Bu araştırma Ekonomi Bakanlığı ve rekabet (MINECO) SAF2016-78898-C2-2-R. İspanya hükümeti hibe tarafından desteklenmiştir

Bu çalışmada her iki İspanyol düzenlemeler (Royal kararname 53/2013 - hukuk 32/2007) sıkı doğrultusunda gerçekleştirilmiştir ve Avrupa Birliği Kuralları (yönergesi 2010/63/AB) bakım ve Biyomedikal Araştırma hayvanlarda kullanımı.
 1. Fareyi hazırlanması Not: erkek rats hormon değişiklikleri önlemek için deneyler yapılır.
<ol><li>Ketamin hidroklorür (30 mg/kg) ve İntramüsküler enjekte xylazine hidroklorür (5 mg/kg); bu doz ile bir karışımını kullanarak hayvan sıçan derinden yaklaşık 1 h. anestezi Anesthetize</li>
	<li>Tutam sıçan &#39; s ayak; devamsızlık bir geri çekilmesi refleks hayvan tamamen bilinçsiz olduğunu gösterir. Fare için çimdik yanıt verirse, ilk doz üçte biri takıma giren anestezi vermek.</li>
	<li>Kafa derisi tıraş ve cerrahi alan povidone-iyot ile dezenfekte.</li>
	<li>Yer hayvan 38 ° C sıcaklık sürdürmek ve hayvan için bir Isıtma yastığı &#39; iki kulak çubuğu ve bir ısırık çubuğu kullanarak çerçeveyi stereotaksik kafasından s. Kulak çubuğu olan kulak zarı delici önlemek için dikkatli olun.</li>
	<li>Her göz için bir damla göz jeli veya serum salin uygulayarak gözleri koruyun.</li>
</ol> 2. Odalarda klima Temporal kemik farenin konumunu <ol><li>bir neşter kullanmadan bir kesi kafatası maruz ve kafatasının yüzeyini örten kapaklarini geri çekmek için orta çizgi boyunca olun.</li>
	<li>Steril pamuklu ipucu hafifçe bregma, lambda ve sıçan beyin 22 Paxinos ve Watson'ın atlas göre interaural 0 görselleştirmek için kafatasının yüzeyini örten herhangi bir kan kaldırmak için kullanın.</li>
	<li>Temporal kas sırt onun ekleme kafatasındaki bir neşter ile yakınındaki bir kesi yapmak. Bir iğne ve dikiş malzeme kullanılarak Kas çekin ve belgili tanımlık suture maddi stereotaksik çerçeveye saptamak; Bu temporal kemik neden olur. Kanama meydana gelirse, soğuk steril serum fizyolojik ile durulayın.</li>
	<li>Steril düz iğne tam güvenli emin stereotaktik micromanipulator içinde yerleştirin.</li>
	İğne ucu interaural 0 olarak ayarlayın kafatası, yüzeyi üzerinde doğru gelinceye <li>iğneyi yavaşça indirin. Bu noktada sıfır ayarlayın ve bu noktadan itibaren koordinatları belirlemek.</li>
	<li>Stereotaksik koordinatları ilgi beyin alan bağlı olarak değişir. Bu koordinatlar sıçan beyin 22 Paxinos ve Watson'ın atlas kullanarak belirleyin. Bir kez koordinatları belirlenir, o koordinatlara eşleşecek şekilde iğne hareket.</li>
	<li>Hedef aşağıdaki dört puan koordinatlarını kullanarak AC: A: A / P =-5.8 mm, M/M = 6,4 mm + /; B: A/P =-2.7 mm, M/M = 6,4 mm + /; C: A/P =-2.7 mm, M/M = +/-8.67 mm; D: A/P =-5.8 mm, M/M = 8.67 mm. + / alt sağ temporal kemik her bu dört puan görselleştirmek için iğne. Bir işaretleyici kalem kullanarak, temporal kemik noktalarında işaretlemek ve bunları bir dikdörtgen çizmek için bağlamak; Dikdörtgen bir pencerenin kemik ( şekil 1) açmak için bir rehber olarak görev yapacak.</li>
</ol> 3. Cerrahi pozlama AC <ol><li>açık bir elektrikli matkap ve küçük bir matkap kullanarak pencereyi biraz (0.6 mm Ø). Kemik uzaklıkta verene 8000 devirde dikdörtgenin çevre matkap. Delme yüzey subcortical yapılara zarar önlemek için soğuk steril serum fizyolojik ile durulama tarafından cool. Kemik yolu verdiğinde, direnç bir düşüş tespit edilebilir. Beyin inebilecek değil dikkatli olun.</li>
	<li>Sınırları gevşek olduğunda iyi Forseps ile kaplama kemik çekin ve soğuk steril serum fizyolojik içinde saklayın.</li>
</ol> 4. Ablasyon AC <ol><li>cerrahi mikroskop (10 X), hafifçe kullanarak meninkslerde mikrocerrahi bir bıçak ile kesmek ve bunları iki ince sivri uçlu forseps kullanarak kaldırın. Kanama meydana gelirse, soğuk steril serum fizyolojik ile durulayın.</li>
	<li>Yavaşça steril bir 20 G künt ucu iğne birleştiğinde bir emme cerrahi cihazı (basıncı-0.24 bar) kullanarak AC Aspire edin. Bu noktada çok önemlidir ve çok dikkatli bir şekilde yapılması gerekiyor: yalnızca altı kortikal katmanlar ve alttaki beyaz önemli değil Aspire edin.</li>
	<li>Kanama Perfore arterler durdurana kadar Aspire edin.</li>
	<li>Aspirasyon işlemi tamamlandığında ayıklanan kemik ile yaralı alanı kapsayacak ve absorbe bir kan durdurucu sargı gazlı bez uygulayın.</li>
	<li>Özgün konumuna yeniden elde etmek ve deri yara klip (9 mm) kullanarak dikiş temporal kas izin. Antibiyotikli bir krem uygulayın (bkz. Tablo malzeme). Üç gün boyunca günde iki kez yaraya merhem uygulamaya devam. 
	Not: Her uygulama yaranın üzerine uygulanan ince bir tabaka oluşur.</li>
	<li>Ekleme buprenorfin subkutan arkasında bir analjezik 1s ameliyattan sonra ve daha sonra her 8 h 72 h. sırasında fare (0,05 mg/kg)</li>
	<li>o uyanana kadar Isıtma yastığını hayvan tutmak ve kurtarmak için onun konut kafes dönmek.</li>
	<li>Ev hayvanları tek tek dikilmiş alan dokunmaktan kafes arkadaşları önlemek ve bazı zenginleştirme öğeleri sağlamak için. Enfeksiyonu önlemek ve dikkatle kontrol hayvan düzgün kurtarır ve rahatsızlık belirtisi göstermez için günlük talaş değiştirin.</li>
</ol> 5. Doku koleksiyonu dikkat: paraformaldehyde (PFA), katı ve sulu işlerken, kişisel koruyucu donanımları (PPE) ve güvenlik kabini kullanın.
 Not: %4 (w/v) İngiltere'de yılın 1 ısı (55 ° C) kullanarak tamponlanmış fosfat solüsyonu (PBS) x içine çözülerek 750 mL formaldehit solüsyon hazırlamak. Formaldehit çözüm filtre kağıdı ile filtre. Zil hazırlamak &#39; 8,5 gram NaCl, 0, 25 g KCl ve 0.2 g NaHCO 3 ' te 1000 mL su eriterek tarafından s çözüm (çözüm pH 6,9 =).
<ol><li>İçin çalışma için gerekli olduğu sürece hayatta hayvanın izin. AC ablated fare ile gerçekleştirilen araştırma tamamlandığında, ölümcül 0.1 mL sodyum Fentobarbital (60 mg/kg) intra Periton enjeksiyonu ile uyuşturan. Anestezi derinliği ayak çimdik ve para çekme refleks yokluğunda tarafından değerlendirmek.</li>
	<li>Hayvan derin anestezi, İntrakardiyak perfüzyon 23 zil 125 mL / kaplamadığında &#39; s çözüm takip 750 mL formaldehit çözeltisi 1.8 mm iğne ölçer kullanarak iç çapı.</li>
	<li>Perfüzyon bittiği zaman, fareyi ilk servikal omur, başını kesmek.</li>
	Baştan çıkarmak belgili tanımlık deri ve kas ve kafatası maruz <li>Kullanım makas. Kesip deliği magnum açın ve kafatası arkası kaldırmak için makas kullanın.</li>
	<li>Spencer makas kullanarak orbital kemiğin içine kesme ve rongeurs beyin ortaya çıkarmak için kafatasının üst kenarları boyunca kesmek için kullanın bir enine olun. Beyin zarar vermemeye dikkat.</li>
	Bir kez beyin maruz, <li>dikkatli bir şekilde ince sivri uçlu forseps kullanarak dura mater çıkarın. Parmağını yavaşça altında kepçe ve beyin yükseltmek için kullanın. Beyin yükseltmek ve sinirler unt kestiIl ücretsizdir. Formaldehit çözüm beyinde bırakın ve 24 h için 4 ° C'de depolayın</li>
</ol> 6. Yerelleştirme AC lezyonların <ol><li>sonrası fiksasyon sonra dikkatle beyin beyin yanal yüzeyinin açığa sagittal sıçan beyin matris yer..</li>
	<li>Bir fotoğraf makinesini 21 cm yukarıda bir kamera sahibi kullanarak korteks yüzeyine yerleştirin, seçin &#34; super makro çekim &#34; modu ve almak bir resim beyin yüzeyinin.</li>
	<li>Beyin beyin dorsal yüzeyi açığa koronal sıçan beyin matris yerleştirin ve bir fotoğraf daha.</li>
	<li>Bir resim Düzenleyicisi programı kullanarak görüntüleri açın ve onları aşağı % 50 onlarla çalışmayı kolaylaştırmak için ölçekli. Bregma, lambda ve Paxinos ve Watson'ın koordinatları 19 göre resim üzerinde interaural 0 başvuruları tanımlamak ve resimler ( Resim 2) kendi konumunu işaretleyin. Ablasyon kontur beyin yanal resmin üzerinde çizin. Çevre hesaplamak.</li>
	<li>Alma koordinat harita İlköğretim (A1) ve ikincil bölgeleri (Dorsal ve Ventral Cortices) AC bulunduğu 18-resimlerle çalıştığınız dosya Düzenleyicisi programı nerede. Harita üzerinde tıklayın ve ablated beyin yanal fotoğrafı üst üste sürükleyin.
	<ol><li>Bregma yapmak ve lambda başvurular koordinat haritanın denk yanal beyin resimde tespit bregma ve lambda referansları ile.</li>
		<li>Rhinal fissür beyin haritasını resmini ayarlamak için bir referans olarak kullanmak ve yapmak onları ( şekil 2B) denk.</li>
	</ol></li> <li>Hesaplama lezyon alan AC. tarafından işgal göre yüzdesi</li></ol>

<ol>
	<li>Talwar, S. K., Gerstein, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auditory+frequency+discrimination+in+the+white+rat.">Auditory frequency discrimination in the white rat.</a> Hear Res. 126 (1-2), 135-150 (1999).</li><li>Heffner, H. E., Heffner, R. S., Contos, C., Ott, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Audiogram+of+the+hooded+Norway+rat.">Audiogram of the hooded Norway rat.</a> Hear Res. 73 (2), 244-247 (1994).</li><li>Malmierca, M. S., Merch&#225;n, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auditory+System.">Auditory System.</a> The Rat Nervous System. , 995-1080 (2004).</li><li>Delano, P. H., Elgoyhen, A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editorial:+Auditory+Efferent+System:+New+Insights+from+Cortex+to+Cochlea.">Editorial: Auditory Efferent System: New Insights from Cortex to Cochlea.</a> Front Syst Neurosci. 10, 1-2 (2016).</li><li>Dinse, H. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sound+Case+for+Enrichment.+Focus+on+"Environmental+Enrichment+Improves+Response+Strength,+Threshold,+Selectivity,+and+Latency+of+auditory+cortex+Neurons.".">Sound Case for Enrichment. Focus on "Environmental Enrichment Improves Response Strength, Threshold, Selectivity, and Latency of auditory cortex Neurons.".</a> J Neurophysiol. 92 (1), 36-37 (2004).</li><li>Polley, D. B., Heiser, M. A., Blake, D. T., Schreiner, C. E., Merzenich, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Associative+learning+shapes+the+neural+code+for+stimulus+magnitude+in+primary+auditory+cortex.">Associative learning shapes the neural code for stimulus magnitude in primary auditory cortex.</a> Proc Natl Acad Sci U S A. 101 (46), 16351-16356 (2004).</li><li>Kaur, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracortical+Pathways+Determine+Breadth+of+Subthreshold+Frequency+Receptive+Fields+in+Primary+auditory+cortex.">Intracortical Pathways Determine Breadth of Subthreshold Frequency Receptive Fields in Primary auditory cortex.</a> J Neurophysiol. 91 (6), 2551-2567 (2004).</li><li>Talwar, S. K., Musial, P. G., Gerstein, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+mammalian+auditory+cortex+in+the+perception+of+elementary+sound+properties.">Role of mammalian auditory cortex in the perception of elementary sound properties.</a> J Neurophysiol. 85 (6), 2350-2358 (2001).</li><li>Tan, A. Y. Y., Atencio, C. A., Polley, D. B., Merzenich, M. M., Schreiner, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unbalanced+synaptic+inhibition+can+create+intensity-tuned+auditory+cortex+neurons.">Unbalanced synaptic inhibition can create intensity-tuned auditory cortex neurons.</a> Neuroscience. 146 (1), 449-462 (2007).</li><li>Le&#243;n, A., Elgueda, D., Silva, M. A., Hamam&#233;, C. M., Delano, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auditory+cortex+basal+activity+modulates+cochlear+responses+in+chinchillas.">Auditory cortex basal activity modulates cochlear responses in chinchillas.</a> PLOS ONE. 7 (4), e36203 (2012).</li><li>Jager, K., Kossl, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Corticofugal+Modulation+of+DPOAEs+in+Gerbils.">Corticofugal Modulation of DPOAEs in Gerbils.</a> Hear Res. 332, 61-72 (2016).</li><li>Dragicevic, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Olivocochlear+Reflex+Strength+and+Cochlear+Sensitivity+are+Independently+Modulated+by+auditory+cortex+Microstimulation.">The Olivocochlear Reflex Strength and Cochlear Sensitivity are Independently Modulated by auditory cortex Microstimulation.</a> J Assoc Res Otolaryngol. 16 (2), 223-240 (2015).</li><li>Clarkson, C., Herrero-Turri&#243;n, M. J., Merch&#225;n, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cortical+Auditory+Deafferentation+Induces+Long-Term+Plasticity+in+the+Inferior+Colliculus+of+Adult+Rats:+Microarray+and+qPCR+Analysis.">Cortical Auditory Deafferentation Induces Long-Term Plasticity in the Inferior Colliculus of Adult Rats: Microarray and qPCR Analysis.</a> Front Neural Circuits. 6, 86 (2012).</li><li>Clarkson, C., Ju&#237;z, J. M., Merch&#769;an, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+regulation+in+calretinin+staining+in+the+rat+inferior+colliculus+after+unilateral+auditory+cortical+ablation.">Long-term regulation in calretinin staining in the rat inferior colliculus after unilateral auditory cortical ablation.</a> J Comp Neurol. 518, 4261-4276 (2010).</li><li>Clarkson, C., Ju&#237;z, J. M., Merch&#225;n, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+down-regulation+of+sound-induced+c-Fos+protein+expression+in+the+inferior+colliculus+after+ablation+of+the+auditory+cortex.">Transient down-regulation of sound-induced c-Fos protein expression in the inferior colliculus after ablation of the auditory cortex.</a> Front Neuroanat. 4, 141 (2010).</li><li>Hunter, K. P., Willott, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+bilateral+lesions+of+auditory+cortex+in+mice+on+the+acoustic+startle+response.">Effects of bilateral lesions of auditory cortex in mice on the acoustic startle response.</a> Physiol Behav. 54 (6), 1133-1139 (1993).</li><li>Lamas, V., Arevalo, J. C., Juiz, J. M., Merch&#225;n, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acoustic+input+and+efferent+activity+regulate+the+expression+of+molecules+involved+in+cochlear+micromechanics.">Acoustic input and efferent activity regulate the expression of molecules involved in cochlear micromechanics.</a> Front Syst Neurosci. 8, 253 (2014).</li><li>Lamas, V., Alvarado, J. C., Carro, J., Merch&#225;n, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+evolution+of+brainstem+electrical+evoked+responses+to+sound+after+restricted+ablation+of+the+auditory+cortex.">Long-term evolution of brainstem electrical evoked responses to sound after restricted ablation of the auditory cortex.</a> PLOS ONE. 8 (9), e73585 (2013).</li><li>Lamas, V., Juiz, J. M., Merch&#225;n, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ablation+of+the+auditory+cortex+results+in+changes+in+the+expression+of+neurotransmission-related+mRNAs+in+the+cochlea.">Ablation of the auditory cortex results in changes in the expression of neurotransmission-related mRNAs in the cochlea.</a> Hear Res. 346, 71-80 (2017).</li><li>Doron, N. N., Ledoux, J. E., Semple, M. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Redefining+the+tonotopic+core+of+rat+auditory+cortex:+physiological+evidence+for+a+posterior+field.">Redefining the tonotopic core of rat auditory cortex: physiological evidence for a posterior field.</a> J Comp Neurol. 453 (4), 345-360 (2002).</li><li>Polley, D. B., Read, H. L., Storace, D. a., Merzenich, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiparametric+auditory+receptive+field+organization+across+five+cortical+fields+in+the+albino+rat.">Multiparametric auditory receptive field organization across five cortical fields in the albino rat.</a> J Neurophysiol. 97 (5), 3621-3638 (2007).</li><li>Paxinos, G., Watson, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Rat Brain in Stereotaxic Coordinates. , (2005).</li><li>Gage, G. J., Kipke, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole+Animal+Perfusion+Fixation+for+Rodents.">Whole Animal Perfusion Fixation for Rodents.</a> J Vis Exp. (65), e3564 (2012).</li></ol>

Yazarlar araştırma potansiyel bir çatışması olarak yorumlanamaz herhangi bir ticari veya mali ilişkileri yokluğunda yapılmıştır bildirin.

Başarılı beyin ameliyatı iki faktöre dayanıyor: hayvan sırasında ve sonra yordamı yaşatmak ve doğru bir şekilde ilgi alanı bulunuyor. Fare (para çekme refleks testi) ameliyat sırasında derin anestezi ve yeterli analjezikler alır ve ototoksik olmayan antibiyotik hayatta kalma yardımcı olacaktır sağlanması. Ayrıca, hipotermi önlemek için anesteziden uyanır kadar fareyi bir Isıtma yastığı üzerinde tutulmalıdır. Dikiş enfeksiyona yatkınlık azalacak ve uygun tekniği önemlidir: hayvanlar onlar yeterince sıkı yaranın üzerine çok fazla gerilim koymadan önlemek için implante bu yüzden onların yara klibe seçin.
Doğru bir şekilde AC (veya herhangi bir diğer kortikal alanı) bulmak için bregma, lambda ve onları hedeflenen bölge sınırları hesaplamak için referans olarak kullanmak için interaural 0 konumunu belirlemek önemlidir. Koordinatları hesaplanmasında herhangi bir hata kısmi ablasyon AC veya diğer çevresinde istenmeyen aspirasyon neden olur. Böylece, iğne ucu, sadece interaural 0 kemikte dokunmatik ve bu protokol için açıklanan ne göre antero-posterior ve medio-lateral koordinatları tercüme etmek.
Bu makale, aynı zamanda nasıl cerrahi olarak ortaya çıkarmak ve AC ablate anlatmıştık. Üç kritik adım vardır: Delme işlemi, açılış ve meninkslerde ve aspirasyon tarafından ablasyon kaldırma. Yüksek Delme hızlı subcortical yapıları etkileyebilir ısı üretir gibi sondaj ile en düşük basınç, düşük bir hızda yapılmalıdır. Ancak, düşük hızlı Bakımı ve soğuk steril serum fizyolojik ile Delme alan soğutma herhangi bir zarar önlemek. Buna ek olarak, en düşük basınç ani break kafatası ve temel korteks için sonraki yaralanma önlemek için önemlidir. Açılış ve kaldırma AC kapak meninkslerde kan damarları bozulmaması için dikkatli bir şekilde yapılmalıdır. Kanama meydana gelirse, erken ve geç prognoz genellikle olumsuz ve böyle bir hayvan güvenilir bir çalışma dahil ölçütünü karşılayıp tartışmalıdır. Bu durumda ötenazi önerilir. Son olarak, aspirasyon (etkili bir lezyon gerçekleştirme muhtemelen en zor yönü), gri madde sınırlı olmalıdır. Beyaz madde olup olmadığını belirlemek yardımcı olabilir iki göstergeleri vardır: (1) bir beyaz madde olarak renk karşıtlığını değişimdir daha parlak gri cevherde; ve (2) Perfore arterler kanama bırakma.
Beyinde herhangi bir manipülasyon gerçekleştirmesinden sonra Yerelleştirme, boyutu ve uzantısı korteks hayvandan elde edilen veri doğrulama ve daha sonraki analiz için yapılan yordam değerlendirmek gereklidir. Bu makale, biz ayrıntılı nasıl daha önce bizim grup18tarafından açıklanan koordinat bir harita kullanarak kortekste gerçekleştirilen ablasyon yerelleştirmek için. Bu harita anatomik başvurular seri bölüm rekonstrüksiyonlar histolojik kesitler, sıçan beyin22Paxinos ve Watson'ın atlas ile ilişkili, elde kullanma inşa edilmiştir. Buna göre harita (A1) birincil ve ikincil cortices (sırt ve Ventral) AC arasında ayırır. Bu koordinat harita en büyük avantajı bu lezyon lokalizasyonu hızlı bir resim sagittal beyin dizey içinde yer beyin yanal yüzeyinden alınan superimposing tarafından sağlanmıştır. Anatomi daha az deneyimi olan laboratuvarlar için hayvan kendi modellerinin adapte tarafından harita kullanabilirsiniz başka bir avantajdır. Sadece bregma, lambda ve interaural 0 başvurular arasındaki mesafeleri periosteum denetim beyinde ayarlamak ve haritayı ölçeklendirmek gerekli olan yukarı ya da buna göre aşağı. Rhinal fissür beyin haritasını resmini ayarlamak için referans olarak kullanın. Beyin histolojik bölümlerde tespit edilmelidir böylece ablasyon derinliği bu koordinat haritada belirlenemiyor.
Stereotaksik yöntemlerin bileşimini AC cerrahi pozlama ile kolayca fareyi AC hedeflemesini isteyen herhangi bir araştırmacı tarafından adapte temel yöntem vardır. Bu Akut deneme veya implantasyon kalıcı cihazların gerektiren bir olabilir. Ayrıca, AC cerrahi ablasyon daha önce bir model olarak işitme kronik kortikal yoksunluk etkileri çalışma kullanılmaya başlanmıştır. AC ablations de tek taraflı AC ablations diğer kortikal alanlarda uygulamak veya kontur bir model olarak hizmet etkilerini incelemek için kullanılabilir. Böylece, burada açıklanan deneysel tasarımlar, ayrı ayrı veya birlikte çok çeşitli deneysel tasarımlar uygulanacak yararlı yöntemlerdir.

En sık kullanılan hayvan modellerinden birini işitsel nörolojik faredir. Davranışının sağlamlık denemeler günlük yüzlerce çalışmak mümkün yapar. Onun hassasiyeti ve işitme1,2ve diğer memeliler3için karşılaştırılabilir onun Merkezi sisteminin anatomik ve fonksiyonel organizasyon için spektral keskinliği fare çok çeşitli analiz etmek için uygun bir hayvan modeli olun işitsel nörolojik araştırma konuları. Sıçan işitsel korteks (AC), özellikle, kendi yapısı, organizasyonu ve ses işleme3rolü anlamaya çalıştık birçok anatomik ve fizyolojik araştırma konusu olmuştur. Günümüzde, AC nörologlar deneyim-bağımlılık plastisite, işitsel algı, alıcı alan kuruluş sinaptik temeli ve işitsel kortikal denetim subcortical ses işleme ilgi arasında popüler oldu çekirdeklerin4,5,6,7,8,9. Bu yeni yaklaşımlar poz sorunları ele almak üzere, doğru bir şekilde bulun ve cerrahi olarak AC maruz yordamlar araştırma çabalarına hızlandırmak. Stereotaksik teknikleri Fizyoloji testleri olmadan beyin içindeki belirli bölgeleri yerelleştirmek kolaylaştırır. Her ne kadar beyin boyutu biraz hayvanlar arasında değişir, herhangi bir beyin alanın konumunu yerler sıçan beyin kafatasında ayarla stereotaksik koordinatları kullanarak belirlenebilir.
AC kısıtlı ablasyon en doğrudan işitme ile ilgili korteksin duyusal bölgesinin cerrahi çıkartılmasıdır. Klima, soğutma veya yerel lidokain enjeksiyonu10,11,gibi12, kronik kaybı AC sonuçlarında işlevinin cerrahi ablasyon faaliyetleri engellemek için kullanılan bir diğer yöntem aksine. Böylece, AC ablations kortikal yoksunluğu uzun vadeli etkileri, hem de lezyon plastisite sonraki olayların eğitim için daha uygundur. Cerrahi ablations AC ile stereotaksik yöntemlerin bileşimini başarıyla kortikal denetim yoksunluğu13,14,15 fizyolojik, davranış ve moleküler etkilerini incelemek için kullanılmıştır ,16,17,18,19. Örneğin, bir fare modeli ile ikili AC ablations işitsel korkutmak refleks ve işitsel beyin sapı yanıt (ABR)16kortikal ablasyonun eğitim için kullanılmıştır. Son zamanlarda, o sıçan AC üretmek ABR eşikleri, genlikleri ve gecikme süreleri farklı zaman noktalarda ikili ablations karşı tek taraflı etkileri sonra yaralanma18karşılaştırıldığında var. Buna ek olarak, kısıtlayıcı AC ablasyon fare modeli da aşağı collicus13,14,15 ve iç kulak17 corticofugal yolu dejenerasyon etkisini incelemek için kullanılmıştır ,19. Böyle bir manipülasyon beyinde gerçekleştirildikten sonra Yerelleştirme, boyutu ve uzantısı korteks yapılan lezyonların değerlendirmek gereklidir. Çok yararlı olsa da, nöronal yanıt-e doğru20,21 tarihinde dayalı tonotopic haritalar ana sınırlandırılması sıçan beyninde işitsel alanları bulmak için gerekli Elektrofizyolojik teknikler vardır. Tüm laboratuar gerekli ekipman ve/veya uzmanlık böyle yapmaya beri AC cytoarchitectural sınırlarını transfer beynin yüzey18görüntüye dayalı bir koordinat harita inşa. Bu harita AC Fizyoloji testleri olmadan bulmak çok yararlı olabilir.
Mevcut iletişim kuralı stereotactically destekli konumu, cerrahi pozlama ve AC Sıçanlarda ablasyon yöntemi açıklanır. Ayrıca bizim koordinat harita18 lezyon uzantısı ablated beyin yüzeyine bir resmin üzerine kolayca yerelleştirmek için nasıl kullanılacağını açıklar.

<table>
	<tbody>
		<tr>
			<td>Stereotaxic frame</td>
			<td>David Kopf Ins.</td>
			<td>900</td>
			<td></td>
		</tr>
		<tr>
			<td>Surgical microscope</td>
			<td>WILD M650 Heerbrugg</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Heating pad</td>
			<td>DAGA</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Dental micromotor</td>
			<td>W&#38;H elco</td>
			<td>5118</td>
			<td></td>
		</tr>
		<tr>
			<td>Diamond burr</td>
			<td>B Braun</td>
			<td>GD021R</td>
			<td>0.6 mm</td>
		</tr>
		<tr>
			<td>Surgical suction device</td>
			<td>Atmos</td>
			<td>Atmoforte E2</td>
			<td></td>
		</tr>
		<tr>
			<td>Ketamine</td>
			<td>Merial</td>
			<td></td>
			<td>30 mg/kg</td>
		</tr>
		<tr>
			<td>Xylazine</td>
			<td>Bayer</td>
			<td></td>
			<td>5 mg/kg</td>
		</tr>
		<tr>
			<td>Micromanipulator</td>
			<td>Narishige</td>
			<td>SM-11</td>
			<td></td>
		</tr>
		<tr>
			<td>Scalpel</td>
			<td>Lawton</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Povidone iodine</td>
			<td>Meda</td>
			<td>Betadine</td>
			<td></td>
		</tr>
		<tr>
			<td>sterile saline serum</td>
			<td>B.Braun</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>20G sterile needle</td>
			<td>Terumo Neolus</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Cotton tips</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Suture material</td>
			<td>B.Braun</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Antibiotic Ointment</td>
			<td>Quadriderm (Betametasona, Gentamicina, Clotrimazol) - Schering-Plough</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Forceps</td>
			<td>dimeda</td>
			<td>10.331.12</td>
			<td></td>
		</tr>
		<tr>
			<td>Surgical needles</td>
			<td>World Precision Instruments</td>
			<td>501940</td>
			<td></td>
		</tr>
		<tr>
			<td>Buprenorphine</td>
			<td>Indivior UK</td>
			<td>Buprex</td>
			<td>0.01-0.05 mg/kg</td>
		</tr>
		<tr>
			<td>Scissor</td>
			<td>dimeda</td>
			<td>08.120.15</td>
			<td></td>
		</tr>
		<tr>
			<td>Spencer scissor</td>
			<td>dimeda</td>
			<td>08.804.14</td>
			<td></td>
		</tr>
		<tr>
			<td>Rongeurs</td>
			<td>Lawton</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microsurgical knife</td>
			<td>MSP</td>
			<td>7503</td>
			<td></td>
		</tr>
		<tr>
			<td>Absorbable hemostatic gauze</td>
			<td>Surgicel</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Saggital rat Brain Matrix</td>
			<td>Activational systems Inc.</td>
			<td>RBM-1000DV / RBM 4000C</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium pentobarbital</td>
			<td>Vetoquinol</td>
			<td></td>
			<td>0.1 mL</td>
		</tr>
		<tr>
			<td>Camera</td>
			<td>Olympus 5.1 MP</td>
			<td>C-5060 wide zoom</td>
			<td>lens F2.8-4.8</td>
		</tr>
		<tr>
			<td>Wound clips</td>
			<td>Reflex 9</td>
			<td></td>
			<td>9 mm</td>
		</tr>
		<tr>
			<td>Canvas 12</td>
			<td>ACD Systems</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>needle gauge</td>
			<td></td>
			<td></td>
			<td>diameter 1.8 mm</td>
		</tr>
		<tr>
			<td>Separatory funnel</td>
			<td>labbox</td>
			<td>11409</td>
			<td>500 mL</td>
		</tr>
		<tr>
			<td>GluA2 primer Forward</td>
			<td>GeneBank</td>
			<td>NM_017261</td>
			<td>CGGCAGCTCAGCTAAAAACT</td>
		</tr>
		<tr>
			<td>GluA2 primer Reverse</td>
			<td>GeneBank</td>
			<td>NM_017261</td>
			<td>TTGTAGCTGGTGGCTGTTGA</td>
		</tr>
		<tr>
			<td>GluA3 primer Forward</td>
			<td>GeneBank</td>
			<td>NM_032990</td>
			<td>ATTGCTGATGGTGCAATGAC</td>
		</tr>
		<tr>
			<td>GluA3 primer Reverse</td>
			<td>GeneBank</td>
			<td>NM_032990</td>
			<td>TTTGCATTGTCGCAAGTCTC</td>
		</tr>
	</tbody>
</table>

stereotactically-guided ablation of the rat auditory cortex, and localization of the lesion in the brain

Sıçan işitsel korteks (AC) deneyimi-bağımlılık plastisite, işitsel algısal süreçleri ve kortikal subcortical işitsel çekirdeklerin işleme ses kontrolünü ilgilenen işitsel nörolojik müfettişler arasında popüler hale gelmektedir. Yeni adres, zorlukları doğru bir şekilde bulmak için bir yordam ve cerrahi olarak maruz işitsel korteks bu araştırma çaba hızlandırmak. Stereotaktik Beyin Cerrahisi, bir iğne veya elektrot işitsel korteks içinde önceden tanımlanmış bir yerde engraft için rutin olarak önceden klinik araştırma hayvan modellerinde kullanılır. Aşağıdaki iletişim kuralında, roman bir şekilde stereotaksik yöntemleri kullanın. Biz bir kez açıldı, İlköğretim (A1) hem doğru bir şekilde ortaya çıkaran bir pencere tanımlamak için fareyi temporal bone ve ikincil (Dorsal ve Ventral) cortices AC. kullanma bu yöntem yüzey üzerinde dört koordinat noktalarını belirlemek, sonra bir cerrahi gerçekleştiriyoruz ablasyon AC. Böyle bir manipülasyon gerçekleştirildikten sonra Yerelleştirme, boyutu ve uzantısı korteks yapılan lezyonların değerlendirmek gereklidir. Böylece, aynı zamanda kolayca beyin yüzeyine AC cytoarchitectural sınırlarını aktararak inşa bir koordinat harita kullanarak AC ablasyon öldükten sonra bulmak için bir yöntem açıklanmaktadır. Stereotactically destekli konum ve bir koordinat harita öldükten sonra yaralı alanında lokalizasyonu ile AC ablasyon kombinasyonu hayvandan elde ettiği bilgileri doğrulama kolaylaştırır ve daha iyi bir analiz için yol açar ve Anlama veri.

Üç Wistar Rat stereotactically destekli konumu, cerrahi pozlama ve AC tek taraflı ablasyon gerçekleştirilen. Lezyon lokalizasyonu ablations 3 arasında gerçekleştirilen doğruladı sıçan AC (birincil, dorsal ve ventral cortices) büyük alt bölümleri işgal ve 80-%100 toplam AC alanının (şekil 2B) bir dizi oluşur.
Kısıtlayıcı AC ablations gerçekleştirmek için burada açıklanan protokol daha önce bizim laboratuvarda kortikal denetim yoksunluk subcortical işitsel çekirdekleri içinde uzun vadeli etkileri yanı sıra plastisite sonraki olayları incelemek için kullanılmıştır. Bu çalışmalarda, fizyolojik (ABR), uygulayarak AC ablations Protokolü doğrulandı davranış (yanıt-e doğru ürkütmek, prepulse inhibisyon; ÜFE) ve moleküler (DNA microarrays, qPCR ve Western Blot) yöntemleri13,14,15,16,17,18,19. Burada, bizim iletişim kuralı etkinliğini göstermek için biz bir hafta boyunca hayatta üç ablated AC fareler ve izin için toplanan cochleae doku toplama sırasında adım en uygun AMPA alt birimleri yetişkin koklea içinde mevcut ifade değişiklikleri çalışma , GluA2 ve qPCR tarafından GluA3. AC gelen transkript arasında karşılaştırma fareler ablated ve sahte denetim hayvanlar tüm cerrahi işlemi, ancak değil kortikal ablasyon yapılacağı yeri aşağı-Yönetmeliğin GluA2 ve bir yukarı-yönetmelik için GluA3 için her iki cochleae (şekil 3) gösterdi , hangi olduğunu bizim önceki anlaşarak çalışma19.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56429/56429fig1.jpg"> 
Şekil 1: üç farklı cerrahi adım sıçan temporal kemikte görüntülerini. (A)transferi AC stereotaksik koordinatlarını temporal kemik. Dört puan Koordinatlar: A: A/P =-5.8 mm, M/M = 6,4 mm + /; B: A/P =-2.7 mm, M/M = 6,4 mm + /; C: A/P =-2.7 mm, M/M = +/-8.67 mm; D: A/P =-5.8 mm, M/M +/-8.67 mm koordinatları bir pencere açılması rehberlik edecek temporal kemik yüzeyine bir dikdörtgen çizmek için bir başvuru olarak kullanılır. (B) =. Sondaj sonra kemik pencere açtı (C) gösterir. Kan damarları ile meninkslerde beyin yüzeyinde görülebilmektedir. R: rostral, D: dorsal. <a href="http://ecsource.jove.com/files/ftp_upload/56429/56429fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56429/56429fig2.jpg"> 
Şekil 2: sıçan beyin lezyonlar bulmak için yordam. (A)bir ablated AC beyin Lambda ve Bregma stereotactically implante iğneler (göre Paxinos ve Watson'ın koordinatları19) ile dorsal yüzeyi fotoğrafı. Noktalı çizgiler olduğu gibi beyin dorsal yüzeyi Bregma ve Interaural 0 9 cm x 9 cm kılavuz konumunu işaretleyin. (B) AC koordinat Haritası üst üste ablated beyin yanal yüzeyinin fotoğrafı. Lezyon çevre resimdeki kırmızı etiketli. AC alanı çevresine siyah harita etiketlenir. Bu örnekte, %84.79 AC ablasyon ile ilgili Toplam alan AC tarafından işgal yüzdesidir. AC: işitsel korteks, IA: işitsel, Inter FR: Rhinal çatlak. <a href="http://ecsource.jove.com/files/ftp_upload/56429/56429fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56429/56429fig3.jpg"> 
Şekil 3: değişiklikleri AMPA reseptör alt birimleri GluA2 ve GluA3 tek taraflı AC ablations 7 gün sonrası lezyon sonra düzeyde mRNA. Sonuçlar kat değişim ortalama ± standart sapma sunulur. GluA2 transkript için değişiklikler mavi renkle gösterilir. GluA3 transkript için değişiklikler kırmızıyla sunulmaktadır. Her iki cochleae GluA2 önemli bir azalma ve GluA3 bir artış görülmektedir (ipsi - ve ablasyon kontralateral) sham denetimleri ile 7 gün sonra ameliyat; kortikal yok ablations göre bizim önceki sonuçları19ile anlaşma bu. <a href="http://ecsource.jove.com/files/ftp_upload/56429/56429fig3large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>

Watch this Scientific Journal Video about Stereotactically-guided Ablation of the Rat Auditory Cortex, and Localization of the Lesion in the Brain at JoVE.com

Stereotactically-guided Ablation of the Rat Auditory Cortex, and Localization of the Lesion in the Brain

Stereotactically destekli ablasyon sıçan işitsel korteks ve beyin lezyon lokalizasyonu

Biz stereotactically güdümlü konumunu, pozlama ve ablasyon Sıçanlarda işitsel korteks için bir yöntem açıklanmaktadır. Ablasyon lokalizasyonu koordinat harita otopsi kullanarak değerlendirilir.

The rat auditory cortex (AC) is becoming popular among auditory neuroscience investigators who are interested in experience-dependence plasticity, ...

stereotactically-guided-ablation-rat-auditory-cortex-localization

Research

JoVE Journal

Behavior

11.5K Görüntüleme.  University of Salamanca. Biz stereotactically güdümlü konumunu, pozlama ve ablasyon Sıçanlarda işitsel korteks için bir yöntem açıklanmaktadır. Ablasyon lokalizasyonu koordinat harita otopsi kullanarak değerlendirilir.

Video: Stereotactically-guided Ablation of the Rat Auditory Cortex, and Localization of the Lesion in the Brain

Stereotactic Injection of MicroRNA-expressing Lentiviruses to the Mouse Hippocampus CA1 Region and Assessment of the Behavioral Outcome

MicroRNAs (miRNAs) are small regulatory single-stranded RNA molecules around 22 nucleotides long that may each target numerous mRNA transcripts and dim an entire gene expression pathway by inducing destruction and/or inhibiting translation of these targets. Several miRNAs play key roles in maintaining neuronal structure and function and in higher-level brain functions, and methods are sought for manipulating their levels for exploring these functions. Here, we present a direct in vivo method for examining the cognitive consequences of enforced miRNAs excess in mice by stereotactic injection of miRNA-encoding virus particles. Specifically, the current protocol involves injection into the hippocampal CA1 region, which contributes to mammalian memory consolidation, learning, and stress responses, and offers a convenient injection site. The coordinates are measured according to the mouse bregma and virus perfusion is digitally controlled and kept very slow. After injection, the surgery wound is sealed and the animals recover. Lentiviruses encoding silencers of the corresponding mRNA targets serve to implicate the specific miRNA/target interaction responsible for the observed effect, with na&iuml;ve mice, mice injected with saline and mice injected with "empty" lentivirus vectors as controls. One month post-injection, the animals are examined in the Morris Water Maze (MWM) for assessing their navigation learning and memory abilities. The MWM is a round tank filled with colored water with a small platform submerged 1 cm below the water surface. Steady visual cues around the tank allow for spatial navigation (sound and the earth's magnetic field may also assist the animals in navigating). Video camera monitoring enables measuring the route of swim and the time to find and amount the platform. The mouse is first taught that mounting the hidden platform offers an escape from the enforced swimming; it is then tested for using this escape and finally, the platform is removed and probe tests examine if the mouse remembers its previous location. Repeated tests over several consecutive days highlight improved performance of tested mice at shorter latencies to find and mount the platform, and as more direct routes to reach the platform or its location. Failure to show such improvement represents impaired learning and memory and/or anxiety, which may then be tested specifically (e.g. in the elevated plus maze). This approach enables validation of specific miRNAs and target transcripts in the studied cognitive and/or stress-related processes.

MicroRNAs have significant roles in brain structure and function. Here we describe a method to enforce hippocampal miRNA over-expression using stereotactic injection of an engineered miRNA-expressing lentivirus. This approach can serve as a relatively rapid way to assess the in vivo effects of over-expressed miRNAs in specific brain regions.

Bir Stereotaktik Enjeksiyon MicroRNA-ifade Fare Hippocampus CA1 Bölgesi Lentiviruses ve Davranış Sonuç Değerlendirilmesi

MicroRNAs (miRNAs) are small regulatory single-stranded RNA molecules around 22 nucleotides long that may each target numerous mRNA transcripts and dim an ...

Davranış

Comprehensive Analysis of Transcription Dynamics from Brain Samples Following Behavioral Experience

The encoding of experiences in the brain and the consolidation of long-term memories depend on gene transcription. Identifying the function of specific genes in encoding experience is one of the main objectives of molecular neuroscience. Furthermore, the functional association of defined genes with specific behaviors has implications for understanding the basis of neuropsychiatric disorders. Induction of robust transcription programs has been observed in the brains of mice following various behavioral manipulations. While some genetic elements are utilized recurrently following different behavioral manipulations and in different brain nuclei, transcriptional programs are overall unique to the inducing stimuli and the structure in which they are studied1,2.
In this publication, a protocol is described for robust and comprehensive transcriptional profiling from brain nuclei of mice in response to behavioral manipulation. The protocol is demonstrated in the context of analysis of gene expression dynamics in the nucleus accumbens following acute cocaine experience. Subsequent to a defined in vivo experience, the target neural tissue is dissected; followed by RNA purification, reverse transcription and utilization of microfluidic arrays for comprehensive qPCR analysis of multiple target genes. This protocol is geared towards comprehensive analysis (addressing 50-500 genes) of limiting quantities of starting material, such as small brain samples or even single cells.
The protocol is most advantageous for parallel analysis of multiple samples (e.g. single cells, dynamic analysis following pharmaceutical, viral or behavioral perturbations). However, the protocol could also serve for the characterization and quality assurance of samples prior to whole-genome studies by microarrays or RNAseq, as well as validation of data obtained from whole-genome studies.

This manuscript describes a protocol that applies comprehensive profiling for analysis of transcriptional programs induced in specific brain nuclei of rodents following behavioral paradigms. Herein, this approach is illustrated in the context of profiling genes induced in the nucleus accumbens (NAc) of mice following acute cocaine exposure, utilizing microfluidic qPCR arrays.

Davranış Deneyim ardından Beyin Örneklerden Deşifre Dynamics Kapsamlı Analizi

The encoding of experiences in the brain and the consolidation of long-term memories depend on gene transcription. Identifying the function of specific ...

Infant Auditory Processing and Event-related Brain Oscillations

Rapid auditory processing and acoustic change detection abilities play a critical role in allowing human infants to efficiently process the fine spectral and temporal changes that are characteristic of human language. These abilities lay the foundation for effective language acquisition; allowing infants to hone in on the sounds of their native language. Invasive procedures in animals and scalp-recorded potentials from human adults suggest that simultaneous, rhythmic activity (oscillations) between and within brain regions are fundamental to sensory development; determining the resolution with which incoming stimuli are parsed. At this time, little is known about oscillatory dynamics in human infant development. However, animal neurophysiology and adult EEG data provide the basis for a strong hypothesis that rapid auditory processing in infants is mediated by oscillatory synchrony in discrete frequency bands. In order to investigate this, 128-channel, high-density EEG responses of 4-month old infants to frequency change in tone pairs, presented in two rate conditions (Rapid: 70 msec ISI and Control: 300 msec ISI) were examined. To determine the frequency band and magnitude of activity, auditory evoked response averages were first co-registered with age-appropriate brain templates. Next, the principal components of the response were identified and localized using a two-dipole model of brain activity. Single-trial analysis of oscillatory power showed a robust index of frequency change processing in bursts of Theta band (3 - 8 Hz) activity in both right and left auditory cortices, with left activation more prominent in the Rapid condition. These methods have produced data that are not only some of the first reported evoked oscillations analyses in infants, but are also, importantly, the product of a well-established method of recording and analyzing clean, meticulously collected, infant EEG and ERPs. In this article, we describe our method for infant EEG net application, recording, dynamic brain response analysis, and representative results.

High-density electroencephalography (dEEG) is being used increasingly to study brain development and plasticity in the early years of life. Here we present an application of sophisticated analysis techniques that builds on traditional EEG recording to understand the oscillatory dynamics of rapid auditory processing in the infant brain.

Bebek İşitsel İşleme ve Olaya ilişkin Beyin Salınımlılığı

Rapid auditory processing and acoustic change detection abilities play a critical role in allowing human infants to efficiently process the fine spectral ...

The Modified Hole Board - Measuring Behavior, Cognition and Social Interaction in Mice and Rats

This protocol describes the modified hole board (mHB), which combines features from a traditional hole board and open field and is designed to measure multiple dimensions of unconditioned behavior in small laboratory mammals (e.g., mice, rats, tree shrews and small primates). This paradigm is a valuable alternative for the use of a behavioral test battery, since a broad behavioral spectrum of an animal&#8217;s behavioral profile can be investigated in one single test.
The apparatus consists of a box, representing the &#8216;protected&#8217; area, separated from a group compartment. A board, on which small cylinders are staggered in three lines, is placed in the center of the box, representing the &#8216;unprotected&#8217; area of the set-up. The cognitive abilities of the animals can be measured by baiting some cylinders on the board and measuring the working and reference memory. Other unconditioned behavior, such as activity-related-, anxiety-related- and social behavior, can be observed using this paradigm. Behavioral flexibility and the ability to habituate to a novel environment can additionally be observed by subjecting the animals to multiple trials in the mHB, revealing insight into the animals&#8217; adaptive capacities.
Due to testing order effects in a behavioral test battery, na&#239;ve animals should be used for each individual experiment. By testing multiple behavioral dimensions in a single paradigm and thereby circumventing this issue, the number of experimental animals used is reduced. Furthermore, by avoiding social isolation during testing and without the need to food deprive the animals, the mHB represents a behavioral test system, inducing if any, very low amount of stress.

This protocol describes the modified hole board, which is a behavioral test set-up that comprises the characteristics of an open field and a traditional hole board. This set-up enables the differential analysis of unconditioned behavior of small laboratory mammals as well as the analysis of cognitive abilities.

Modifiye Delik Kurulu - Fareler ve Sıçanlarda Davranışı, Biliş ve Sosyal Etkileşim Ölçme

This protocol describes the modified hole board (mHB), which combines features from a traditional hole board and open field and is designed to measure ...

Vagus Nerve Stimulation as a Tool to Induce Plasticity in Pathways Relevant for Extinction Learning

Extinction describes the process of attenuating behavioral responses to neutral stimuli when they no longer provide the reinforcement that has been maintaining the behavior. There is close correspondence between fear and human anxiety, and therefore studies of extinction learning might provide insight into the biological nature of anxiety-related disorders such as post-traumatic stress disorder, and they might help to develop strategies to treat them. Preclinical research aims to aid extinction learning and to induce targeted plasticity in extinction circuits to consolidate the newly formed memory. Vagus nerve stimulation (VNS) is a powerful approach that provides tight temporal and circuit-specific release of neurotransmitters, resulting in modulation of neuronal networks engaged in an ongoing task. VNS enhances memory consolidation in both rats and humans, and pairing VNS with exposure to conditioned cues enhances the consolidation of extinction learning in rats. Here, we provide a detailed protocol for the preparation of custom-made parts and the surgical procedures required for VNS in rats. Using this protocol we show how VNS can facilitate the extinction of conditioned fear responses in an auditory fear conditioning task. In addition, we provide evidence that VNS modulates synaptic plasticity in the pathway between the infralimbic (IL) medial prefrontal cortex and the basolateral complex of the amygdala (BLA), which is involved in the expression and modulation of extinction memory.

Vagus nerve stimulation (VNS) has emerged as a tool to induce targeted synaptic plasticity in the forebrain to modify a range of behaviors. This protocol describes how to implement VNS to facilitate the consolidation of fear extinction memory.

Aracı Olarak vagus sinir stimülasyonu Extinction Öğrenme İlgili Pathways Plastisitesi tetikleyebilecek

Extinction describes the process of attenuating behavioral responses to neutral stimuli when they no longer provide the reinforcement that has been ...

Repetitive Transcranial Magnetic Stimulation to the Unilateral Hemisphere of Rat Brain

Previous rodent models of repetitive transcranial magnetic stimulation (rTMS) adopted whole-brain stimulation instead of unilateral hemispheric rTMS, which is unlike the protocols used for human subjects. We report a successful application of rTMS to the unilateral hemisphere of rat brain. The rTMS was delivered with a low-frequency (1 Hz), high-frequency (20 Hz), or sham stimulation protocol to one side of the brain by using a small 25-mm figure-8 coil. We placed the center of the coil 1 cm lateral to the vertex on the biauricular line and angulated the coil 45&#176; to the ground to minimize a potential direct effect of rTMS on the contralateral cortex. We also used an in-house water cooling system to enable repetitive magnetic stimulation for more than 20 min, even at a 20-Hz stimulation frequency. Increases in the transcriptions of immediate early genes (Arc, Junb, and Egr2) were greater after rTMS than after sham stimulation. After 5 consecutive days of 20-min 1-Hz rTMS, bdnf mRNA expression was significantly higher in stimulated cortex than in contralateral side. The model presented herein will elucidate the molecular mechanisms of rTMS by allowing analysis of the inter-hemispheric difference in its effect.

We applied repetitive transcranial magnetic stimulation (rTMS) to the unilateral hemisphere of rat brain, by placing a 25-mm figure-8 coil 1 cm lateral to the vertex on the biauricular line and angulating the coil by 45&#176;. An in-house water cooling system was used for rTMS for more than 20 min.

Sıçan Beyin Tek Taraflı Yarımküre için Transkraniyal Manyetik Uyarım

Previous rodent models of repetitive transcranial magnetic stimulation (rTMS) adopted whole-brain stimulation instead of unilateral hemispheric rTMS, ...

Using Eye Movements Recorded in the Visual World Paradigm to Explore the Online Processing of Spoken Language

In a typical eye tracking study using the visual world paradigm, participants' eye movements to objects or pictures in the visual workspace are recorded via an eye tracker as the participant produces or comprehends a spoken language describing the concurrent visual world. This paradigm has high versatility, as it can be used in a wide range of populations, including those who cannot read and/or who cannot overtly give their behavioral responses, such as preliterate children, elderly adults, and patients. More importantly, the paradigm is extremely sensitive to fine grained manipulations of the speech signal, and it can be used to study the online processing of most topics in language comprehension at multiple levels, such as the fine grained acoustic phonetic features, the properties of words, and the linguistic structures. The protocol described in this article illustrates how a typical visual world eye tracking study is conducted, with an example showing how the online processing of some semantically complex statements can be explored with the visual world paradigm.

The visual world paradigm monitors participants' eye movements in the visual workspace as they are listening to or speaking a spoken language. This paradigm can be used to investigate the online processing of a wide range of psycholinguistic questions, including semantically complex statements, such as disjunctive statements.

Konuşulan dil çevrimiçi işlenmesi keşfetmek için görsel dünya paradigmada kaydedilen göz hareketleri kullanarak

In a typical eye tracking study using the visual world paradigm, participants' eye movements to objects or pictures in the visual workspace are recorded ...

An Instrumented Pull Test to Characterize Postural Responses

Impairment of postural reflexes, termed postural instability, is a common and disabling deficit in Parkinson's disease. To assess postural reflexes, clinicians typically employ the pull test to grade corrective responses to a backward perturbation at the shoulders. However, the pull test is prone to issues with reliability and scaling (score/4). Here, we present an instrumented version of the pull test to more precisely quantify postural responses. Akin to the clinical test, pulls are manually administered except pull force is also recorded. Displacements of the trunk and feet are captured by a semi-portable motion tracking system. Raw data represent distance traveled (in millimeter units), making subsequent interpretation and analysis intuitive. The instrumented pull test also detects variabilities influencing pull test administration, such as pull force, thereby identifying and quantifying potential confounds that can be accounted for by statistical techniques. The instrumented pull test could have application in studies seeking to capture early abnormalities in postural responses, track postural instability over time, and detect responses to therapy.

Impairment of postural reflexes, termed postural instability, is difficult to quantify. Clinical assessments such as the pull test suffer issues with reliability and scaling. Here, we present an instrumented version of the pull test to objectively characterize postural responses.

Postural yanıt-e doğru tanımlamak için bir Araçlı çekme testi

Impairment of postural reflexes, termed postural instability, is a common and disabling deficit in Parkinson's disease. To assess postural reflexes, ...

Transcranial Direct Current Stimulation for Online Gamers

Transcranial direct current stimulation (tDCS) is a noninvasive brain stimulation technique that applies a weak electric current to the scalp to modulate neuronal membrane potentials. Compared to other brain stimulation methods, tDCS is relatively safe, simple, and inexpensive to administer.
Since excessive online gaming can negatively affect mental health and daily functioning, developing treatment options for gamers is necessary. Although tDCS over the dorsolateral prefrontal cortex (DLPFC) has demonstrated promising results for various addictions, it has not been tested in gamers. This paper describes a protocol and a feasibility study for applying repeated tDCS over the DLPFC and neuroimaging to examine the underlying neural correlates in gamers.
At baseline, individuals who play online games report average weekly hours spent on games, complete questionnaires on addiction symptoms and self-control, and undergo brain 18F-&#64258;uoro-2-deoxyglucose positron emission tomography (FDG-PET). The tDCS protocol consists of 12 sessions over the DLPFC for 4 weeks (anode F3/cathode F4, 2 mA for 30 min per session). Then, a follow-up is conducted using the same protocol as the baseline. Individuals who do not play online games receive only baseline FDG-PET scans without tDCS. Changes of clinical characteristics and asymmetry of regional cerebral metabolic rate of glucose (rCMRglu) in the DLPFC are examined in gamers. In addition, asymmetry of rCMRglu is compared between gamers and non-gamers at baseline.
In our experiment, 15 gamers received tDCS sessions and completed baseline and follow-up scans. Ten non-gamers underwent FDG-PET scans at the baseline. The tDCS reduced addiction symptoms, time spent on games, and increased self-control. Moreover, abnormal asymmetry of rCMRglu in the DLPFC at baseline was alleviated after tDCS.
The current protocol may be useful for assessing treatment efficacy of tDCS and its underlying brain changes in gamers. Further randomized sham-controlled studies are warranted. Moreover, the protocol can be applied to other neurological and psychiatric disorders.

We present a protocol and a feasibility study for applying transcranial direct current stimulation (tDCS) and neuroimaging assessment in online gamers.

Transkraniyal Doğrudan Akım Stimülasyonu Online Oyuncular için

Transcranial direct current stimulation (tDCS) is a noninvasive brain stimulation technique that applies a weak electric current to the scalp to modulate ...

Assessing the Coherence of Parents' Short Narratives Regarding their Child Using the Five-Minute Speech Sample Procedure

Valid and efficient measures for assessing the quality of parent-child relationships are needed to facilitate research and evidence-based practice with parents. This paper focuses on such a method, namely Five-Minute Speech Sample-Coherence (FMSS-Coherence). In this method, a parent is asked to speak for five uninterrupted minutes about her/his child and their relationship. The resulted narrative is coded for coherence, namely the extent to which the parent provides&#160;in the narrative&#160;a clear, consistent, multidimensional and well-supported portrayal of the child. FMSS-Coherence is based on attachment research that shows that the coherence of parents&#8217; narratives is indicative of the quality of the parent-child relationship and child adjustment. It overcomes the limitations of attachment narrative measures which are typically labor intensive. FMSS-Coherence is less nuanced than extant attachment narrative measures. Yet, studies of families from different cultural backgrounds, across different child ages and in the context of typically developing children as well as children with special needs suggest that coherence can be reliably evaluated using the FMSS procedure. Furthermore, parents&#8217; FMSS-Coherence is associated with parenting quality and children&#8217;s socio-emotional adjustment. Thus, it holds promise for researchers and practitioners who seek a relatively time- and cost-effective method for assessing the coherence of parents&#8217; narratives regarding their child.

This paper introduces a method for assessing the coherence of parents' short narratives regarding their child and their relationship using the five-minute speech sample procedure.

Beş Dakikalık Konuşma Örnek Prosedürü Kullanarak Ebeveynlerin ÇocuklarıYla İlgili Kısa Anlatımlarının Tutarlılığının Değerlendirilmesi

Valid and efficient measures for assessing the quality of parent-child relationships are needed to facilitate research and evidence-based practice with ...