Gianni Scimone video yapma ile mükemmel destek için minnettar.

HIV ile enfekte kan örneklerinin taşınması için bazı önemli tavsiyeler gerektirir. Tüm kan örnekleri sağlam sızdırmaz kaplarda taşınmalıdır. Konteyner dış ve numune ile birlikte herhangi bir evrak kirlenmesini önlemek için numune toplarken dikkatli olmalıdır. Enfekte kan işleme tüm kişilerin eldiven giymelidir. Eldiven değişti ve ellerini örnek işlem tamamlandıktan sonra yıkanmış olmalıdır. HIV virüslü kan örnekleri İşleme sınıf II biohazard kabin kaput yapılmalıdır. Mekanik pipetleme yardımcıları kullanılmalıdır. Iğne veya diğer kavuz (cam, örneğin pipetler veya kılcal tüpleri dahil) herhangi bir alternatif var olduğu durumlar ile sınırlı olmalıdır. Laboratuvar yüzeyler kan dökmek sonra uygun bir kimyasal dezenfektan ile dekontamine edilmeli ve iş faaliyetleri tamamlanmıştır. Kullanılan kontamine malzeme, tekrar kullanmadan önce dekontamine edilmelidir ya da klinik atık yolla doğru atılmalıdır. Müdahalelerin etkili olabilmesi için derhal başlatılmalıdır olarak potansiyel bulaşıcı kan veya sıvıları (yani, bu gerektiren evrensel önlemler) mesleki maruziyet Her olay bir tıbbi acil olarak tedavi edilmelidir. Protokol, tamamlanması için 5 gün gerektirir. Zaman diliminde Şekil 1&#39;de ayrıntılı olarak verilmiştir. Şekil 2&#39;de açıklanan yöntemleri kullanarak bakteri türlerinin tespit edilir. 1. Örnek Toplama <ol><li> 9 ml tam kan EDTA içeren tüplere içine çekilir. </li><li> Tüpler plazma elde etmek için oda sıcaklığında 10 dakika 2000 rpm&#39;de santrifüj. </li><li> Plazma 2 ml steril Eppendorf-tüp içinde toplanır. </li></ol> 2. Plazma Örnekleri DNA Ekstraksiyon <ol><li> Kaput, pipetler ve deney için gerekli malzeme sterilite garanti altına almak için yeterince dezenfekte edin. </li><li> UV ışıkları altında en az 30 dakika için tüm malzemeleri yerleştirin. </li><li> Bir dezenfektan ile eldiven silin. </li><li> Etanol içinde ıslatın ve birkaç kağıt havlu başlık altında koyun. Her zaman bir ipucu, ıslak kağıt havlu üzerine pipet silin atılır. </li></ol> DNA, üreticinin talimatlarına (Easy-DNA Takımı, Invitrogen, Carlsbad CA, ABD) ticari kiti kullanılarak elde edilir. <ol start="5"><li> Plazma 350 mcL steril bir 2ml Eppendorf tüp yerleştirilir. </li><li> 350 mcL süzülmüş ultra saf su negatif kontrol olarak kullanılmıştır. </li><li> Örnekleri lizozim (1mg/ml) 10 mcL ekleyin. </li><li> 37 az 30 dakika boyunca inkübe ° C </li><li> 500 mcL Lizis Çözüm örnekleri ekleyin ve hafifçe karıştırın. </li><li> 65 yaşında 7 dakika inkübe ° C </li><li> Örnekleri kloroform 900 mcL ekleyin. </li><li> Numunelerin düzgün viskoz kadar kuvvetlice karıştırın. </li><li> Yağış Çözüm ve şiddetle vorteks 200 mcL ekleyin. </li><li> Fazlar ayrı ve arayüz oluşturmak için oda sıcaklığında 10 dakika 10.500 rpm&#39;de örnekleri santrifüjleyin. </li><li> Üst sulu faz 1 ml% 100 etanol içeren taze mikrosantrifüj tüpüne aktarın. </li><li> 4 10500 rpm&#39;de 10 dakika boyunca örnek Santrifüj ° C </li><li> Etanol çıkarın. </li><li> % 70 etanol, 1 ml ekleyin. </li><li> 4 10 dakika boyunca maksimum hızda örnekleri Santrifüj ° C </li><li> Etanol çıkarın. Bir pipettator kalan etanol ile temizlenmesi gerekir. </li><li> 50 mcL ultra saf su pelletini tekrar. </li><li> Spektrofotometre ile DNA konsantrasyonu okuyun. </li></ol> 3. 16S rRNA gen PCR PCR 9 Daha önce açıklandığı gibi yapılır. <ol><li> 10X PCR tampon, 5 mcL 25 mM MgCl2, 5 mcL 2 mM toplam dNTP, 50 mcM astar RW01 (AACTGGAGGAAGGTGGGGAT) 1 mcL, 50 mcM astar DG74 1 mcL 10 mcL oluşan 100 mcL reaksiyon karışımının DNA Amplify (AGGAGGTGATCCAACCGCA), H20 34 mcL ve Taq polimeraz (AmpliTaq Gold, Uygulamalı Biosystem, Foster City, CA, USA) 0.5 mcL. </li><li> Bakteriyel Taq polimeraz ile olası kontaminasyonu önlemek amacıyla filtreler PCR karışımı aktarın. </li><li> 4 500 RCF az 30 dakika santrifüj filtreleri (Microcon, Millipore, Billerica, MA, ABD) ° C </li><li> (Pozitif ve negatif PCR denetimleri, örnekler ve çıkarılan su) yükseltilecek gereken örnekleri sayısına göre kısım PCR karışımı. </li><li> Aşağıdaki termal cycler koşulları: 94 ° C 10 dakika boyunca, her zaman için 1 dakika 40 kez 94 ° C, 55 ° C ve 72 ° C ve 72 ° C&#39;de 10 dakika </li><li> PCR ürünü% 2 agaroz jel üzerinde gözünüzde canlandırın. 100 bp DNA merdiven kullanın. PCR ürününün boyutu 360 bp (Şekil 3) hakkında. </li></ol> 4. PCR Ürün Arıtma Sadece PCR pozitif örnekler arındırılmalıdır. Arıtma kullanılarak yapılırticari kit aşağıdaki üreticinin talimatlarına (PCR PureLink microkit, Invitrogen, Carlsbad CA, USA). <ol><li> Izopropanol içeren PCR ürünü 1 hacim başına 4 cilt Cilt Tampon ekleyin. </li><li> Bir sütun bağlama Tampon PCR ürünü aktarın. </li><li> RT 10000 RCF 1 dakika boyunca santrifüjleyin. </li><li> Yıkama Tamponu etanol içeren sütun yıkayın. </li><li> RT 10000 RCF 1 dakika boyunca santrifüjleyin. </li><li> Silika membran kuru ve etanol ile herhangi bir kalıntı Yıkama Tamponu kaldırmak için RT 1 dakika maksimum hızda santrifüjleyin. </li><li> 10 mcL ultra saf su ekleyin. </li><li> 1 dakika oda sıcaklığında inkübe edin. </li><li> Saflaştırılmış DNA toplamak için oda sıcaklığında 2 dakika boyunca maksimum hızda santrifüjleyin. </li></ol> 5. Klonlama Lysogeny Broth (LB) Levha Hazırlık <ol><li> LB karışımı yaklaşık 800 ml su 25 gr eritin. </li><li> Son hacmi 1 L&#39;ye getirin </li><li> Bactoagar, 15 gr. </li><li> 20 dakika için Otoklav. </li><li> Otoklav sonrası şiddetle girdap balonuna çözüm erimiş agar karıştırmak için. </li><li> 50 ° C&#39;ye kadar çözüm soğutun </li><li> Ampisilin (50 mg / ml) ve girdap eriyene kadar ekleyin. </li><li> Yaklaşık 3mm derinliğe kadar plakaları dökün. </li><li> Plakaları oda sıcaklığında bekletin. </li><li> 37 her LB plaka ve inkübe yayıldı X-Gal (40mg/ml) ve IPTG (100 mM) ° C kullanıma hazır olana kadar. </li></ol> Yetkili Hücreler Dönüşüm Dönüşüm ticari kit aşağıdaki üreticinin talimatlarına (Topo TA klonlama kiti, Invitrogen, Carlsbad CA, USA) kullanılarak yapılır. <ol><li> Klonlama reaksiyon karışımı (1-4 mcL taze PCR ürünü, tuz solüsyonu 1 mcL, vektör ve gerekirse su 1 mcL) hazırlayın. </li><li> Reaksiyon hafifçe karıştırın ve oda sıcaklığında 5-10 dakika inkübe edin. </li><li> Buz üzerinde reaksiyon yerleştirin. </li><li> Yetkili hücrelerinin bir şişe içine klonlama reaksiyon 2 mcL ekleyin ve hafifçe karıştırın. </li><li> 30 dakika boyunca buz üzerinde inkübe edin. </li><li> 42 az 30 saniye için ısı-şok hücreleri ° C </li><li> Hemen buz tüp transferi. </li><li> Orta 250 mcL ekleyin. </li><li> Tighly tüp Cap ve 37 tüp yatay sallamak ° C 1 saat. </li><li> Prewarmed seçici bir plaka üzerinde her dönüşümü 50 mcL sürün. </li><li> 37 o gece inkübe ° C </li></ol> Takiben kuluçka plakalar, beyaz ve mavi koloniler gelişir. Beyaz koloniler PCR ürününün yerleştirilmesi için pozitif ve mavi koloniler PCR ürününün yerleştirilmesi için negatif. 6. Sıralama Analizi Sıralama Reaksiyon <ol><li> 2,5 ul DNA, 1 ul astar (ul / 5pmol) 1,1 ul BigDye (Uygulamalı Biosystem, Foster City, CA, USA): bir karışımı bu reaktifler kullanılarak yapılır. </li><li> Termal cycler koşulları: 96 ° C 1 dakika, 4 dakika 15 saniye ve 60 ° C için 10 saniye, 55 ° C 96 ° C için 25 kez. </li></ol> Sütun Arıtma <ol><li> Her reaksiyon için, bir MicroSpin Sütun (Qiagen, Milano, İtalya) hazırlar. </li><li> Reçine karışımı sütun ve vorteks tersine çevirin. </li><li> Snap, sütunun alt = kapağı gevşetin açın ve bir mikrosantrifüj tüp içinde yer sütun. </li><li> 1 dakika için 3200 rpm santrifüjleyin. </li><li> Sütun temiz bir mikrosantrifüj tüpüne aktarın. </li><li> Dikkatle pipetlemeyin sütun merkezi haline tüm PCR sıralama tepki. </li><li> 1 dakika için 3200 rpm santrifüjleyin. </li><li> Arıtılmış DNA tüp (ultra saf su 20 ul) içine eluite. </li></ol> Sıralama Analizi <ol><li> 96-multiwell plaka arıtılmış örnek (20 ul) yükleyin. </li><li> Sequencer plaka yükleyin. Otomatik DNA Sekans sıralama vadede sonuçlarını gösteren bir dört renk kromatogram üretir. </li><li> Kamu dizisi veritabanlarına karşı bir sorgu olarak nükleotid dizisi Girdi. Temel Yerel Hizalama Tarama Aracı (BLAST) arama, NCBI veritabanları ve sunucular üzerinde yapılır. </li><li> 98-100% benzerliklerin sadece bakterileri ele alalım. </li></ol> 7. Temsilcisi Sonuçlar <img src="/files/ftp_upload/2830/2830fig1.jpg" alt="Şekil 1" /> Şekil 1 prosedürü Timeline. <img src="/files/ftp_upload/2830/2830fig2.jpg" alt="Şekil 2" /> Şekil 2 tüm bakteri tanımlama prosedürü akış şemaları. <img src="/files/ftp_upload/2830/2830fig3.jpg" alt="Şekil 3" /> Şekil 3 gösteren geniş 16S rRNA geni PCR ürünleri% 2 agaroz jel. Lane 1 100bp DNA merdiveni içerir, şerit 2 PCR pozitif denetimi içeren, şerit 3 PCR negatif kontrol gösterir. Lane 4 HIV-pozitif hasta örnekleri gösterir ve şeritli 5 su içerir. Lane 6 shsağlıklı bir birey ve bir negatif PCR reaksiyonu insanı örnekleri; şeritli 7 su içerir. Sadece HIV pozitif hastalarda pozitif bir PCR görüntüler. Ultra Saf su çıkarma adımı sırasında bir negatif kontrol olarak kullanılan herhangi bir kirlenme meydana geldiğini gösterir. <img src="/files/ftp_upload/2830/2830fig4.jpg" alt="Şekil 4" /> Plazmid gösteren Şekil 4.% 0.7 agaroz jel miniprep prosedürü ile ayıklanır. Lane 1, 1 kilobaz DNA merdiveni içerir, 2 şeritli mavi kontrol kolonisi, 12 üzerinden 3 beyaz koloniler içerir şeritleri içerir. Mavi koloni plazmid PCR ürün eklemek içermez. Tüm 10 beyaz koloniler doğru eklemek plazmid içerir. <img src="/files/ftp_upload/2830/2830fig5.jpg" alt="Şekil 5" /> Şekil 5, HIV-pozitif bir kişiden plazma bakteri sıralama analiz bir örnek gösterir. Çalışmamızın sonuçları, HIV hastalığı mikrobiyal translokasyon bakterilerin translokasyonu kontrol bağırsak bağışıklığın önemli yetmezliği düşündüren HIV-negatif kişilerde görülür bir polimicrobic flora, içerdiğini göstermektedir.

<ol>
	<li>Hooper, L. V., Macpherson, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+adaptations+that+maintain+homeostasis+with+the+intestinal+microbiota.">Immune adaptations that maintain homeostasis with the intestinal microbiota.</a> Nat Rev Immunol. 10, 159-169 (2010).</li><li>Macpherson, A. J., Harris, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+between+commensal+intestinal+bacteria+and+the+immune+system.">Interactions between commensal intestinal bacteria and the immune system.</a> Nat Rev Immunol. 4, 478-485 (2004).</li><li>Kanauchi, O., Mitsuyama, K., Araki, Y., Andoh, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+intestinal+flora+in+the+treatment+of+inflammatory+bowel+disease.">Modification of intestinal flora in the treatment of inflammatory bowel disease.</a> Curr Pharm Des. 9, 333-346 (2003).</li><li>Brenchley, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+a+cause+of+systemic+immune+activation+in+chronic+HIV+infection.">Microbial translocation is a cause of systemic immune activation in chronic HIV infection.</a> Nat Med. 12, 1365-1371 (2006).</li><li>Brenchley, J. M., Price, D. A., Douek, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+disease:+fallout+from+a+mucosal+catastrophe.">HIV disease: fallout from a mucosal catastrophe.</a> Nat Immunol. 7, 235-239 (2006).</li><li>Jiang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasma+levels+of+bacterial+DNA+correlate+with+immune+activation+and+the+magnitude+of+immune+restoration+in+persons+with+antiretroviral-treated+HIV+infection.">Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection.</a> J Infect Dis. 199, 1177-1185 (2009).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+associated+with+sustained+failure+in+CD4++T-cell+reconstitution+in+HIV-infected+patients+on+long-term+highly+active+antiretroviral+therapy.">Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy.</a> AIDS. 22, 2035-2038 (2008).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+Microbial+Translocation+and+Immune+Hyperactivation+in+Disease+Progression+of+HIV++Patients+with+Preserved+CD4+Count+in+the+Absence+of+ART.">Role of Microbial Translocation and Immune Hyperactivation in Disease Progression of HIV+ Patients with Preserved CD4 Count in the Absence of ART.</a> , (2010).</li><li>Greisen, K., Loeffelholz, M., Purohit, A., Leong, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+primers+and+probes+for+the+16S+rRNA+gene+of+most+species+of+pathogenic+bacteria,+including+bacteria+found+in+cerebrospinal+fluid.">PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid.</a> J Clin Microbiol. 32, 335-351 (1994).</li></ol>

<p class="jove_content"&gt; Biz, burada, HIV ile enfekte bireylerin periferik kan bakteri translokasyonu karakterize bir PCR / sıralama protokol göstermektedir.</p&gt;<p class="jove_content"EDTA içeren tüplere toplanan plazma kullanırken&gt; En güvenilir sonuçlar elde edilir. Kan örneklemesi sonra, plazma hemoliz ve DNA parçası bozulması önlemek için, 2 / 3 saat içinde santrifüj ile ayrılmış olmalıdır. Örnekler -80 sonra yaklaşık 5 gün ve ° C -20 ° C&#39;de saklanır Birden fazla donma ve çözülme döngüleri bakteri...

<table border="1"><tbody><tr><th> Reaktif Adı </th><th> Şirket </th><th> Katalog Numarası </th><th> Yorumlar (isteğe bağlı) </th></tr><tr><td> Easty-DNA Seti </td><td> Invitrogen </td><td> K 180.001 </td><td></td></tr><tr><td> Kloroform </td><td> Sigma-Aldrich </td><td> C2432 </td><td></td></tr><tr><td> Etanol </td><td> Sigma-Aldrich </td><td> E7203 </td><td></td><tr/><tr><td> Ultrapure Waer </td><td> Invitrogen </td><td> 10977049 </td><td></td></tr><tr><td> Lizozim </td><td> Fluka </td><td> 62970 </td><td> 10 mcg / mL distile su </td></tr><tr><td> AmpliTaq Gold </td><td> Uygulamalı Biosystem </td><td> 26478701 </td><td></td></tr><tr><td> Microcon 100 </td><td> Millipore </td><td> 42413 </td><td></td></tr><tr><td> PCR primerleri </td><td> Invitrogen </td><td></td><td></td></tr><tr><td> Agaroz </td><td> Eppendorf </td><td> C1343 </td><td></td></tr><tr><td> DNA merdiveni </td><td> Invitrogen </td><td> 15628019 </td><td></td></tr><tr><td> Purelink PCR mikro kiti </td><td> Invitrogen </td><td> K310050 </td><td></td></tr><tr><td> LB Agar, toz </td><td> Invitrogen </td><td> 22700025 </td><td></td></tr><tr><td> Bactoagar </td><td> Invitrogen </td><td></td><td></td></tr><tr><td> Ampisilin </td><td> Invitrogen </td><td> 11593027 </td><td> Distile su içinde 10 mg / ml </td></tr><tr><td> X-gal </td><td> Invitrogen </td><td> 15520034 </td><td> DMF içinde 40mg/mL </td></tr><tr><td> IPTG </td><td> Invitrogen </td><td> 15529019 </td><td> Distile su içinde 100 mM </td></tr><tr><td> Topo TA klonlama kiti </td><td> Invitrogen </td><td> K450002 </td><td></td></tr><tr><td> Purelink Hızlı Plazmid Miniprep kiti </td><td> Invitrogen </td><td> K210010 </td><td></td></tr><tr><td> Büyük boya </td><td> Uygulamalı Biosystem </td><td> 4337455 </td><td></td></tr><tr><td> DyeEx 2.0 dönmeye kiti </td><td> Qiagen </td><td> 63204 </td><td></td></tr></tbody></table>

sequencing of bacterial microflora in peripheral blood: our experience with hiv-infected patients

Sağlıklı bir gastrointestinal sistem, humoral ve hücresel mukozal bağışıklık sistemi 1,2 gelişimini etkileyen komensal mikropların çok çeşitli fizyolojik tarafından kolonize. Mikrobiyota bağışıklık sistemini güçlü bir mukozal bariyeri ile karşı korumalıdır. Enfeksiyonlar ve antibiyotikler normal gastrointestinal sistem bariyer ve yerleşik bakteri kompozisyonu, olası bağışıklık anormallikleri 3 sonuç değiştirmek için bilinmektedir. HIV, sistemik immün aktivasyon 4-7 katkıda lipopolisakkarid ve bakteriyel DNA parçaları gibi bakteriyel bioproducts, sistemik dolaşıma mukozal bağışıklık ve kaçak ilerici yetmezliği olan gastrointestinal bariyer ihlali neden olur . Mikrobiyal translokasyon, HIV / AIDS immünopatogenezi ve tedavisi 4,8 yanıt alakalıdır . Biz, HIV ile enfekte olan hastaların periferik kan translocating bakteriler bileşimi karakterize etmek amaçlanmıştır. Amacımız takip etmek, bir sıralama analizi ile takip panbacteric 16S ribosomial gen için PCR kurdu. Kısaca, hem de HIV ile enfekte ve sağlıklı kişilerde tam kan kullanılır. Sağlıklı bireyler normal bağırsak homeostazı mevcut olduğu göz önüne alındığında, bu hastalarda mikroflora hiçbir translokasyon bekleniyor. Venipunktür ve plazma ayırma ile tam kan toplama, DNA plazmasından elde edilen ve gen 9 ribosomial panbacteric 16S için geniş bir PCR reaksiyonu gerçekleştirmek için kullanılır. Takiben PCR ürün arıtma, klonlama ve sıralama analizleri yapılmaktadır.

Watch this Scientific Journal Video about Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients at JoVE.com

Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Bizim deney HIV pozitif hastaların periferik kan translocating bakteri türlerinin bir sıralama analizi gerçekleştirmek için nasıl gösterecektir.

Periferik Kan Bakteriyel Mikroflorası Sıralama: HIV ile enfekte olan hastalar ile bizim Deneyimi

The healthy gastrointestinal tract is physiologically colonized by a large variety of commensal microbes that influence the development 
	of the humoral ...

sequencing-bacterial-microflora-peripheral-blood-our-experience-with

Research

JoVE Journal

Medicine

12.2K Görüntüleme.  San Paolo Hospital University of Milan, Italy. Bizim deney HIV pozitif hastaların periferik kan translocating bakteri türlerinin bir sıralama analizi gerçekleştirmek için nasıl gösterecektir.

Video: Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Modeling Intracerebral Hemorrhage in Mice: Injection of Autologous Blood or Bacterial Collagenase

Spontaneous intracerebral hemorrhage (ICH) defines a potentially life-threatening neurological malady that accounts for 10-15% of all stroke-related hospitalizations and for which no effective treatments are available to date1,2. Because of the heterogeneity of ICH in humans, various preclinical models are needed to thoroughly explore prospective therapeutic strategies3. Experimental ICH is commonly induced in rodents by intraparenchymal injection of either autologous blood or bacterial collagenase4. The appropriate model is selected based on the pathophysiology of hemorrhage induction and injury progression. The blood injection model mimics a rapidly progressing hemorrhage. Alternatively, bacterial collagenase enzymatically disrupts the basal lamina of brain capillaries, causing an active bleed that generally evolves over several hours5. Resultant perihematomal edema and neurofunctional deficits can be quantified from both models. In this study, we described and evaluated a modified double injection model of autologous whole blood6 as well as an ICH injection model of bacterial collagenase7, both of which target the basal ganglia (corpus striatum) of male CD-1 mice. We assessed neurofunctional deficits and brain edema at 24 and 72 hr after ICH induction. Intrastriatal injection of autologous blood (30 &mu;l) or bacterial collagenase (0.075U) caused reproducible neurofunctional deficits in mice and significantly increased brain edema at 24 and 72 hr after surgery (p&lt;0.05). In conclusion, both models yield consistent hemorrhagic infarcts and represent basic methods for preclinical ICH research.

Clinically relevant animal models of intracerebral hemorrhage (ICH) are needed to extend our knowledge of hemorrhagic stroke and to examine novel therapeutic strategies. In this study, we describe and evaluate two ICH models that implement unilateral injections of either autologous whole blood or bacterial collagenase into the basal ganglia (corpus striatum) of mice.

Farelerde Modelleme İntraserebral Kanama: Otolog Kan veya bakteriyel kollajenaz Enjeksiyon

Spontaneous intracerebral hemorrhage (ICH) defines a potentially life-threatening neurological malady that accounts for 10-15% of all stroke-related ...

Tıp

Measuring Frailty in HIV-infected Individuals. Identification of Frail Patients is the First Step to Amelioration and Reversal of Frailty

A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased reserve and resistance to stressors increases in incidence with increasing age. In the elderly, frailty may pursue a step-wise loss of function from non-frail to pre-frail to frail. We studied frailty in HIV-infected patients and found that ~20% are frail using the Fried phenotype using stringent criteria developed for the elderly1,2. In HIV infection the syndrome occurs at a younger age.
HIV patients were checked for 1) unintentional weight loss; 2) slowness as determined by walking speed; 3) weakness as measured by a grip dynamometer; 4) exhaustion by responses to a depression scale; and 5) low physical activity was determined by assessing kilocalories expended in a week's time. Pre-frailty was present with any two of five criteria and frailty was present if any three of the five criteria were abnormal.
The tests take approximately 10-15 min to complete and they can be performed by medical assistants during routine clinic visits. Test results are scored by referring to standard tables. Understanding which of the five components contribute to frailty in an individual patient can allow the clinician to address relevant underlying problems, many of which are not evident in routine HIV clinic visits.

Frailty syndrome is commonly seen in the aged and reflects multi-system physiological change. However, with reduced functional reserve and resilience frailty is also known to be common in the HIV infected population. This study outlined an easily administered screening test to identify HIV patients with frailty. When significant components of frailty are identified, clinicians will be able to focus on amelioration of the problem and promote reversion to the pre-frail state.

HIV ile enfekte Bireylerde Frailty ölçüm. Narin Hastalar tanımlanması Islahı ve Frailty iptali için ilk adımdır

A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased ...

Computerized Dynamic Posturography for Postural Control Assessment in Patients with Intermittent Claudication

Computerized dynamic posturography with the EquiTest is an objective technique for measuring postural strategies under challenging static and dynamic conditions. As part of a diagnostic assessment, the early detection of postural deficits is important so that appropriate and targeted interventions can be prescribed. The Sensory Organization Test (SOT) on the EquiTest determines an individual&#39;s use of the sensory systems (somatosensory, visual, and vestibular) that are responsible for postural control. Somatosensory and visual input are altered by the calibrated sway-referenced support surface and visual surround, which move in the anterior-posterior direction in response to the individual&#39;s postural sway. This creates a conflicting sensory experience. The Motor Control Test (MCT) challenges postural control by creating unexpected postural disturbances in the form of backwards and forwards translations. The translations are graded in magnitude and the time to recover from the perturbation is computed.
Intermittent claudication, the most common symptom of peripheral arterial disease, is characterized by a cramping pain in the lower limbs and caused by muscle ischemia secondary to reduced blood flow to working muscles during physical exertion. Claudicants often display poor balance, making them susceptible to falls and activity avoidance. The Ankle Brachial Pressure Index (ABPI) is a noninvasive method for indicating the presence of peripheral arterial disease and intermittent claudication, a common symptom in the lower extremities. ABPI is measured as the highest systolic pressure from either the dorsalis pedis or posterior tibial artery divided by the highest brachial artery systolic pressure from either arm. This paper will focus on the use of computerized dynamic posturography in the assessment of balance in claudicants.

Individuals with intermittent claudication exhibit poor balance compared to healthy controls. Computerized dynamic posturography is an objective method for measuring an individual's postural responses to balance disturbances. This provides an objective reflection of the person&#x2019;s ability to respond to situations under which sensory stimuli are altered and unexpected perturbations occur.

Aralıklı topallama Hastalarda Postural Kontrol Değerlendirme için bilgisayarlı dinamik postürografi

Computerized dynamic posturography with the EquiTest is an objective technique for measuring postural strategies under challenging static and dynamic ...

Assessment of Vascular Function in Patients With Chronic Kidney Disease

Patients with chronic kidney disease (CKD) have significantly increased risk of cardiovascular disease (CVD) compared to the general population, and this is only partially explained by traditional CVD risk factors. Vascular dysfunction is an important non-traditional risk factor, characterized by vascular endothelial dysfunction (most commonly assessed as impaired endothelium-dependent dilation [EDD]) and stiffening of the large elastic arteries. While various techniques exist to assess EDD and large elastic artery stiffness, the most commonly used are brachial artery flow-mediated dilation (FMDBA) and aortic pulse-wave velocity (aPWV), respectively. Both of these noninvasive measures of vascular dysfunction are independent predictors of future cardiovascular events in patients with and without kidney disease. Patients with CKD demonstrate both impaired FMDBA, and increased aPWV. While the exact mechanisms by which vascular dysfunction develops in CKD are incompletely understood, increased oxidative stress and a subsequent reduction in nitric oxide (NO) bioavailability are important contributors. Cellular changes in oxidative stress can be assessed by collecting vascular endothelial cells from the antecubital vein and measuring protein expression of markers of oxidative stress using immunofluorescence. We provide here a discussion of these methods to measure FMDBA, aPWV, and vascular endothelial cell protein expression.

The degree of vascular dysfunction and contributing physiological mechanisms can be assessed in patients with chronic kidney disease by measuring brachial artery flow-mediated dilation, aortic pulse-wave velocity, and vascular endothelial cell protein expression.

Kronik Böbrek Hastalarında Vasküler Fonksiyon Değerlendirilmesi

Patients with chronic kidney disease (CKD) have significantly increased risk of cardiovascular disease (CVD) compared to the general population, and this ...

Orthotopic Implantation and Peripheral Immune Cell Monitoring in the II-45 Syngeneic Rat Mesothelioma Model

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of the role of the tumor microenvironment in treatment response, collectively point to the need for immune-competent orthotopic models for pre-clinical testing of these new therapies. This paper demonstrates how to establish an orthotopic immune-competent rat model of pleural malignant mesothelioma. Monitoring disease progression in orthotopic models is confounded by the internal location of the tumors. To longitudinally monitor disease progression and its effect on circulating immune cells in this and other rat models of cancer, a single tube flow cytometry assay requiring only 25 &#181;l whole blood is described. This provides accurate quantification of seven immune parameters: total lymphocytes, monocytes and neutrophils, as well as the T-cell subsets CD4 and CD8, B-cells and Natural Killer cells. Different subsets of these parameters are useful in different circumstances and models, with the neutrophil to lymphocyte ratio having the greatest utility for monitoring disease progression in the mesothelioma model. Analyzing circulating immune cell levels using this single tube method may also assist in monitoring the response to immune-based treatments and understanding the underlying mechanisms leading to success or failure of treatment.

The generation of an orthotopic rat model of pleural malignant mesothelioma by implantation of II-45 mesothelioma cells into the pleural cavity of immune competent rats is presented. A flow cytometric method to analyze seven immune cell subsets in these animals from a 25 &#181;l&#160;blood sample is also described.

II-45 singenik Rat Mezotelyoma Modelinde Ortotopik Yerleştirilmesi ve Periferik Bağışıklık Hücre İzleme

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of ...

Endotoxin Activity Assay for the Detection of Whole Blood Endotoxemia in Critically Ill Patients

Lipopolysaccharide, also known as endotoxin, is a fundamental component of gram-negative bacteria and plays a crucial role in the development of sepsis and septic shock. The early identification of an infectious process that is rapidly evolving to a critical illness might prompt a quicker and more intensive treatment, thereby potentially leading to better patient outcomes. The Endotoxin Activity (EA) assay can be used at the bedside as a reliable biomarker of systemic endotoxemia. The detection of elevated endotoxin activity levels has been repeatedly shown to be associated with an increased disease severity in patients with sepsis and septic shock. The assay is quick and easy to perform. Briefly, after sampling, an aliquot of whole blood is mixed with an anti-endotoxin antibody and with added LPS. Endotoxin activity is measured as the relative oxidative burst of primed neutrophils as detected by chemioluminescence. The assay&#39;s output is expressed on a scale from 0 (absent) to 1 (maximal) and categorized as &#8220;low&#8221; (&#60;0.4 units), &#8220;intermediate&#8221; (0.4&#8211;0.59 units), or &#8220;high&#8221; (&#8805;0.6 units). The detailed methodology and rationale for the implementation of the EA assay are reported in this manuscript.

We hereby present a protocol to measure at the bedside the endotoxin activity of human whole blood samples. The Endotoxin Activity assay is a simple test to perform and may be a useful biomarker in critically ill patients with sepsis.

Eleştirel hasta hastalarda tam kan endotoksemi tespiti için endotoksin aktivite assay

Lipopolysaccharide, also known as endotoxin, is a fundamental component of gram-negative bacteria and plays a crucial role in the development of sepsis ...

Digital Handwriting Analysis of Characters in Chinese Patients with Mild Cognitive Impairment

An increasing amount of evidence shows that cognitive deficits and movement dysfunctions are not separated. Patients with mild cognitive impairment (MCI) can manifest fine motor disorders of the upper extremities. Handwriting is a complex and unique human activity involving both motor and cognitive coordination. Researchers from western countries have discovered that patients with MCI have abnormal handwriting features. However, no relevant studies have been conducted in the Chinese population. Owing to the cross-culture phenomenon of handwriting, the aim of this study is to find new handwriting tasks to demonstrate the differences in handwriting features between elderly patients with MCI and age-matched healthy individuals.

This study proposed a digital handwriting analysis of characters in individuals with mild cognitive impairment to find more information than is revealed by traditional pencil&#8211;paper handwriting analysis.

Hafif Bilişsel Bozukluğu Olan Çinli Hastalarda Karakterlerin Dijital El Yazısı Analizi

An increasing amount of evidence shows that cognitive deficits and movement dysfunctions are not separated. Patients with mild cognitive impairment (MCI) ...

Fertility Preservation in Patients with Severe Ovarian Dysfunction

Ovarian function progressively declines during aging and in some pathophysiological conditions including karyotype abnormality, autoimmune diseases, chemo- and radiation-therapies, as well as ovarian surgeries. In unmarried women with severe ovarian dysfunction, fertility preservation is important for future pregnancies. Although oocyte cryopreservation is an established method for fertility preservation, these patients could only preserve a limited number of oocytes even after ovarian hyperstimulation, leading to repeated stimulations to ensure sufficient oocytes to guarantee future pregnancy. To solve this issue, we have recently developed a drug-free in vitro activation (IVA) procedure, which enable us to stimulate early stages of ovarian follicles to develop to the preantral follicle stage. These preantral follicles can respond to the unique protocol of gonadotropin stimulation, resulting in increased number of retrieved oocytes per ovarian stimulation for cryopreservation. The drug-free IVA comprised from the surgical approach and ovarian stimulation. We removed a part of cortex from one or both ovaries from patients under laparoscopic surgery. The ovarian cortical tissues were cut into small cubes to disrupt the Hippo signaling pathway and stimulate the development of early stage follicles. These cubes were grafted orthotropically into remaining ovaries as well as beneath the serosa of both Fallopian tubes. We have already published the surgical procedure of the drug-free IVA and the protocol of subsequent ovarian stimulation, but herein we present the details of laboratory methods required for drug-free IVA.

We present details of laboratory procedures for drug-free in vitro activation (IVA) of ovarian follicles for patients with severe ovarian dysfunction. This method could increase the number of retrievable oocytes per ovarian hyperstimulation and benefit fertility preservation for those patients.

Şiddetli Yumurtalık Disfonksiyonu Olan Hastalarda Doğurganlığın Korunması

Ovarian function progressively declines during aging and in some pathophysiological conditions including karyotype abnormality, autoimmune diseases, ...

Evaluation of a Point-of-Care Testing Analyzer for Measuring Peripheral Blood Leukocytes

White blood cell (WBC) is an important indicator of inflammation in the body, and it can help distinguish between bacterial and viral infections. At present, most primary medical institutions in China have a poor percentage of adoption of blood-testing technology, and a hematology detection system with a high price to performance ratio and easy operation is urgently needed in primary healthcare centers. This paper introduces the principle and operation procedures of a point-of-care testing (POCT) card-based leukocyte analyzer (evaluated system), which was used to detect WBC indexes such as neutrophils, lymphocytes, and intermediate group cells (including eosinophils, basophils, and monocytes) in whole blood. The results from the evaluated system were compared to those from two commercial automatic hematology analyzers (reference system). The correlation and consistency between the evaluated system and the commercial reference systems were analyzed. The results showed that WBC count and number of granulocytes detected by the evaluated and reference systems showed a strong positive correlation (rs = 0.972 and 0.973, respectively), while the number of lymphocytes showed a relatively low correlation (rs = 0.851). A Bland-Altman plot showed that the major difference between the values detected by the evaluated system and the reference systems is within 95% limits of agreement (LoA), indicating that the two systems are in good agreement. In conclusion, the evaluated system has an excellent correlation, robust consistency, and a reliable comparison with the results of the widely used automatic hematology analyzers. It is ideal for WBC detection in primary medical institutions where a full-automatic five-category hematology analyzer is unavailable, especially during the COVID-19 normalized prevention and control period.

A protocol to measure peripheral blood leukocytes using a POCT card-based leukocyte analyzer is presented here. Same blood samples were tested by two automated hematology analyzers to evaluate the consistency and accuracy of the results. The results showed that the evaluated analyzer had a good correlation with the reference system.

Periferik Kan Lökositlerini Ölçmek için Bakım Noktası Test Analizörünün Değerlendirilmesi

White blood cell (WBC) is an important indicator of inflammation in the body, and it can help distinguish between bacterial and viral infections. At ...

Cox-Maze IV Procedure Concomitant with Valvular Surgery In Situs Inversus Dextrocardia: A Single-Center Experience in China

Atrial fibrillation (AF) is the most common cardiac arrhythmia. The use of ablation technologies made the Cox-Maze IV procedure (CMP-IV) technically easier, faster, becoming the gold standard for the surgical treatment of AF. However, the efficacy and safety of CMP-IV in situs inversus dextrocardia are largely unknown. This paper summarizes the CMP-IV procedure performed concomitantly with valvular surgery in patients with situs inversus dextrocardia at this institution.
From February 2016 to September 2020, three dextrocardia patients with persistent AF and valvular diseases were referred to this institution for valvular and CMP-IV surgery. CMP-IV was performed using either cryoablation with a nitrous oxide (N2O)-based cryoprobe or a bipolar radiofrequency clamp and bipolar radiofrequency pen. Mechanical valve replacement or mitral vavuloplasty was performed in another patient in addition to tricuspid annuloplasty. Transmurality of the ablated atrial tissues was evaluated by electron microscopy. Heart function was assessed by transthoracic echocardiography. Cardiac rhythm was monitored by 24 h Holter at 3, 6, 12, 18, 24, and 48 months follow-up. 
All the AF was successfully eliminated in the ablation procedure without recurrence or other complications during hospitalization. The mean bypass and crossclamp times were similar in all the patients. The postoperative ventilator support time, the duration of stay in the ICU, and postoperative residence time were also not significantly different among the patients. Transmural atrial necrosis was detected in the ablated atrial tissues. Sinus rhythm maintenance was achieved at 3, 6, 12, 18, 24, and 48 months follow-up in all the patients. All valve protheses switched freely; no tricuspid regurgitation was observed. The results of the present study demonstrate that the CMP-IV is safe and effective in eliminating AF in dextrocardia patients concomitant with valvular surgery.

We summarize the Cox-Maze IV procedure concomitant with valvular surgery performed in patients with situs inversus dextrocardia at this institution.

Cox-Labirent IV Prosedürü Kapak Cerrahisi ile Birlikte In Situs Inversus Dextrocardia: Çin'de Tek Merkezli Bir Deneyim

Atrial fibrillation (AF) is the most common cardiac arrhythmia. The use of ablation technologies made the Cox-Maze IV procedure (CMP-IV) technically ...