eoe sub articles

EoE Sub Articles

1. Preparation of porcine aminopeptidase N (APN) protein antigen
NOTE: The pET28a (+)-APN-BL21 (DE3) strain and the APN stably expressed cells pEGFP-C1-APN-IPEC-J2 were constructed in a previous study.
<ol>
	<li>Recover bacteria from a frozen glycerol stock and streak onto Luria-Bertani (LB) plates containing 50 &#181;g/mL kanamycin (Km+) for single colony isolation.</li>
	<li>Select a single colony from the freshly streaked plate, culture in 4 mL of LB medium (10 g/L tryptone, 10 g/L sodium chloride (NaCl) and 5 g/L yeast extract, pH 7.2) supplemented with Km+&#160;(50 &#181;g/mL), and leave to grow overnight (12-16 h) with agitation (178 rpm) at 37 &#176;C.</li>
	<li>Dilute the prepared bacteria at 1:100 in fresh Km+&#160;LB broth and incubate at 37 &#176;C with shaking for 2-3 h until the OD600&#160;reaches 0.4-0.6.</li>
	<li>Add isopropyl &#946;-d-1-thiogalactopyranoside (IPTG) to the medium to a final concentration of 0.4 mM, and incubate the cultures for an additional 10 h at 16 &#176;C.</li>
	<li>Consequently, centrifuge and harvest the bacteria using IPTG induction (10,000 &#215; g, 4 &#176;C 15 min).</li>
	<li>Resuspend the cell pellet using 5 mL of LEW (Lysis/Equilibration/Wash) buffer (50 mM anhydrous sodium phosphate monobasic (NaH2PO4) and 300 mM NaCl, pH 8.0) containing 1 mg/mL lysozyme. Stir the bacterial suspension for 30 min on ice and sonicate completely (15 s pulse and 20 s off, 15 min) using an ultrasonic homogenizer.</li>
	<li>Centrifuge the crude cell lysate at 4 &#176;C and 10,000 &#215; g for 30 min to remove cellular debris. Transfer supernatant into a pre-equilibrated column and incubate 1-2 min before gravity drainage. Repeat this step three times.</li>
	<li>Wash the column using 20 mL of LEW buffer and drain using gravity. Elute the histidine-tagged APN protein using 9 mL of elution buffer (50 mM NaH2PO4, 300 mM NaCl and 250 mM imidazole, pH 8.0) and collect into dialysis tubing.</li>
	<li>Dialyze the protein solution overnight at 4 &#176;C in sodium carbonate-sodium bicarbonate (phosphate-buffered saline (PBS), 135 mM NaCl, 4.7 mM potassium chloride, 2 mM NaH2PO4, and 10 mM dodecahydrate sodium phosphate dibasic, pH 7.2) buffer.</li>
	<li>Analyze using a 12.0% SDS-PAGE gel and western blotting to assess the purity of the APN protein.
	<ol>
		<li>Load 5 &#181;g of protein into each well of the gel and allow to run at 110 V for 1.5 h. Then, transfer protein onto a polyvinylidene fluoride (PVDF) membrane for 50 min at 15 V. Determine the concentration of the purified protein using a bicinchoninic acid (BCA) assay.</li>
	</ol>
	</li>
</ol>
2. Animal immunization
<ol>
	<li>Subcutaneous (s.c) inject female BALB/c mice, 6-8 weeks of age, with 50 &#181;g of APN protein or PBS (negative control) mixed with adjuvants once every 2 weeks. Use complete Freund&#39;s adjuvant that contains the heat-killed Mycobacteria for initial immunization, and incomplete Freund&#39;s adjuvant for booster immunizations. Mix equal volumes of APN protein (or PBS) and Freund&#39;s adjuvant or incomplete Freund&#39;s adjuvant, respectively.</li>
	<li>Detect antibody titers against APN in the sera of these mice by indirect enzyme-linked immunosorbent assay (ELISA) using a microtiter plate coated with 5 &#181;g/mL APN protein diluted in 0.05 M PBS (pH 9.6).</li>
</ol>
3. Hybridoma technology to produce monoclonal antibodies against APN
<ol>
	<li>Intraperitoneally (i.p.) inject 100 &#181;g of APN protein into the selected mice for a final antigen boost.</li>
	<li>Three days later, euthanize the mice using pentobarbital sodium (50 mg/kg, v/v, intraperitoneal) and cervical dislocation.</li>
	<li>Collect spleens, and wash with Dulbecco&#39;s Modified Eagle Medium (DMEM) twice to remove blood and fat cells. Filter the spleen-cell suspension using a 200-mesh copper grid to remove tissue debris, and harvest spleen cells using centrifugation (1500 &#215; g, 10 min) to remove the membrane of the spleen.</li>
	<li>Seed mouse myeloma SP2/0 cells in a 25 cm2&#160;flask containing 5 mL of DMEM supplemented with 6% fetal bovine serum (FBS) and culture at 37 &#176;C, 6% carbon dioxide (CO2)&#160;atmosphere to maintain cell viability. After 5-6 days of culture, the cells reach 80%-90% confluence post-resuscitation and are in growth log phase. Under the microscope, the cells are round, bright, and clear.</li>
	<li>One day before hybridization, collect macrophages from peritoneal cavities of the mice according to a previously published method.</li>
	<li>Seed peritoneal macrophages at a density of 0.1-0.2 &#215; 105/mL in 96-well plates, each well containing 100 &#181;L of hypoxanthine-aminopterin-thymidine (HAT) medium (DMEM supplemented with 10% FBS and 1x HAT Supplement), and incubate at 37 &#176;C, 6 % CO2&#160;humidified atmosphere overnight.</li>
	<li>For hybridization, gently aspirate SP2/0 cells with a pipette from 8-10 bottles and suspend in 10 mL of serum-free DMEM medium. Wash cells with fresh DMEM, centrifuge (1500 &#215; g, 10 min) twice, and then re-suspend in 10 mL of DMEM.</li>
	<li>Mix the quantified spleen cells with SP2/0 cells at a ratio of 10:1 and transfer into 50 mL tubes. Centrifuge (1500 &#215; g, 10 min) and discard the supernatant. Collect the cell pellets at the bottom of the tubes and tap with palm to loosen the pellets prior to hybridization.</li>
	<li>Add 1 mL of polyethylene glycol 1500 (PEG 1500), pre-warmed to 37 &#176;C, dropwise using a dropper to the loosened cell pellet over the time period of 45 s while gently rotating the bottom of the tube.</li>
	<li>Slowly add 1 mL of DMEM pre-warmed to 37 &#176;C to the above mixture over the period of 90 s, followed by another 30 mL of fresh DMEM. Place the fusion tube into a 37 &#176;C water bath for 30 min.</li>
	<li>After incubation in the warm bath, harvest the cells and re-suspend in HAT medium. Then culture in a 96-well plate inoculated with peritoneal macrophages.</li>
	<li>Five days later, add 100 &#181;L of fresh HAT medium to each well, and incubate the plate for an additional 5 days, after which replace the medium with HT medium (DMEM supplemented with 10% FBS and 1x HT Supplement).</li>
	<li>Use a microtiter plate coated with 5 &#181;g/mL APN protein diluted in 0.05 M PBS (pH 9.6) to analyze monoclonal antibodies in the hybridoma supernatant using ELISA assay.
	<ol>
		<li>When the medium in the wells of the 96-well plate turns yellow (due to cell growth and metabolite release, pH in the medium decreases to 6.8, and phenol red turns from fuchsia to yellow) or cell clusters are observed, acquire 100 &#181;L supernatant from the selected wells and add to the wells of the coated ELISA plate. Use a microplate reader to measure the optical density 450 (OD450) values.</li>
		<li>Use the polyclonal antibodies against APN and non-infected mouse serum as positive and negative control, respectively, and use PBS as blank control. In this study, OD450 ratio of sample to negative control (P/N) &#8805; 2.1 was recognized as positive selection standard.</li>
	</ol>
	</li>
	<li>After three consecutive positive selection rounds, select the hybridoma showing increased serology response against the APN protein for a limited dilution assay.
	<ol>
		<li>Prepare peritoneal macrophages and seed in 96-well plates as described previously.</li>
		<li>Suspend hybridoma cells in HT medium at an average of 0.5-2 cells per well and culture in a 37 &#176;C, 6% CO2&#160;incubator. Repeat this step three or four times until the positive rate indicated by ELISA immunoassay reaches 100%.</li>
	</ol>
	</li>
	<li>Under the pressure of continuous freezing and thawing, select the positive hybridoma cells able to stably secrete anti-APN antibodies and proliferate normally.
	<ol>
		<li>Administer a single i.p. injection of 0.3 mL of pristane to each mouse (8-10 weeks). At 10 days after receiving pristine, inject each mouse with 2-5 x 105&#160;hybridoma cells in 0.5 mL of PBS (pH 7.2).</li>
		<li>Carefully collect peritoneal fluid from the peritoneal cavity of these mice 8 to 10 days after the injection.</li>
		<li>Harvest the supernatants by centrifugation at 5,000 &#215; g for 15 min and purify antibodies in the supernatants using 33% saturated ammonium sulfate [(NH4)2SO4] precipitation and protein A agarose.</li>
	</ol>
	</li>
</ol>
4. Characterization of monoclonal antibodies (mAbs) against APN protein
<ol>
	<li>Determine the immunoglobulin subtype of the collected mAbs using an SBA Clonotyping System-HRP. Use SDS-PAGE and western blotting to assess mAb purity and specificity.</li>
	<li>Analyze mAb epitope specificity against the APN protein using ELISA.&#160;Additivity value (AV) is the ratio of ODmAbs (a+b)&#160;to (ODmAbs-a+ODmAbs-b), which is used to evaluate whether mAbs recognize the same antigenic site; ODmAbs-a&#160;and ODmAbs-b&#160;represent the OD450 values of different monoclonal antibodies against APN alone, and ODmAbs (a+b)&#160;represent the OD450 values of a 1:1 mixture of two mAbs against APN.
	<ol>
		<li>Assess each sample at least four replicates and repeat the whole experiment at least three times.</li>
	</ol>
	</li>
</ol>
5. Expression of rAbs against APN
<ol>
	<li>Extract total RNA from the above-mentioned hybridoma cells and spleens of APN-immunized mice (e.g., TRIzol). Synthesize complementary DNA (cDNA) using a cDNA synthesis kit per manufacturer&#39;s instructions.</li>
	<li>Amplify variable regions of mAbs using nested polymerase chain reaction (PCR) and determine heavy chain (VH) and light chain (VL) sequences using sequencing. Analyze the genes encoding VH and VL using the IMGT mouse genome analysis tool (http://www.imgt.org/about/immunoinformatics.php).</li>
	<li>Combine the VH and VL genes with leader sequences and sequentially subclone them into the pET28a (+) and pIRES2-ZsGreen1 vectors, respectively, using seamless cloning technology to allow for scarless DNA fragment insertion. The specific primers are listed in&#160;Table 1.</li>
	<li>Grow the pET28a (+)-rAbs-APN-BL21-transformed bacteria in the presence of 0.4 mM IPTG in orbital shakers at 37 &#176;C for 10 h. Then induce, purify, and assess for the expression of the rAbs protein using routine protein purification.</li>
	<li>Seed 100 &#181;L 0.5 x 105&#160;CHO cells per well into a 96-well plate and incubate at 37 &#176;C in a 6% CO2&#160;atmosphere for 18-24 h. When the cells reach 80-90% confluence, dilute the pIRES2-ZsGreen1-rAbs-APN plasmid with Opti-MEM to a final concentration of 0.1 &#181;g/&#181;L, and incubate 5 min at room temperature before using for transfection.</li>
	<li>Gently mix 50 &#181;L of diluted pIRES2-ZsGreen1-rAbs-APN plasmid with 1 &#181;L of Lipofectamine&#160;2000 and 49 &#181;L of Opti-MEM and incubate the mixture for an additional 20 min at room temperature. Add 100 &#181;L of mixture to each well of a 96-well plate containing CHO cells and incubate at 37 &#176;C in 6% CO2&#160;atmosphere for 4-6 h.</li>
	<li>At 4-6 h post-transfection, replace the medium with DMEM-F12 medium supplemented with 10% FBS, and incubate the plate for another 48 h. Then, add 400 &#181;g/mL G418 to each well to select the stably transfected cells.</li>
	<li>After 10 days of selection using DMEM-F12 medium supplemented with 10% FBS and 400 &#181;g/mL G418, sort the cells (3.0 &#215; 107&#160;cells/mL) by fluorescence-activated cell sorting. Approximately 10-15% of the cell population were positive.</li>
	<li>Serially dilute harvested positive cells, seed at an average of 0.5-2 cells per well in a 96-well plate, and culture in a 37 &#176;C, 6% CO2&#160;incubator. Maintain the stably transfected pIRES2-ZsGreen1-rAbs-APN-CHO cells using selection with G418 (200 &#181;g/mL).</li>
	<li>FBS concentration in the above-described cell-culture medium decreases gradually from 10% to 0% during the logarithmic growth phase over the time period of 3 weeks. Then, adapt the adherent CHO cells to suspension growth in a serum-free medium.</li>
	<li>Culture the seeded pIRES2-ZsGreen1-rAbs-APN-CHO cells in the logarithmic growth phase in serum-free medium at a density of 0.8-1.0 &#215; 105&#160;cells/mL in shake flasks at 80-110 rpm shaking speed and 37&#176;C, 6% CO2.</li>
	<li>Collect the cell suspension every 12 h to determine changes in cell viability and vitality using a cell counting kit (e.g., CCK-8) per manufacturer&#39;s instructions.</li>
	<li>Antibody expression reaches peak levels when cell viability decreased to 80% and cell density reaches 1.0-2.0 &#215; 106&#160;cells/mL. Harvest cell supernatants using centrifugation, filter using a 0.22 &#181;m polytetrafluoroethylene membrane filter, and purify using protein A agarose.</li>
	<li>Confirm production of APN-specific antibodies using indirect immunofluorescence assays (IFA).</li>
	<li>Determine antibody titers and binding affinities using ELISA assay as described previously.&#160;Calculate the equilibrium dissociation constant (KD&#160;value) of the antibodies with a four-parameter logistic equation using software.</li>
</ol>
Table 1. The specific primers used in this study.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer</td>
			<td>Sequence (5&#39;-3&#39;)</td>
		</tr>
		<tr>
			<td>VH-VL-F</td>
			<td>CCGGGTGGGCCGGATAGACMGATGGGGCTG</td>
		</tr>
		<tr>
			<td>VH-VL-R</td>
			<td>CCGGCCACATAGGCCCCACTTGACATTGATGT</td>
		</tr>
		<tr>
			<td>pET28a (+)-F</td>
			<td>TCCACCAGTCATGCTAGCCATAACAACGGTCGTGATTCGA</td>
		</tr>
		<tr>
			<td>pET28a (+)-R</td>
			<td>CTGGTGCCGCGCGGCAGCCAGTGGGATACCCGTATTACCC</td>
		</tr>
		<tr>
			<td>pIRES2-ZsGreen1-F</td>
			<td>CGACGGTACCGCGGGCCCGGTAACAACGGTCGTGATTCGA</td>
		</tr>
		<tr>
			<td>pIRES2-ZsGreen1-R</td>
			<td>GGGGGGGAGGGAGAGGGGCGGTGGGATACCCGTATTACCC</td>
		</tr>
	</tbody>
</table>

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Complete Freund&#39;s adjuvant</td>
			<td>Sigma-Aldrich</td>
			<td>F5881</td>
			<td>Animal immunization</td>
		</tr>
		<tr>
			<td>DAPI</td>
			<td>Beyotime&#160; Biotechnology</td>
			<td>C1002</td>
			<td>Nuclear counterstain</td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Gibco</td>
			<td>11965092</td>
			<td>Cell culture</td>
		</tr>
		<tr>
			<td>DMEM-F12</td>
			<td>Gibco</td>
			<td>12634010</td>
			<td>Cell culture</td>
		</tr>
		<tr>
			<td>Dylight 549-conjugated goat anti-mouse IgG secondary antibody</td>
			<td>Abbkine</td>
			<td>A23310</td>
			<td>Indirect immunofluorescence analysis</td>
		</tr>
		<tr>
			<td>Enhanced Cell Counting Kit-8</td>
			<td>Beyotime&#160; Biotechnology</td>
			<td>C0042</td>
			<td>Measurement&#160;of&#160;cell&#160;viability and vitality</td>
		</tr>
		<tr>
			<td>Fetal bovine serum</td>
			<td>Gibco</td>
			<td>10091</td>
			<td>Cell culture</td>
		</tr>
		<tr>
			<td>Geneticin&#8482; Selective Antibiotic</td>
			<td>Gibco</td>
			<td>11811098</td>
			<td>Selective antibiotic</td>
		</tr>
		<tr>
			<td>HAT Supplement (50X)</td>
			<td>Gibco</td>
			<td>21060017</td>
			<td>Cell selection</td>
		</tr>
		<tr>
			<td>HT Supplement (100X)</td>
			<td>Gibco</td>
			<td>11067030</td>
			<td>Cell selection</td>
		</tr>
		<tr>
			<td>Incomplete Freund&#39;s adjuvant</td>
			<td>Sigma-Aldrich</td>
			<td>F5506</td>
			<td>Animal immunization</td>
		</tr>
		<tr>
			<td>Isopropyl &#946;-d-1-thiogalactopyranoside</td>
			<td>Sigma-Aldrich</td>
			<td>I5502</td>
			<td>Protein expression</td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>Beyotime&#160; Biotechnology</td>
			<td>ST102</td>
			<td>Bactericidal antibiotic</td>
		</tr>
		<tr>
			<td>Leica TCS SP8 STED confocal microscope</td>
			<td>Leica Microsystems</td>
			<td>&#160;SP8 STED</td>
			<td>Fluorescence imaging</td>
		</tr>
		<tr>
			<td>Lipofectamine&#174; 2000 Reagent</td>
			<td>Thermofisher</td>
			<td>11668019</td>
			<td>Transfection</td>
		</tr>
		<tr>
			<td>LSRFortessa&#8482; fluorescence-activated cell sorting</td>
			<td>BD</td>
			<td>FACS LSRFortessa</td>
			<td>Flow cytometry</td>
		</tr>
		<tr>
			<td>Microplate reader</td>
			<td>BioTek</td>
			<td>BOX 998</td>
			<td>ELISA analysis</td>
		</tr>
		<tr>
			<td>Micro spectrophotometer</td>
			<td>Thermo Fisher</td>
			<td>Nano Drop one</td>
			<td>Nucleic acid concentration detection</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Sinopharm Chemical Reagent</td>
			<td>10019308</td>
			<td>Culture broth</td>
		</tr>
		<tr>
			<td>(NH4)2SO4</td>
			<td>Sinopharm Chemical Reagent</td>
			<td>10002917</td>
			<td>Culture broth</td>
		</tr>
		<tr>
			<td>Opti-MEM</td>
			<td>Gibco</td>
			<td>31985088</td>
			<td>Cell culture</td>
		</tr>
		<tr>
			<td>Polyethylene glycol 1500</td>
			<td>Roche Diagnostics</td>
			<td>10783641001</td>
			<td>Cell fusion</td>
		</tr>
		<tr>
			<td>PrimeScript&#8482; 1st strand cDNA Synthesis Kit</td>
			<td>Takara Bio</td>
			<td>RR047</td>
			<td>qPCR</td>
		</tr>
		<tr>
			<td>Protein A agarose</td>
			<td>Beyotime&#160; Biotechnology</td>
			<td>P2006</td>
			<td>Antibody protein purification</td>
		</tr>
		<tr>
			<td>Protino&#174; Ni+-TED 2000 Packed Columns</td>
			<td>MACHEREY-NAGEL</td>
			<td>745120.5</td>
			<td>Protein purification</td>
		</tr>
		<tr>
			<td>SBA Clonotyping System-HRP</td>
			<td>Southern Biotech</td>
			<td>May-00</td>
			<td>Isotyping of mouse monoclonal antibodies</td>
		</tr>
		<tr>
			<td>Seamless Cloning Kit</td>
			<td>Beyotime&#160; Biotechnology</td>
			<td>D7010S</td>
			<td>Construction of plasmids</td>
		</tr>
		<tr>
			<td>Shake flasks</td>
			<td>Beyotime&#160; Biotechnology</td>
			<td>E3285</td>
			<td>Cell culture</td>
		</tr>
		<tr>
			<td>Sodium carbonate-sodium bicarbonate buffer</td>
			<td>Beyotime&#160; Biotechnology</td>
			<td>C0221A</td>
			<td>Cell culture</td>
		</tr>
		<tr>
			<td>Trans-Blot SD Semi-Dry Transfer Cell</td>
			<td>Bio-rad</td>
			<td>&#160;170-3940</td>
			<td>Western blot</td>
		</tr>
		<tr>
			<td>Tryptone</td>
			<td>Oxoid</td>
			<td>LP0042</td>
			<td>Culture broth</td>
		</tr>
		<tr>
			<td>Ultrasonic Homogenizer</td>
			<td>Ningbo Xinzhi Biotechnology</td>
			<td>JY92-IIN</td>
			<td>Sample homogenization</td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>Oxoid</td>
			<td>LP0021</td>
			<td>Culture broth</td>
		</tr>
		<tr>
			<td>96-well microplate</td>
			<td>Corning</td>
			<td>3599</td>
			<td>Cell culture</td>
		</tr>
	</tbody>
</table>

a method to produce recombinant antibodies against metallopeptidase

Source: Xia, P. et al., <a href="https://app.jove.com/v/62437">Production of Monoclonal Antibodies Targeting Aminopeptidase N in the Porcine Intestinal Mucosal Epithelium.</a>&#160;J. Vis. Exp.&#160;(2021)
This video demonstrates a procedure for the production of recombinant antibodies against metallopeptidase. Recombinant plasmids carrying genes for the antibody, green fluorescent protein, and antibiotic resistance are transfected into epithelial cells with lipofectamine. The transfected cells are selected and cultivated to generate recombinant antibodies.

A Method to Produce Recombinant Antibodies Against Metallopeptidase

1. Preparation of porcine aminopeptidase N (APN) protein antigen
NOTE: The pET28a (+)-APN-BL21 (DE3) strain and the APN stably expressed cells ...

Begin with a tube containing a cationic lipid-based transfection agent and add recombinant expression plasmids.
The plasmid carries a gene encoding metallopeptidase-targeting recombinant antibodies and green fluorescent protein or GFP under one promoter, while the antibiotic resistance gene is under another promoter.
Positively charged lipids interact with a negatively charged plasmid, forming a complex.
Transfer the complexes into a multi-well plate containing mammalian cells, enabling the plasmid to enter the cytoplasm.
The plasmid reaches the nucleus and gets transcribed into mRNAs for antibiotic resistance proteins and bicistronic mRNAs encoding recombinant antibodies and GFPs.
These mRNAs lead to the production of recombinant antibodies, GFPs, and antibiotic resistance proteins.
Post-transfection, replace the medium with a serum-enriched medium.
Introduce an antibiotic, selectively eliminating non-transfected cells while the antibiotic-resistant transfected cells survive.
Using the fluorescence-activated cell-sorting technique, collect the green fluorescent cells expressing recombinant antibodies.
Seed the diluted transfected cells in a serum-free medium and incubate to produce recombinant antibodies against metallopeptidase.

a-method-to-produce-recombinant-antibodies-against-metallopeptidase

Research

JoVE Encyclopedia of Experiments

Immunology

Antibody-Based Technologies

Production and Purification

77 Görüntüleme. Kaynak: Xia, P. ve ark., Domuz Bağırsak Mukozal Epitelinde Aminopeptidaz N'yi Hedefleyen Monoklonal Antikorların Üretimi.J. Vis. Uzm.(2021) Bu video, metallopeptidaza karşı rekombinant antikorların üretimi için bir prosedürü göstermektedir. Antikor, yeşil floresan proteini ve antibiyotik direnci genlerini taşıyan rekombinant plazmitler, lipofektamin ile epitel hücrelerine transfekte edilir. Transfekte edilen hücreler, rekombinant antikorlar oluşturmak için seçilir ve yetişt...

Video: Metallopeptidaza Karşı Rekombinant Antikorlar Üretmek İçin Bir Yöntem - Kavram

Purification and Analytics of a Monoclonal Antibody from Chinese Hamster Ovary Cells Using an Automated Microbioreactor System

Monoclonal antibodies (mAbs) are one of the most popular and well-characterized biological products manufactured today. Most commonly produced using Chinese hamster ovary (CHO) cells, culture and process conditions must be optimized to maximize antibody titers and achieve target quality profiles. Typically, this optimization uses automated microscale bioreactors (15 mL) to screen multiple process conditions in parallel. Optimization criteria include culture performance and the critical quality attributes (CQAs) of the monoclonal antibody (mAb) product, which may impact its efficacy and safety. Culture performance metrics include cell growth and nutrient consumption, while the CQAs include the mAb's N-glycosylation and aggregation profiles, charge variants, and molecular weight. This detailed protocol describes how to purify and subsequently analyze HCCF samples produced by an automated microbioreactor system to gain valuable performance metrics and outputs. First, an automated protein A fast protein liquid chromatography (FPLC) method is used to purify the mAb from harvested cell culture samples. Once concentrated, the glycan profiles are analyzed by mass spectrometry using a specific platform (refer to the Table of Materials). Antibody molecular weights and aggregation profiles are determined using size exclusion chromatography-multiple angle light scattering (SEC-MALS), while charge variants are analyzed using microchip capillary zone electrophoresis (mCZE). In addition to the culture performance metrics captured during the bioreactor process (i.e., culture viability, cell counts, and common metabolites including glutamine, glucose, lactate, and ammonia), spent media is analyzed to identify limiting nutrients to improve the feeding strategies and overall process design. Therefore, a detailed protocol for the absolute quantification of amino acids by liquid chromatography-mass spectrometry (LC-MS) of spent media is also described. The methods used in this protocol take advantage of high-throughput platforms that are compatible for large numbers of small-volume samples.

A detailed protocol for the purification and subsequent analysis of a monoclonal antibody from harvested cell culture fluid (HCCF) of automated microbioreactors has been described. Use of analytics to determine critical quality attributes (CQAs) and maximizing limited sample volume to extract vital information is also presented.

Otomatik bir Mikrobioreactor sistemi kullanılarak Çin hamster yumurtlama hücrelerinden bir monoklonal antikor arıtma ve analitik

Monoclonal antibodies (mAbs) are one of the most popular and well-characterized biological products manufactured today. Most commonly produced using ...

JoVE Journal

Biyomühendislik

Single-cell Screening Method for the Selection and Recovery of Antibodies with Desired Specificities from Enriched Human Memory B Cell Populations

The human antibody repertoire represents a largely untapped source of potential therapeutic antibodies and useful biomarkers. While current computational methods, such as next generation sequencing (NGS), yield enormous sets of data on the antibody repertoire at the sequence level, functional data is required to identify which sequences are relevant for a particular antigen or set of antigens. Here, we describe a method to identify and recover individual antigen-specific antibodies from peripheral blood mononuclear cells (PBMCs) from a human blood donor. This method utilizes an initial enrichment of mature B cells and requires a combination of phenotypic cell markers and fluorescently-labeled protein to isolate IgG memory B cells via flow cytometry. The heavy and light chain variable regions are then cloned and re-screened. Although limited to the memory B cell compartment, this method takes advantage of flow cytometry to interrogate millions of B cells and returns paired heavy and light chain sequences from a single cell in a format ready for expression and confirmation of specificity. Antibodies recovered with this method can be considered for therapeutic potential, but can also link specificity and function with bioinformatic approaches to assess the B cell repertoire within individuals.

The BSelex method to identify and recover individual antigen-specific antibodies from human peripheral blood mononuclear cells combines flow cytometry with single cell PCR and cloning.

Zenginleştirilmiş İnsan Hafızası B Hücre Popülasyonlarından İstenilen Özgülliklerle Antikorların Seçimi ve Geri Kazanımı İçin Tek Hücreli Tarama Yöntemi

The human antibody repertoire represents a largely untapped source of potential therapeutic antibodies and useful biomarkers. While current computational ...

İmmünoloji ve Enfeksiyon

High Yield Expression of Recombinant Human Proteins with the Transient Transfection of HEK293 Cells in Suspension

The art of producing recombinant proteins with complex post-translational modifications represents a major challenge for studies of structure and function. The rapid establishment and high recovery from transiently-transfected mammalian cell lines addresses this barrier and is an effective means of expressing proteins that are naturally channeled through the ER and Golgi-mediated secretory pathway. Here is one protocol for protein expression using the human HEK293F and HEK293S cell lines transfected with a mammalian expression vector designed for high protein yields. The applicability of this system is demonstrated using three representative glycoproteins that expressed with yields between 95-120 mg of purified protein recovered per liter of culture. These proteins are the human Fc&#947;RIIIa and the rat &#945;2-6 sialyltransferase, ST6GalI, both expressed with an N-terminal GFP fusion, as well as the unmodified human immunoglobulin G1 Fc. This robust system utilizes a serum-free medium that is adaptable for expression of isotopically enriched proteins and carbohydrates for structural studies using mass spectrometry and nuclear magnetic resonance spectroscopy. Furthermore, the composition of the N-glycan can be tuned by adding a small molecule to prevent certain glycan modifications in a manner that does not reduce yield.

Laboratory-scale production of eukaryotic proteins with appropriate post-translational modification represents a significant barrier. Here is a robust protocol with rapid establishment and turnaround for protein expression using a mammalian expression system. This system supports selective amino acid, selective labeling of proteins and small molecule modulators of glycan composition.

A Method to Produce Recombinant Antibodies Against Metallopeptidase

TRANSKRIPT

A Method to Produce Recombinant Antibodies Against Metallopeptidase