleme tampon ve sonraki adımlar için herhangi bir hava kabarcıklarını çıkarmak için bir desikatöre tampon çalışma 20 ml 5 ml koyarak başlayın. </li><li> PEG-Fonksiyonlu lamel alın ve PBS-seyreltilmiş streptavidin çözüm yüzey üzerinde 125 yayıldı. Streptavidin yüzey biotins bağlamak için izin vererek, odanın diğer bölümlerine hazırlarken oda sıcaklığında 20 dakika inkübe bırakın. </li><li> Kuvars slayt boyutuna uyacak şekilde çift taraflı bant bir parça kesin. Akış odasının bir taslak bant çizilebilir, böylece bant boru delik konumunu işaretleyin. </li><li> 3 mm çapında bir merkez kanal ve iki delik içeren dikdörtgenler olun. Biz iki giriş ve iki çıkış Y-şekilli kanal akışı odaları kullanın. </li><li> Kanal içine herhangi bir yapışkan çıkıntı emin olmak için düz ve temiz kesim, çizilen taslak boyunca kesin. </li><li> Kuvars iyice kullanarak aseton veya etanol önceki akış hücresi inşaat yapıştırıcı çıkarmak için temizleyin. </li><li> Kanal anahat iyi hizalama, bir tarafı yapışkanlı arka kaldırmak ve kuvars slayt üzerine bandı dikkatlice yerleştirin. Giriş ve çıkış delikleri unblocked kalmaya ihtiyacı gibi, bant düzgün hizalamak için dikkatli olun. </li><li> Akış hücresi giriş ve çıkış boru uzunlukları kesin. Bu tüp odası dibine düz basın böylece ilgili bir 30 ° açı tüp sonuna kesmek için yardımcı olur. Sonraki adımlar akış hücresi kolay eki için askıya destek (örneğin tüp rafları) bir çeşit tüpler yerleştirin. </li><li> Streptavidin kaplı lamel su ile iyice durulayın ve basınçlı hava kullanarak kurutun. Sadece bir tarafı Fonksiyonlu olduğunu unutmayın. Teyp yedekleme diğer tarafına çıkartın ve kuvars slayt lamel üzerine yerleştirin. </li><li> Yapıştırıcı sıkışıp herhangi bir hava hafifçe dışarı itmek için lamel basın. Bu akış kanalı içine almak herhangi bir hava kabarcıkları önlemeye yardımcı olacaktır. </li><li> Epoksi ile odasının yanında Seal. Kesilmiş boru epoksi ile kuvars ve mühür deliklere yerleştirin. Bu, birkaç dakika kurumasını gerekiyor. </li><li> Kuruduktan sonra, bazı gazlar engelleme tampon tüplerinden biri aracılığıyla çekerek yüzey engelleme başlar. 21-gauge iğne, 0,76 mm boru içinde mükemmel uyum sağlar. Hava kabarcıklarını çıkarmak için birkaç kez yıkayın ve odasının en az yarım saat süreyle inkübe izin. </li></ol> 5. Tek molekül Çoğaltma Deney DNA şablonu ve Fonksiyonlu boncuk hazırlanan ve akış odasının hazır var, tek bir molekülün deney yapılabilir. Malzemeler: Hazır akış odası, Engelleme tamponu (5X: 20 mM Tris-HCl, pH 7.5, 2 mM EDTA, 50 mM NaCl, 1 mg / ml BSA,% 0.025 &#39;Tween-20), Çalışma tamponu (1X: 20 mM Tris-HCl pH 7.5, 2 mM EDTA, 50 mM NaCl), T7 çoğaltma tamponlar veya 10mM MgCl 2 olmadan (1X: 40 mM Tris-HCl, pH 7.5, 50 mM K-glutamat, 2 mM EDTA, 100 mg / ml BSA, 10 mM DTT, 600 mcM dNTP), çoğaltma proteinleri, 10X amacı, CCD kamera, kalıcı nadir toprak mıknatısı, şırınga pompası, airspring, fiber aydınlatma, bilgisayar görüntü elde etme yazılımı ile ters optik mikroskop. <ol><li> Akış hücresi bloke edildikten sonra, denemeyi başlatmak için hazır. </li><li> Akış hücresi ve mikroskop sahne üzerine yerleştirin. Sahne klipler ile oda tutunve akış kanal CCD kamera ile uyum içinde yerleştirilmiş olduğundan emin olun. </li><li> Akış hücresi çıkış tüpleri, daha büyük çaplı bir konnektör boru veya bir iğne kullanarak airspring bağlayın. Airspring herhangi bir akım düzensizliklerini stabilize etmek için kullanılır. 50 ml plastik tüp 45ml su ile dolu. Epoksi ile tüp kapağı kapatılır. Üç delikler kapak delinmiş ve üç adet tüp tüp içine yerleştirilir. Epoksi kullanarak, tüpleri sonra girerek veya kaçan herhangi bir hava önlenmesi, kapağı mühürlenir. Airspring şırınga pompa ve akış hücresi çıkışına tüpler bağlıdır. </li><li> Yerleştirin ve tampon engelleme akışını hücrenin giriş tüpleri, tüp içindeki herhangi bir havayı çıkarmak için şırınga geri çekin. Çıkış borusunun nazik bir fiske akış hücresi sıkışmış olan herhangi bir hava kabarcığı temizlenmesine yardımcı olacaktır. </li><li> Tüm hava kabarcıkları kaldırıldı, bir iğne ile giriş tüpleri biri olan ve 1800 ile bükme ve tüp yapışkan bant ile güvence çıkış tüpleri bir blok. </li><li> 10:00 gazlar engelleme tampon 1 ml stok DNA şablonu sulandırınız. DNA (20 dakika ,01-0,05 ml / dak iyi çalışır) iyi yüzey kapsama sağlamak için orta akış hızında odasına Akış. Bu lamelleri her parti için yüzeyde ya da deney için kaç istenilen kaç DNA molekülleri dayalı çeşitli olabilir. </li><li> 2-4x10 6 boncuk / ml 1 ml gazlar engelleme tampon stok boncuk çözüm sulandırınız. 0,01-0,05 ml / dk 15 dakika odasına Akış. </li><li> Boncuk eklendi akışı kapatın ve odasına dengeye ulaşması için izin. Sonra her iki çıkış tüpleri kapatın. Kabinsiz tüpler herhangi bir değişiklik, boncuk ve kesme gergin DNA molekülleri üzerinde güçlü bir kuvvet uygularlar basınç dalgalanmalara neden kapattı. </li><li> Bir iğne ile boncuk yüklemek için kullanılan giriş tüp blok ve akış hücresi, çalışma tampon engelleme tampon gazlar 1X çözümü ile ikinci giriş kullanarak yıkama başlamak. 0,01-0,05 ml / dak hızında iyice yıkayın. Nonspecifically yüzey (yapışmış herhangi bir boncuk kaldırmak için dokunarak sahne elle <a href="https://www.jove.com/files/ftp_upload/1689/Tapping.avi">dokunulduğunda</a> çalkalayın ). </li><li> Ücretsiz boncuk yeterince kaldırıldıktan sonra, akış kapatın ve odasına dengeye ulaşması için izin. Kapatın ve açık çıkış borusunun giriş haznesi protein solüsyonu geçiş, yavaş yavaş, hızlı basınç değişiklikleri önlemek için çıkış açılış </li><li> Boncuklar, akış yönünü (değiştirerek DNA gergin olup olmadığını kontrol <a href="https://www.jove.com/files/ftp_upload/1689/DNA.avi">edebilirsiniz DNA</a> ) . </li><li> Şimdi, enzimatik reaksiyon yapılabilir. Önde gelen iplikçik sentez deneyleri GP4 helikaz ve MgCl 2 içermez gazlar T7 çoğaltma tampon GP5 polimeraz (processivity faktör tiyoredoksin ile bir kompleks olarak arıtılmış) 20nm çözüm, 20nm çözüm olun . </li><li> DNA verimli bağlama izin orta akış hızında odasına protein çözüm Akış. 0.037 ml / dk 8 dakika sonra 0.012 ml / dk 7 dakika. </li><li> MgCl 2 olmadan gazlar T7 çoğaltma tamponu ile serbest proteinler kaldırmak için odasına yıkayın. 0.037 ml / dk 3-10 dakika oranı gayet iyi çalışıyor. </li><li> Yıkadıktan sonra, akış T7 çoğaltma MgCl 2 ile tampon ve veri toplama başlar. 0.012 ml / dak bu protokolde belirtilen koşullar altında DNA hayvan iplerini 3 pN sürtünme kuvveti uygun bir akış hızını kullanın. </li><li> Görüntüleme nonspesifik boncuk ve yüzey arasındaki etkileşimleri önlemek için önce bir akış hücresi üzerinde nadir toprak kalıcı mıknatıs yerleştirin. </li><li> 10X objektif ve CCD kamera ile saha. Gergin bir boncuk kullanarak odaklanın. </li><li> Bir fiber ışığı 10 derece ve mikroskop yakın mikroskop aşamasına paralel arasındaki insidansı açıyla yerleştirin. Karanlık alan aydınlatma boncuk görüntülemede kontrast arttırmak için kullanılır. </li><li> 20 30 dakika süreyle yavaş bir kare hızı (genellikle 2-4 Hz) veri almak. </li></ol> 6. Temsilcisi Sonuçlar Başarılı bir deneyde (aynı anda 100&#39;den fazla boncuklar gözlemlemek <a href="https://www.jove.com/files/ftp_upload/1689/Leading_strand_synthesis.avi">gerekir Lider iplikçik</a> sentez) . Deney önde gelen iplikli DNA sentezini gösteren sayısız izlerini boyun eğmek zorundadır. Veri Analizi: DNA ve polimerizasyon gevşemek oranları ve processivities ölçmek için, boncuk kesin pozisyonları tespit edilmelidir. 2-boyutlu Gauss fonksiyonları ile bu pozisyonları takarak elde edebilirsiniz. Yörüngeler sonra izleme yazılımı (örneğin DiaTrack) kullanarak her bir karenin izleme boncuk pozisyonu ile elde edilebilir. Şimdi, böylece herhangi bir grafik kullanarak zamanın bir fonksiyonu olarak boncuk pozisyonu komplo ile yörüngeleri görselleştirmek için hazırızFtware (örneğin Kökeni). Oran veri elde etmek için, lineer regresyon ile araziler uyum ve eğimi hesaplamak. Processivity için, başından sonuna kadar bir kısalma olay (Şekil 3) DNA toplam uzunluğu belirler. Her ikisi de bu sayıların basepairs dönüştürülebilir gerekecektir. Basepairs için boncuk hareket dönüştürmek için, ilk reaksiyon debisi uzatılmış λ DNA molekülünün uzunluğunu ölçmek gerekir. Λ DNA uzunluğu (48.502 bp) bilindiğinden deneysel gücü az sayıda baz çifti / piksel kalibre edebilir. Artan doğruluğu için bir temel eser ilgi enzimatik değişmez bir boncuk sabrının izlerini çıkarmak. Tüm tek ölçüm ve çizim hızı ve processivity dağıtımları birleştirin. Gauss ve tek üstel fonksiyonlar, sırasıyla (Şekil 3) kullanarak veri sığdır. <img src="/files/ftp_upload/1689/1689fig1.jpg" alt="Şekil 1" /> Şekil 1. Tek molekül deney düzeneği. (A) Dubleks λ DNA (48.5 kb) 5 üzerinden akışını hücrenin yüzeyine bağlı &#39;biotin streptavidin etkileşimi kullanarak bir iplikçik sonu ve 3&#39; aynı iplikçik sonu kullanarak bir boncuk eklenir digoxigenin anti-digoxigenin etkileşim. Astarlanmalıdır çoğaltma çatal polimeraz yükleme izin boncuk karşısında sonunda oluşur. (B) Boncuk-DNA meclisleri laminer akış tampon kullanarak gergin ve geniş alan optik mikroskop kullanarak görüntülü. Sürekli bir germe kuvveti korurken, zamanla boncuk pozisyonları takip ederek, DNA yapıları uzunlukları izlenebilir. (C) düşük kuvvetler altında Uzantısı ssDNA profili (dolu daire) ve dsDNA (açık daire). Kesikli çizgi kristalografik tam ds-λ DNA uzunluğu, 16.3 mm gösterir. SsDNA ve dsDNA arasındaki uzunluğu 3 pN etrafında güçlerine büyük bir fark DNA uzunluğu izleme değişiklikleri ss ve dsDNA arasındaki dönüşümlerin doğrudan gözlem sağlar. DNA birleştiğinde boncuklar çok sayıda eş zamanlı görselleştirme, bir deney birçok bireysel replisomes çalışması için olanak sağlar. <img src="/files/ftp_upload/1689/1689fig2.jpg" alt="Şekil 2" /> Şekil 2 bakteriyofaj T7 çoğaltma proteinler: DNA polimeraz (GP5 ve tiyoredoksin kompleks) ve DNA helikaz (GP4) deoxyribonucleotides ve magnezyum varlığında DNA lideri iplikçik sentez. Bu süreç, kıvrılma için DNA gecikmeli iplikçik kısaltılması ile eşlik ediyor. DsDNA boncuk ssDNA pozisyon değiştirir haline dönüştürülmesi. Boncuk pozisyon ölçme DNA replikasyon hızı ve processivity hassas tayini sağlar. <img src="/files/ftp_upload/1689/1689fig3.jpg" alt="Şekil 3" /> Şekil 3 tipik bir veri tek bir molekül önde gelen iplikçik sentez deney örneği. DNA replikasyonu Processivity bir kısalma olayı başından sonuna kadar DNA toplam uzunluğu eşittir. DNA replikasyon oranı lineer regresyon arsa montaj ve eğimin hesaplanması ile elde edilir. Ölçümlerin bir dizi veri birleştirerek elde edildi içerlek gösterir oranı ve processivity dağılımları. Veriler sırasıyla, Gauss ve tek üstel fonksiyonlar kullanarak monte edildi.

<ol>
	<li>Lee, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+primase+acts+as+a+molecular+brake+in+DNA+replication.">DNA primase acts as a molecular brake in DNA replication.</a> Nature. 439, 621-624 (2006).</li><li>Tanner, N. A., van Oijen, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+observation+of+prokaryotic+DNA+replication.">Single-molecule observation of prokaryotic DNA replication.</a> Methods Mol Biol. 521, 397-410 (2009).</li><li>Sofia, S. J., Premnath, V. V., Merrill, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly(ethylene+oxide)+Grafted+to+Silicon+Surfaces:+Grafting+Density+and+Protein+Adsorption.">Poly(ethylene oxide) Grafted to Silicon Surfaces: Grafting Density and Protein Adsorption.</a> Macromolecules. 31, 5059-5070 (1998).</li><li>Tanner, N. A., Loparo, J. J., van Oijen, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+single-molecule+DNA+replication+with+fluorescence+microscopy.">Visualizing single-molecule DNA replication with fluorescence microscopy.</a> J Vis Exp. , (2009).</li><li>Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+DNA+replication+loops+reveal+temporal+control+of+lagging-strand+synthesis.">Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis.</a> Nature. 457, 336-339 (2009).</li><li>van Oijen, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+kinetics+of+lambda+exonuclease+reveal+base+dependence+and+dynamic+disorder.">Single-molecule kinetics of lambda exonuclease reveal base dependence and dynamic disorder.</a> Science. 301, 1235-1238 (2003).</li></ol>

Laminer akış boncuklar üzerinde uyguladığı sürtünme kuvveti çoğaltma proteinler enzimatik faaliyetlerin etkisi olmadığından emin olmak için çok önemlidir. Örneğin, 0.012 ml / dk akış oranına karşılık gelen 3 pN gücü önde gelen iplikçik DNA replikasyon etkilemez. Ancak enzimatik faaliyetleri koordine DNA sentezi sırasında yer alan etkilemez ve bu nedenle 1.5 pN azaltılmalıdır. Sürtünme kuvveti kolayca akış hızını veya akış kanalı 5 genişliği değiştirerek kontrol e...

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">	
		
		<div>
		<table border="1">
		<thead>
		<tr>
		<th>Material Name</th>
		<th>Type</th>
		<th>Company</th>
		<th>Catalogue Number</th>
		<th>Comment</th>
		</tr>
		</thead>
		<tbody>
		
<tr>
<td>Bacteriophage &lambda; DNA</td>
<td>&nbsp;</td>
<td>New England Biolabs</td>
<td>N3011L</td>
<td>&nbsp;</td>
<tr>
<td>DNA Oligonucleotides</td>
<td>&nbsp;</td>
<td>Integrated DNA Technologies</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<tr>
<td>T4 DNA Ligase</td>
<td>&nbsp;</td>
<td>New England Biolabs</td>
<td>M0202L</td>
<td>&nbsp;</td>
<tr>
<td>T4 Polynucleotide Kinase</td>
<td>&nbsp;</td>
<td>New England Biolabs</td>
<td>M0201L</td>
<td>&nbsp;</td>
<tr>
<td>&alpha;-digoxigenin Fab</td>
<td>&nbsp;</td>
<td>Roche</td>
<td>11214667001</td>
<td>&nbsp;</td>
<tr>
<td>Tosyl Activated Beads</td>
<td>&nbsp;</td>
<td>Dynal/Invitrogen</td>
<td>142-03</td>
<td>&nbsp;</td>
<tr>
<td>Magnetic Separator</td>
<td>&nbsp;</td>
<td>Invitrogen</td>
<td>Dynal MPC</td>
<td>&nbsp;</td>
<tr>
<td>3-aminopropyl-triethoxysilane</td>
<td>&nbsp;</td>
<td>Sigma</td>
<td>A3648</td>
<td>Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces</td>
</tr>
<tr>
<td>Succinimidyl propionate PEG</td>
<td>&nbsp;</td>
<td>Nektar</td>
<td>&nbsp;</td>
<td>Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.</td>
</tr>
<tr>
<td>Biotin-PEG-NHS</td>
<td>&nbsp;</td>
<td>Nektar</td>
<td>&nbsp;</td>
<td>Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.</td>
</tr>
<tr>
<td>Double-sided tape</td>
<td>&nbsp;</td>
<td>Grace BioLabs</td>
<td>SA-S-1L</td>
<td>100 &mu;m thickness</td>
</tr>
<tr>
<td>Quartz slide</td>
<td>&nbsp;</td>
<td>Technical Glass</td>
<td>20 mm (W)x 50 mm (L)x 1mm (H)</td>
<td>Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net)</td>
</tr>
<tr>
<td>Polyethylene tubing</td>
<td>&nbsp;</td>
<td>Becton Dickinson</td>
<td>427416</td>
<td>0.76 mm ID, 1.22 OD 
Other size tubing can be substituted.</td>
</tr>
<tr>
<td>Streptavidin</td>
<td>&nbsp;</td>
<td>Sigma</td>
<td>S4762</td>
<td>Make 1 mg/mL solution, 25 &mu;L aliquots in PBS pH 7.3</td>
</tr>
<tr>
<td>Deoxyribonucleotide triphosphate solution mix</td>
<td>&nbsp;</td>
<td>New England Biolabs</td>
<td>N0447</td>
<td>&nbsp;</td>
<tr>
<td>Inverted Optical Microscope with 10X Objective</td>
<td>&nbsp;</td>
<td>Olympus</td>
<td>Olympus IX-51</td>
<td>&nbsp;</td>
<tr>
<td>Permament rare-earth magnet</td>
<td>&nbsp;</td>
<td>National Imports</td>
<td>www.rare-earth-magnets.com</td>
<td>&nbsp;</td>
<tr>
<td>CCD Camera</td>
<td>&nbsp;</td>
<td>QImaging</td>
<td>Rolera-XR Fast 139</td>
<td>&nbsp;</td>
<tr>
<td>Syringe Pump</td>
<td>&nbsp;</td>
<td>Harvard Apparatus</td>
<td>11 Plus</td>
<td>Operate in refill mode to facilitate solution changes</td>
</tr>
<tr>
<td>Fiber Illuminator</td>
<td>&nbsp;</td>
<td>Thorlabs Inc.</td>
<td>OSL1</td>
<td>&nbsp;</td>		</tbody>
		</table>
		</div>

direct observation of enzymes replicating dna using a single-molecule dna stretching assay

Biz bireysel DNA molekülleri bakteriyofaj çoğaltma sistemi proteinleri aracılığı ile gerçek zamanlı çoğaltma gözlemlemek için bir yöntem açıklanmaktadır. Lineerleştirilmiş λ DNA bir iplikçik sonunda bir biotin, ve aynı iplikli diğer ucunu bir digoxigenin benzer parçaları değiştirilir. Biotinlenmiş sonuna Fonksiyonlu cam lamel ve küçük bir boncuk digoxigeninated sonuna eklenir. Bir akış hücre yüzeyinde bu DNA boncuk hayvan iplerini montaj, laminer akış, boncuk üzerinde sürükleyin kuvvet uygularlar uygulanmasına olanak veriyor. Sonuç olarak, DNA ve paralel akış hızı (Şekil 1) tarafından belirlenen bir kuvvet lamel yüzeye yakın gerilir. DNA uzunluğu boncuk pozisyonunun izlenmesi ile ölçülür. Tek ve çift iplikli DNA arasındaki uzunluk farklılıkları çatal çoğaltma proteinlerin aktivitesini gerçek zamanlı bilgi elde etmek için kullanılmaktadır. Boncuk pozisyon ölçme gevşemek DNA ve polimerizasyon (Şekil 2) oranları ve processivities hassas belirliyor.

Watch this Scientific Journal Video about Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay at JoVE.com

Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

Biz bireysel DNA molekülleri bakteriyofaj çoğaltma sistemi proteinleri aracılığı ile gerçek zamanlı çoğaltma gözlemlemek için bir yöntem açıklanmaktadır.

Enzimlerin Klonlanması DNA Doğrudan Gözlem Tek bir molekülü DNA Testi Esneme

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. ...

direct-observation-enzymes-replicating-dna-using-single-molecule-dna

Research

JoVE Journal

Biology

18.6K Görüntüleme.  Harvard Medical School. Biz bireysel DNA molekülleri bakteriyofaj çoğaltma sistemi proteinleri aracılığı ile gerçek zamanlı çoğaltma gözlemlemek için bir yöntem açıklanmaktadır.

Video: Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides (Figure 1). The growing product double-strand DNA (dsDNA) is extended with laminar flow and visualized by using an intercalating dye. Measuring the position of the growing DNA end in real time allows precise determination of replication rate (Figure 2). Furthermore, the length of completed DNA products reports on the processivity of replication. This experiment can be performed very easily and rapidly and requires only a fluorescence microscope with a reasonably sensitive camera.


This protocol demonstrates a simple single-molecule fluorescence microscopy technique for visualizing DNA replication by individual replisomes in real time.

Floresan Mikroskop ile görselleştirme Tek molekül DNA replikasyonu

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA ...

Biyoloji

DNA Stable-Isotope Probing (DNA-SIP)

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and nutrients into cellular biomass. As such, this cultivation-independent technique has been an important methodology for assigning metabolic function to the diverse communities inhabiting a wide range of terrestrial and aquatic environments. Following the incubation of an environmental sample with stable-isotope labelled compounds, extracted nucleic acid is subjected to density gradient ultracentrifugation and subsequent gradient fractionation to separate nucleic acids of differing densities. Purification of DNA from cesium chloride retrieves labelled and unlabelled DNA for subsequent molecular characterization (e.g. fingerprinting, microarrays, clone libraries, metagenomics). This JoVE video protocol provides visual step-by-step explanations of the protocol for density gradient ultracentrifugation, gradient fractionation and recovery of labelled DNA. The protocol also includes sample SIP data and highlights important tips and cautions that must be considered to ensure a successful DNA-SIP analysis.

DNA Stable-Isotope Probing DNA-SIP

DNA stable-isotope probing is a cultivation-independent method to identify and characterize active communities of microorganisms that are capable of utilizing specific substrates. Assimilation of substrate enriched in heavy isotope leads to incorporation of labelled atoms into microbial biomass. Density gradient ultracentrifugation retrieves labelled DNA for downstream molecular analyses.

DNA Kararlı-İzotop (DNA-SIP) Probing

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and ...

Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be produced to contain any desired DNA or RNA sequence and can be prepared to include a wide variety of base and sugar modifications. Moreover, oligos can be designed to mimic specific nucleic acid alterations and thus, can serve as important tools to investigate effects of DNA damage and mechanisms of repair. We found that Thermo Scientific Dharmacon RNA-containing oligos with a length between 50 and 80 nucleotides can be particularly suitable to study, in vivo, functions and consequences of chromosomal RNA/DNA hybrids and of ribonucleotides embedded into DNA. RNA/DNA hybrids can readily form during DNA replication, repair and transcription, however, very little is known about the stability of RNA/DNA hybrids in cells and to which extent these hybrids can affect the genetic integrity of cells. RNA-containing oligos, therefore, represent a perfect vector to introduce ribonucleotides into chromosomal DNA and generate RNA/DNA hybrids of chosen length and base composition. Here we present the protocol for the incorporation of ribonucleotides into the genome of the eukaryotic model system yeast /Saccharomyces cerevisiae/. Yet, our lab has utilized Thermo Scientific Dharmacon RNA-containing oligos to generate RNA/DNA hybrids at the chromosomal level in different cell systems, from bacteria to human cells.

This work shows how to form an RNA/DNA hybrid at the chromosomal level and reveal transfer of genetic information from RNA to genomic DNA in yeast cells.

RNA içeren Oligonükleotidler kullanarak Dönüşüm Genomik DNA, RNA / DNA Hibritlerin Üretimi

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be ...

Visualization of DNA Replication in the Vertebrate Model System DT40 using the DNA Fiber Technique

Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not only ensure faithful genome duplication in the face of endogenous and exogenous DNA damage but also prevent genomic instability, a recognized causative factor in tumor development.
Here, we describe a simple and cost-effective fluorescence microscopy-based method to visualize DNA replication in the avian B-cell line DT40. This cell line provides a powerful tool to investigate protein function in vivo by reverse genetics in vertebrate cells1. DNA fiber fluorography in DT40 cells lacking a specific gene allows one to elucidate the function of this gene product in DNA replication and genome stability. Traditional methods to analyze replication fork dynamics in vertebrate cells rely on measuring the overall rate of DNA synthesis in a population of pulse-labeled cells. This is a quantitative approach and does not allow for qualitative analysis of parameters that influence DNA synthesis. In contrast, the rate of movement of active forks can be followed directly when using the DNA fiber technique2-4. In this approach, nascent DNA is labeled in vivo by incorporation of halogenated nucleotides (Fig 1A). Subsequently, individual fibers are stretched onto a microscope slide, and the labeled DNA replication tracts are stained with specific antibodies and visualized by fluorescence microscopy (Fig 1B). Initiation of replication as well as fork directionality is determined by the consecutive use of two differently modified analogues. Furthermore, the dual-labeling approach allows for quantitative analysis of parameters that influence DNA synthesis during the S-phase, i.e. replication structures such as ongoing and stalled forks, replication origin density as well as fork terminations. Finally, the experimental procedure can be accomplished within a day, and requires only general laboratory equipment and a fluorescence microscope.

DT40, a model vertebrate genetic system, provides a powerful tool to analyze protein function. Here we describe a simple method that allows qualitative analysis of parameters that influence DNA synthesis during the S-phase in DT40 cells at the single molecule level.

DNA replikasyonu Görselleştirme Omurgalı Model Sistemi DT40 DNA Fiber Tekniği

Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not ...

Preparation of DNA-crosslinked Polyacrylamide Hydrogels

Mechanobiology is an emerging scientific area that addresses the critical role of physical cues in directing cell morphology and function. For example, the effect of tissue elasticity on cell function is a major area of mechanobiology research because tissue stiffness modulates with disease, development, and injury. Static tissue-mimicking materials, or materials that cannot alter stiffness once cells are plated, are predominately used to investigate the effects of tissue stiffness on cell functions. While information gathered from static studies is valuable, these studies are not indicative of the dynamic nature of the cellular microenvironment in vivo. To better address the effects of dynamic stiffness on cell function, we developed a DNA-crosslinked polyacrylamide hydrogel system (DNA gels). Unlike other dynamic substrates, DNA gels have the ability to decrease or increase in stiffness after fabrication without stimuli. DNA gels consist of DNA crosslinks that are polymerized into a polyacrylamide backbone. Adding and removing crosslinks via delivery of single-stranded DNA allows temporal, spatial, and reversible control of gel elasticity. We have shown in previous reports that dynamic modulation of DNA gel elasticity influences fibroblast and neuron behavior. In this report and video, we provide a schematic that describes the DNA gel crosslinking mechanisms and step-by-step instructions on the preparation DNA gels.

Our laboratory has developed DNA-crosslinked polyacrylamide hydrogels, a dynamic hydrogel system, to better understand the effects of modulating tissue stiffness on cell function. Here, we provide schematics, descriptions, and protocols to prepare these hydrogels.

DNA çapraz bağlı poliakrilamid hidrojellerinin hazırlanışı

Mechanobiology is an emerging scientific area that addresses the critical role of physical cues in directing cell morphology and function. For example, ...

Combining Single-molecule Manipulation and Imaging for the Study of Protein-DNA Interactions

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method offers the opportunity of investigating interactions occurring in solution (thus avoiding problems due to closeby surfaces as in other single molecule methods), controlling the DNA extension and tracking interaction dynamics as a function of both mechanical parameters and DNA sequence. The methods for establishing successful optical trapping and nanometer localization of single molecules are illustrated. We illustrate the experimental conditions allowing the study of interaction of lactose repressor (lacI), labeled with Atto532, with a DNA molecule containing specific target sequences (operators) for LacI binding. The method allows the observation of specific interactions at the operators, as well as one-dimensional diffusion of the protein during the process of target search. The method is broadly applicable to the study of protein-DNA interactions but also to molecular motors, where control of the tension applied to the partner track polymer (for example actin or microtubules) is desirable.

Here we describe the instrumentation and methods for detecting single fluorescently-labeled protein molecules interacting with a single DNA molecule suspended between two optically trapped microspheres.

Protein-DNA Etkileşiminin Çalışmaları Tek molekül Manipülasyon ve Görüntüleme birleştiren

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method ...

Real-time Imaging of Single Engineered RNA Transcripts in Living Cells Using Ratiometric Bimolecular Beacons

The growing realization that both the temporal and spatial regulation of gene expression can have important consequences on cell function has led to the development of diverse techniques to visualize individual RNA transcripts in single living cells. One promising technique that has recently been described utilizes an oligonucleotide-based optical probe, ratiometric bimolecular beacon (RBMB), to detect RNA transcripts that were engineered to contain at least four tandem repeats of the RBMB target sequence in the 3&#8217;-untranslated region. RBMBs are specifically designed to emit a bright fluorescent signal upon hybridization to complementary RNA, but otherwise remain quenched. The use of a synthetic probe in this approach allows photostable, red-shifted, and highly emissive organic dyes to be used for imaging. Binding of multiple RBMBs to the engineered RNA transcripts results in discrete fluorescence spots when viewed under a wide-field fluorescent microscope. Consequently, the movement of individual RNA transcripts can be readily visualized in real-time by taking a time series of fluorescent images. Here we describe the preparation and purification of RBMBs, delivery into cells by microporation and live-cell imaging of single RNA transcripts.

Ratiometric bimolecular beacons (RBMBs) can be used to image single engineered RNA transcripts in living cells. Here, we describe the preparation and purification of RBMBs, delivery of RBMBs into cells by microporation and fluorescent imaging of single RNA transcripts in real-time.

Oranlı metrik Bimoleküler Fenerleri kullanma Yaşam Hücrelerde Tek Engineered RNA Transkriptlerinin Gerçek zamanlı Görüntüleme

The growing realization that both the temporal and spatial regulation of gene expression can have important consequences on cell function has led to the ...

Studying DNA Looping by Single-Molecule FRET

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

This study presents a detailed experimental procedure to measure looping dynamics of double-stranded DNA using single-molecule Fluorescence Resonance Energy Transfer (FRET). The protocol also describes how to extract the looping probability density called the J factor.

Tek Molekül FRET DNA döngü oluşturma incelenmesi

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into ...

Reduced-gravity Environment Hardware Demonstrations of a Prototype Miniaturized Flow Cytometer and Companion Microfluidic Mixing Technology

Until recently, astronaut blood samples were collected in-flight, transported to earth on the Space Shuttle, and analyzed in terrestrial laboratories. If humans are to travel beyond low Earth orbit, a transition towards space-ready, point-of-care (POC) testing is required. Such testing needs to be comprehensive, easy to perform in a reduced-gravity environment, and unaffected by the stresses of launch and spaceflight. Countless POC devices have been developed to mimic laboratory scale counterparts, but most have narrow applications and few have demonstrable use in an in-flight, reduced-gravity environment. In fact, demonstrations of biomedical diagnostics in reduced gravity are limited altogether, making component choice and certain logistical challenges difficult to approach when seeking to test new technology. To help fill the void, we are presenting a modular method for the construction and operation of a prototype blood diagnostic device and its associated parabolic flight test rig that meet the standards for flight-testing onboard a parabolic flight, reduced-gravity aircraft. The method first focuses on rig assembly for in-flight, reduced-gravity testing of a flow cytometer and a companion microfluidic mixing chip. Components are adaptable to other designs and some custom components, such as a microvolume sample loader and the micromixer may be of particular interest. The method then shifts focus to flight preparation, by offering guidelines and suggestions to prepare for a successful flight test with regard to user training, development of a standard operating procedure (SOP), and other issues. Finally, in-flight experimental procedures specific to our demonstrations are described.

Spaceflight blood diagnostics need innovation. Few demonstrations have been published illustrating in-flight, reduced-gravity health diagnostic technology. Here we present a method for construction and operation of a parabolic flight test rig for a prototype point-of-care flow-cytometry design, with components and preparation strategies adaptable to other setups.

Prototip Minyatür Akış Sitometresi ve Companion mikroakışkan Karıştırma Teknoloji İndirimli-gravite Çevre Donanım Gösterileri

Until recently, astronaut blood samples were collected in-flight, transported to earth on the Space Shuttle, and analyzed in terrestrial laboratories. If ...

A Proteoliposome-Based Efflux Assay to Determine Single-molecule Properties of Cl- Channels and Transporters

The last 15 years have been characterized by an explosion in the ability to overexpress and purify membrane proteins from prokaryotic organisms as well as from eukaryotes. This increase has been largely driven by the successful push to obtain structural information on membrane proteins. However, the ability to functionally interrogate these proteins has not advanced at the same rate and is often limited to qualitative assays of limited quantitative value, thereby limiting the mechanistic insights that they can provide. An assay to quantitatively investigate the transport activity of reconstituted Cl- channels or transporters is described. The assay is based on the measure of the efflux rate of Cl- from proteoliposomes following the addition of the K+ ionophore valinomycin to shunt the membrane potential. An ion sensitive electrode is used to follow the time-course of ion efflux from proteoliposomes reconstituted with the desired protein. The method is highly suited for mechanistic studies, as it allows for the quantitative determination of key properties of the reconstituted protein, such as its unitary transport rate, the fraction of active protein and the molecular mass of the functional unit. The assay can also be utilized to determine the effect of small molecule compounds that directly inhibit/activate the reconstituted protein, as well as to test the modulatory effects of the membrane composition or lipid-modifying reagents. Where possible, direct comparison between results obtained using this method were found to be in good agreement with those obtained using electrophysiological approaches. The technique is illustrated using CLC-ec1, a CLC-type H+/Cl- exchanger, as a model system. The efflux assay can be utilized to study any Cl- conducting channel/transporter and, with minimal changes, can be adapted to study any ion-transporting protein.

A Proteoliposome-Based Efflux Assay to Determine Single-molecule Properties of Cl- Channels and Transporters

Proteoliposomes are used to study purified channels and transporters reconstituted in a well-defined biochemical environment. An experimental procedure to measure efflux mediated by these proteins is illustrated. The steps to prepare proteoliposomes, perform the recordings, and analyze data to quantitatively determine the functional properties of the reconstituted protein are described.

Bir Proteoliposome Tabanlı effluks Deney Cl Tek-molekül Properties belirleme<sup&gt; -</sup&gt; Kanallar ve Nakliyeciler

The last 15 years have been characterized by an explosion in the ability to overexpress and purify membrane proteins from prokaryotic organisms as well as ...