This work was supported by &#34;Fondazione Varrone&#34; and Rieti University Hub &#34;Sabina Universitas&#34; to Vincenzo Mattei.
Figure 5 (A, B) reprinted by permission of the publisher Taylor &#38; Francis Ltd from: Role of Prion protein-EGFR multimolecular complex during neuronal differentiation of human dental pulp-derived stem cells. Martellucci, S., Manganelli V., Santacroce C., Santilli F., Piccoli L., Sorice M., Mattei V. Prion. 2018 Mar 4. Taylor &#38; Francis Ltd.

Third molars used in the study were excised from patients (13-19 years old) with no prior history of drug or alcohol consumption, all non-smoking and with appropriate oral hygiene. On the day of explanation, at the Department of Science Dentistry and Maxillofacial of &#34;Sapienza&#34; University of Rome, informed consent was obtained from the patients or the parents. Informed consent was obtained based on ethical considerations and approval of the ethics committee.
1. Tooth and Dental Pulp Extr...

<ol>
	<li>Robey, P. G., Kuznetsov, S. A., Riminucci, M., Bianco, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+marrow+stromal+cell+assays:+in+vitro+and+in+vivo.">Bone marrow stromal cell assays: in vitro and in vivo.</a> Methods in Molecular Biology. 1130, 279-293 (2014).</li><li>Jiang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pluripotency+of+mesenchymal+stem+cells+derived+from+adult+marrow.">Pluripotency of mesenchymal stem cells derived from adult marrow.</a> Nature. 418, 1-49 (2002).</li><li>Kern, S., Eichler, H., Stoeve, J., Kluter, H., Bieback, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+mesenchymal+stem+cells+from+bone+marrow,+umbilical+cord+blood,+or+adipose+tissue.">Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue.</a> Stem Cells. 24, 1294-1301 (2006).</li><li>Zannettino, A. C. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multi-potential+Human+adipose-derived+stromal+stem+cells+exhibit+a+perivascular+phenotype+in+vitro+and+in+vivo.">Multi-potential Human adipose-derived stromal stem cells exhibit a perivascular phenotype in vitro and in vivo.</a> Journal of Cellular Physiology. 214, 413-421 (2008).</li><li>Mattei, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+lipid+rafts+in+neuronal+differentiation+of+dental+pulp-derived+stem+cells.">Role of lipid rafts in neuronal differentiation of dental pulp-derived stem cells.</a> Experimental Cell Research. 339, 231-240 (2015).</li><li>Jansen, J., Hanks, S., Thompson, J. M., Dugan, M. J., Akard, L. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transplantation+of+hematopoietic+stem+cells+from+the+peripheral+blood.">Transplantation of hematopoietic stem cells from the peripheral blood.</a> Journal of Cellular and Molecular Medicine. 9 (1), 37-50 (2005).</li><li>Young, F. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clonal+heterogeneity+in+the+neuronal+and+glial+differentiation+of+dental+pulp+stem/progenitor+cells.">Clonal heterogeneity in the neuronal and glial differentiation of dental pulp stem/progenitor cells.</a> Stem Cells International. 2016, 1290561 (2016).</li><li>Pisciotta, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+dental+pulp+stem+cells+(hDPSCs):+isolation,+enrichment+and+comparative+differentiation+of+two+sub-populations.">Human dental pulp stem cells (hDPSCs): isolation, enrichment and comparative differentiation of two sub-populations.</a> BMC Developmental Biology. 15, 14 (2015).</li><li>Atari, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dental+pulp+of+the+third+molar:+a+new+source+of+pluripotent-like+stem+cells.">Dental pulp of the third molar: a new source of pluripotent-like stem cells.</a> Journal of Cell Science. 125, 3343-3356 (2012).</li><li>Koyama, N., Okubo, Y., Nakao, K., Bessho, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+pluripotency+in+human+dental+pulp+cells.">Evaluation of pluripotency in human dental pulp cells.</a> Journal of oral and maxillofacial surgery: official journal of the American Association of Oral and Maxillofacial Surgeons. 67, 501-506 (2009).</li><li>Gronthos, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+cell+properties+of+human+dental+pulp+stem+cells.">Stem cell properties of human dental pulp stem cells.</a> Journal of Dental Research. 81, 531-535 (2002).</li><li>Arthur, A., Rychkov, G., Shi, S., Koblar, S. A., Gronthos, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adult+human+dental+pulp+stem+cells+differentiate+toward+functionally+active+neurons+under+appropriate+environmental+cues.">Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues.</a> Stem Cells. 7, 1787-1795 (2008).</li><li>Lee, Y. J., Baskakov, I. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cellular+form+of+the+prion+protein+is+involved+in+controlling+cell+cycle+dynamics,+self-renewal,+and+the+fate+of+human+embryonic+stem+cell+differentiation.">The cellular form of the prion protein is involved in controlling cell cycle dynamics, self-renewal, and the fate of human embryonic stem cell differentiation.</a> Journal of Neurochemistry. 124, 310-322 (2013).</li><li>Steele, A. D., Emsley, J. G., Ozdinler, P. H., Lindquist, S., Macklis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prion+protein+(PrPc)+positively+regulates+neural+precursor+proliferation+during+developmental+and+adult+mammalian+neurogenesis.">Prion protein (PrPc) positively regulates neural precursor proliferation during developmental and adult mammalian neurogenesis.</a> Proceedings of the National Academy of Sciences of the United States of America. 103, 3416-3421 (2006).</li><li>Wulf, M. A., Senatore, A., Aguzzi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biological+function+of+the+cellular+prion+protein:+an+update.">The biological function of the cellular prion protein: an update.</a> BMC Biology. 15, 34 (2017).</li><li>Mattei, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recruitment+of+cellular+prion+protein+to+mitochondrial+raft-like+microdomains+contributes+to+apoptosis+execution.">Recruitment of cellular prion protein to mitochondrial raft-like microdomains contributes to apoptosis execution.</a> Molecular Biology of the Cell. 22, 4842-4853 (2011).</li><li>Linden, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Biological+Function+of+the+Prion+Protein:+A+Cell+Surface+Scaffold+of+Signaling+Modules.">The Biological Function of the Prion Protein: A Cell Surface Scaffold of Signaling Modules.</a> Frontiers in Molecular Neuroscience. 10, 77 (2017).</li><li>Garofalo, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+mitochondrial+raft-like+microdomains+in+the+regulation+of+cell+apoptosis.">Role of mitochondrial raft-like microdomains in the regulation of cell apoptosis.</a> Apoptosis. , 621-634 (2015).</li><li>Watt, N. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reactive+oxygen+species-mediated+beta-cleavage+of+the+prion+protein+in+the+cellular+response+to+oxidative+stress.">Reactive oxygen species-mediated beta-cleavage of the prion protein in the cellular response to oxidative stress.</a> The Journal of Biological Chemistry. 280, 35914-35921 (2005).</li><li>Mattei, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphine+Withdrawal+Modifies+Prion+Protein+Expression+in+Rat+Hippocampus.">Morphine Withdrawal Modifies Prion Protein Expression in Rat Hippocampus.</a> PLoS One. 12, 0169571 (2017).</li><li>Hu, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prion+proteins:+physiological+functions+and+role+in+neurological+disorders.">Prion proteins: physiological functions and role in neurological disorders.</a> Journal of the Neurological Sciences. 264, 1-8 (2008).</li><li>Sorice, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trafficking+of+PrPC+to+mitochondrial+raft-like+microdomains+during+cell+apoptosis.">Trafficking of PrPC to mitochondrial raft-like microdomains during cell apoptosis.</a> Prion. 6, 354-358 (2012).</li><li>Martellucci, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+Prion+protein-EGFR+multimolecular+complex+during+neuronal+differentiation+of+human+dental+pulp-derived+stem+cells.">Role of Prion protein-EGFR multimolecular complex during neuronal differentiation of human dental pulp-derived stem cells.</a> Prion. 12 (2), 117-126 (2018).</li><li>Lee, Y. J., Baskokov, I. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cellular+form+of+the+prion+protein+guides+the+differentiation+of+human+embryonic+stem+cell+into+neuron-,+oligodendrocyte-+and+astrocyte-committed+lineages.">The cellular form of the prion protein guides the differentiation of human embryonic stem cell into neuron-, oligodendrocyte- and astrocyte-committed lineages.</a> Prion. 8, 266-275 (2014).</li><li>Huang, G. T., Sonoyama, W., Chen, J., Park, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+characterization+of+human+dental+pulp+cells:+various+isolation+methods+and+culturing+environments.">In vitro characterization of human dental pulp cells: various isolation methods and culturing environments.</a> Cell and Tissue Research. 324, 225-236 (2006).</li><li>Suchanek, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dental+pulp+stem+cells+and+their+characterization.">Dental pulp stem cells and their characterization.</a> Biomedical papers of the Medical Faculty of the University Palack&#253;. 153, 31-35 (2009).</li><li>Bressan, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Donor+age-related+biological+properties+of+human+dental+pulp+stem+cells+change+in+nanostructured+scaffolds.">Donor age-related biological properties of human dental pulp stem cells change in nanostructured scaffolds.</a> PLoS One. 7 (11), 49146 (2012).</li></ol>

The authors have nothing to disclose.

In this work, we focused on methodology for isolation and neuronal differentiation of hDPSCs; moreover, we evaluated the role of PrPC in this process. There are several methods to isolate and differentiate hDPSCs in neuron-like cells and critical steps during the process. hDPSCs are able to differentiate in several lineages such as chondroblasts, adipocytes, osteoblasts, and neurons. In our paper, we investigated the mechanisms of neuronal differentiation and the presence of PrPC. As discussed above...

Mesenchymal stem cells have been isolated from several tissues, including bone marrow, umbilical cord blood, human dental pulp, adipose tissue, and blood1,2,3,4,5,6. As reported by several authors, hDPSCs show plastic adherence, a typical fibroblast-like morphology. These represent a highly heterogeneous population with distinct clones and differences in proliferative and differentiating capacity7,8. hDPSCs express specific markers for mesenchymal stem cells (i.e. CD44, CD90, CD73, CD105, STRO-1), they are negative for some hematopoietic markers (such as CD14 and CD19) and are capable of in vitro multilineage differentiation9,10,11.
Several authors have shown that these cells are able to differentiate into neuron-like cells using different protocols, that include the addition of NGF, bFGF, EGF in combination&#160;with&#160;the specific media and supplements7,12. Also, many proteins are involved during neuronal differentiation process and, among these, several papers show a relevant role and significant expression of cellular prion protein (PrPC), both in embryonic and adult stem cells13,14. PrPC represents a pleiotropic molecule capable of performing different functions inside cells as copper metabolism, apoptosis, and resistance to oxidative stress15,16,17,18,19,20,21,22.
In our previous paper23, we investigated the role of PrPC in the hDPSCs neuronal differentiation process. In fact, hDPSCs express precociously PrPC and, after neuronal differentiation, it was possible to observe an additional increase. Other authors hypothesized a possible role of PrPC in neuronal differentiation processes of stem cells. Indeed, PrPC drives the differentiation of human embryonic stem cells into neurons, oligodendrocytes, and astrocytes24. The purpose of this study was to emphasize the methodology for obtaining stem cells from dental pulp, its differentiation process and the role of PrPC during neuronal differentiation.

<table border="0" cellpadding="0" cellspacing="0" style="width:2340px;" width="2339">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:269px;">Amphotericin B solution</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:119px;">A2942</td>
			<td style="width:1791px;">It is use to supplement cell culture media, it is a polyene antifungal antibiotic from Streptomyce</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Anti-B3tubulin</td>
			<td>Cell Signaling Technology&#160;</td>
			<td style="width:119px;">#4466</td>
			<td>One of six B-tubulin isoform, it is expressed highly during fetal and postnatal development, remaining high in the peripheral nervous system</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:269px;">Anti-CD105&#160;</td>
			<td style="width:161px;">BD Biosciences</td>
			<td style="width:119px;">611314</td>
			<td>Endoglin (CD105), a major glycoprotein of human vascular endothelium, is a type I integral membrane protein with a large extracellular region, a hydrophobic transmembrane region, and a short cytoplasmic tail</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:269px;">Anti-CD44</td>
			<td style="width:161px;">Millipore</td>
			<td style="width:119px;">CBL154-20ul</td>
			<td>Positive cell markers antibodies directed against mesenchymal stem cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Anti-CD73&#160;</td>
			<td>Cell Signaling Technology&#160;</td>
			<td style="width:119px;">13160</td>
			<td>CD73 is a 70 kDa glycosyl phosphatidylinositol-anchored, membrane-bound glycoprotein that catalyzes the hydrolysis of extracellular nucleoside monophosphates into bioactive nucleosides</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Anti-CD90</td>
			<td>Millipore</td>
			<td style="width:119px;">CBL415-20ul</td>
			<td>Positive cell markers antibodies directed against mesenchymal stem cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Anti-GAP43&#160;</td>
			<td>Cell Signaling Technology&#160;</td>
			<td>#8945</td>
			<td>Is a nervous system specific, growth-associated protein in growth cones and areas of high plasticity</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Anti-mouse PE&#160;</td>
			<td style="width:161px;">Abcam</td>
			<td style="width:119px;">ab7003</td>
			<td>Is an antibody used in in flow cytometry or FACS analysis</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Anti-NFH&#160;</td>
			<td>Cell Signaling Technology&#160;</td>
			<td style="width:119px;">#2836</td>
			<td>Is an antibody that detects endogenous levels of total Neurofilament-H protein</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Anti-PrP mAb EP1802Y&#160;</td>
			<td>Abcam</td>
			<td style="width:119px;">ab52604</td>
			<td>Rabbit monoclonal [EP 1802Y] to Prion protein PrP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Anti-rabbit CY5&#160;</td>
			<td>Abcam</td>
			<td style="width:119px;">ab6564</td>
			<td>Is an antibody used in in flow cytometry or FACS analysis</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Anti-STRO 1</td>
			<td style="width:161px;">Millipore</td>
			<td style="width:119px;">MAB4315-20ul</td>
			<td>Positive cell markers antibodies directed against mesenchymal stem cells</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:269px;">B27 Supp XF CTS</td>
			<td style="width:161px;">Gibco by life technologies</td>
			<td style="width:119px;">A14867-01</td>
			<td>B-27&#160; can be used to support induction of human neural stem cells (hNSCs) from pluripotent stem cells (PSCs), expansion of hNSCs, differentiation of hNSCs, and maintenance of mature differentiated neurons in culture</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BD Accuri C6 flow cytometer&#160;</td>
			<td>BD Biosciences</td>
			<td style="width:119px;">AC6531180187</td>
			<td>Flow cytometer equipped with a blue laser (488 nm) and a red laser (640 nm)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BD Accuri C6 Software&#160;</td>
			<td>BD Biosciences</td>
			<td style="width:119px;"></td>
			<td>Controls the BD Accuri C6 flow cytometer system in order to acquire data, generate statistics, and analyze results</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:269px;">bFGF</td>
			<td style="width:161px;">PeproThec, DBA</td>
			<td style="width:119px;">100-18B</td>
			<td>basic Fibroblast Growth Factor&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:269px;">Centrifuge CL30R</td>
			<td style="width:161px;">Termo fisher Scientific</td>
			<td style="width:119px;">11210908</td>
			<td>it is a device that is used for the separation of fluids,gas or liquid, based on density</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:269px;">CO2 Incubator 3541</td>
			<td style="width:161px;">Termo fisher Scientific</td>
			<td style="width:119px;">317527-185</td>
			<td>it ensures optimal and reproducible growth conditions for cell cultures</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Collagenase, type IV&#160;</td>
			<td>Life Technologies</td>
			<td style="width:119px;">17104019</td>
			<td>Collagenase is a protease that cleaves the bond between a neutral amino acid (X) and glycine in the sequence Pro-X-Glyc-Pro, which is found with high frequency in collagen</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:269px;">Disposable scalpel&#160;</td>
			<td style="width:161px;">Swann-Morton</td>
			<td style="width:119px;">501</td>
			<td>It is use to cut tissues</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:269px;">DMEM-L</td>
			<td>Euroclone</td>
			<td style="width:119px;">ECM0060L</td>
			<td>Dulbecco&#39;s Modified Eagle&#39;s Medium Low Glucose with L-Glutamine with Sodium Pyruvate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:269px;">EGF</td>
			<td style="width:161px;">PeproThec, DBA</td>
			<td style="width:119px;">AF-100-15</td>
			<td>Epidermal Growth Factor&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:269px;">Fetal Bovine Serum</td>
			<td style="width:161px;">Gibco by life technologies</td>
			<td style="width:119px;">10270-106</td>
			<td>FBS is a popular media supplement because it provides a wide array of functions in cell culture. FBS delivers nutrients, growth and attachment factors and protects cells from oxidative damage and apoptosis by mechanisms that are difficult to reproduce in serum-free media (SFM) systems</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:269px;">Filtropur BT50 0.2,500ml Bottle top filter</td>
			<td style="width:161px;">Sarstedt</td>
			<td style="width:119px;">831,823,101</td>
			<td>it is a device that is used for filtration of solutions</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:269px;">Flexitube GeneSolution for PRNP</td>
			<td style="width:161px;">Qiagen</td>
			<td style="width:119px;">GS5621</td>
			<td>4 siRNAs for Entrez gene 5621. Target sequence N.1 TAGAGATTTCATAGCTATTTA&#160; N.2 CAGCAAATAACCATTGGTTAA&#160; N.3. CTGAATCGTTTCATGTAAGAA&#160; N.4&#160; CAGTGACTATGAGGACCGTTA</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:269px;">Hank&#39;s solution 1x</td>
			<td style="width:161px;">Gibco by life technologies</td>
			<td style="width:119px;">240200083</td>
			<td>The essential function of Hanks&#8242; Balanced Salt solution is to maintain pH as well as osmotic balance. It also provides water and essential inorganic ions to cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:269px;">HiPerFect Transfection Reagent&#160;</td>
			<td style="width:161px;">Qiagen</td>
			<td style="width:119px;">301705</td>
			<td>HiPerFect Transfection Reagent is a unique blend of cationic and neutral lipids that enables effective siRNA uptake and efficient release of siRNA inside cells, resulting in high gene knockdown even when using low siRNA concentrations</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:269px;">Neurobasal A&#160;</td>
			<td style="width:161px;">Gibco by life technologies</td>
			<td style="width:119px;">10888022</td>
			<td>Neurobasal-A Medium is a basal medium designed for long-term maintenance and maturation of pure post-natal and adult brain neurons&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:269px;">Paraformaldehyde</td>
			<td>Sigma-Aldrich</td>
			<td style="width:119px;">30525-89-4</td>
			<td>Paraformaldehyde has been used for fixing of cells and tissue sections during staining procedures</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:269px;">penicillin/streptomycin&#160;</td>
			<td style="width:161px;">Euroclone</td>
			<td style="width:119px;">ECB3001D&#160;</td>
			<td>It is use to supplement cell culture media to control bacterial contamination</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phosphate buffered saline&#160; (PBS)</td>
			<td style="width:161px;">Euroclone</td>
			<td style="width:119px;">ECB4004LX10&#160;</td>
			<td>PBS is a balanced salt solution used for the handling and culturing of mammalian cells. PBS is used to to irrigate, wash, and dilute mammalian cells. Phosphate buffering maintains the pH in the physiological range</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:269px;">TC-Platte 6 well, Cell+,F</td>
			<td style="width:161px;">Sarstedt</td>
			<td style="width:119px;">833,920,300</td>
			<td>It is a growth surface for adherent cells</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:269px;">Tissue culture flask T-25,Cell+,Vented Cap</td>
			<td style="width:161px;">Sarstedt</td>
			<td style="width:119px;">833,910,302</td>
			<td>Tissue culture flask T-25, polystyrene, Cell+ growth surface for sensitive adherent cells, e.g. primary cells, canted neck, ventilation cap, yellow, sterile, Pyrogen-free, non-cytotoxic, 10 pcs./bag</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:269px;">Triton X-100&#160;</td>
			<td>Sigma-Aldrich</td>
			<td style="width:119px;">9002-93-1</td>
			<td>Widely used non-ionic surfactant for recovery of membrane components under mild non-denaturing conditions</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:269px;">Trypsin-EDTA&#160;</td>
			<td style="width:161px;">Euroclone</td>
			<td>ECB3052D&#160;</td>
			<td>Trypsin will cleave peptides on the C-terminal side of lysine and arginine amino acid residues. Trypsin is used to remove adherent cells from a culture surface</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:269px;">Tube</td>
			<td style="width:161px;">Sarstedt</td>
			<td style="width:119px;">62,554,502</td>
			<td>Tube 15ml, 120x17mm, PP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:269px;">VBH 36 C2 Compact</td>
			<td style="width:161px;">Steril</td>
			<td>ST-003009000</td>
			<td>Offers totally protection for the enviroment and worker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ZEISS Axio Vert.A1 &#8211; Inverted&#160;Microscope</td>
			<td>Zeiss</td>
			<td style="width:119px;">3849000962</td>
			<td>ZEISS Axio Vert.A1 provides a unique entry level price and can provide all contrasting techniques, including brightfield, phase contrast, PlasDIC, VAREL, improved Hoffman Modulation Contrast (iHMC), DIC and fluorescence. Incorporate LED illumination for gentle imaging for fluorescently-labeled cells. Axio Vert.A1 is ergonomically designed for routine work and compact enough to sit inside tissue culture hoods.</td>
		</tr>
	</tbody>
</table>

isolation, propagation, and prion protein expression during neuronal differentiation of human dental pulp stem cells

Bioethical issues related to the manipulation of embryonic stem cells have hindered advances in the field of medical research. For this reason, it is very important to obtain adult stem cells from different tissues such as adipose, umbilical cord, bone marrow and blood. Among the possible sources, dental pulp is particularly interesting because it is easy to obtain in respect of bioethical considerations. Indeed, human Dental Pulp Stem Cells (hDPSCs) are a type of adult stem cells able to differentiate in neuronal-like cells and can be obtained from the third molar of healthy patients (13-19 ages). In particular, the dental pulp was removed with an excavator, cut into small slices, treated with collagenase IV and cultured in a flask. To induce the neuronal differentiation, hDPSCs were stimulated with EGF/bFGF for 2 weeks. Previously, we have demonstrated that during the differentiation process the content of cellular prion Protein (PrPC) in hDPSCs increased. The cytofluorimetric analysis showed an early expression of PrPC that increased after neuronal differentiation process. Ablation of PrPC by siRNA PrP prevented neuronal differentiation induced by EGF/bFGF. In this paper, we illustrate that as we enhanced the isolation, separation and in vitro cultivation methods of hDPSCs with several easy procedures, more efficient cell clones were obtained and large-scale expansion of the mesenchymal stem cells (MSCs) was observed. We also show how the hDPSCs, obtained with methods detailed in the protocol, are an excellent experimental model to study the neuronal differentiation process of MSCs and subsequent cellular and molecular processes.

The isolation and separation procedures of hDPSCs from dental pulp, obtained from the third molar, are complex processes in which small changes can lead a ruinous result. In this paper, we use the protocol of Arthur et al.12 with several improvements. A representative scheme of procedures is shown in Figure 1.
hDPSCs represents a heterogeneous population of cells wit...

Watch this Scientific Journal Video about Isolation, Propagation, and Prion Protein Expression During Neuronal Differentiation of Human Dental Pulp Stem Cells at JoVE.com

Isolation, Propagation, and Prion Protein Expression During Neuronal Differentiation of Human Dental Pulp Stem Cells

Here we present a protocol for human Dental Pulp Stem Cells isolation and propagation in order to evaluate the prion protein expression during neuronal differentiation process.

Bioethical issues related to the manipulation of embryonic stem cells have hindered advances in the field of medical research. For this reason, it is very ...

The standard way to obtain a stem cell from dental pulp is poorly efficient, and this depends on several variable. Our protocol allowed to obtain a successful isolation of stem cell from treated teeth in 90%of the cases. Obtaining a high number of cells in a few weeks is the main advantage.That allow us to use the cell in regenerative medicine and to create a biobank providing other scientists with this useful tool. The procedure for opening the tooth will be performed by Dr.Constantino Santacroce. Subsequently, the protocol will be shown by Stefano Martellucci, the PhD student from my lab, who is the first author of the article.To begin, extract the third molar from the patient, quickly rinse it with PBS, put in a 15-milliliter test tube with the medium, and transfer it to the laboratory in less than two hours. Under a biohazard hood, use a cutter to open the tooth by a coronal cutting pass, parallel and tangent, through the roof of the pulp chamber. With a small excavator, gently remove the pulp, and place it in a test tube.Then, wash with PBS three times, and centrifuge at 2, 500 times g at room temperature for 10 minutes. After the centrifugation, remove the supernatant. Resuspend the pellet in Hank's solution, and transfer the sample to a Petri dish.Remove the Hank's solution by centrifugation at 2, 500 times g at room temperature for 10 minutes. Then, with a disposable scalpel, divide the pulp into approximately one-millimeter slices, and add one milliliter of type IV collagenase. Next, centrifuge the sample at 2, 500 times g at room temperature for 10 minutes.Remove the supernatant, and resuspend the pellet in the medium. Culture it in a T25 flask specific for stem cells at 37 degrees Celsius in 5%carbon dioxide. During the incubation period, change the culture medium every three days.Once the adherent cells reach confluence, add one milliliter of trypsin-EDTA solution to the cells to detach them, and incubate the cells at 37 degrees Celsius for three minutes. Next, add four milliliters of the culture medium in a one-to-five ratio to stop the trypsin action, and centrifuge the cell suspension at 259 times g for six minutes. Remove the supernatant.Then, place the cells in a T25 flask to propagate. Then, detach the cells with one milliliter of trypsin-EDTA at 37 degrees Celsius for three minutes. Centrifuge the cell suspension at 259 times g for six minutes.Remove the supernatant, and proceed to test the cells for cytofluorimetric analysis. To perform the transient prion protein silencing step, first culture the human dental pulp stem cells in six-well plates with two milliliters of the culture medium for 24 hours. Then, add 400 microliters of the small interfering RNA PrP medium to each sample, and incubate them at 37 degrees Celsius for six hours.Without discarding siRNA PrP medium, add 1.6 milliliters of the culture medium in a one-to-five ratio, and leave the cells at 37 degrees Celsius for 72 hours. After the incubation period, remove the supernatant, and wash the cells with two milliliters of PBS three times at room temperature. Then, add two milliliters of the neuronal culture medium, and keep the cells for seven to 14 days in an incubator at 37 degrees Celsius.After the incubation period, wash the cells with two milliliters of PBS three times at room temperature, and proceed to Western blot analysis to test for neuronal surface antigens. To perform the neuronal induction process, culture 2 million human dental pulp stem cells in six-well plates, up to 28 days from the pulp separation. Every three days, discard the supernatant.Wash three times with two milliliters of PBS at room temperature, and replace two milliliters of the neuronal culture medium. After seven to 14 days, detach the cells with one milliliter of trypsin-EDTA at 37 degrees Celsius for three minutes. Then, add four milliliters of the culture medium in a one-to-five ratio to stop the trypsin action.To characterize the human dental pulp stem cells by flow cytometry, culture 2 million per milliliter of the cells in six-well plates with two milliliters of the culture medium. At 28 days post-dental pulp separation or after an additional 14 days with neuronal culture medium, add one milliliter of the trypsin-EDTA at 37 degrees Celsius for three minutes to detach the cells. Next, add four milliliters of the culture medium in a one-to-five ratio to stop the trypsin action, and centrifugate at 259 times g at room temperature for six minutes.Fix the untreated or treated cells with 300 microliters of 4%paraformaldehyde in PBS at four degrees Celsius for 10 minutes. Next, centrifuge, discard the supernatant, and permeabilize the cells with 1%non-ionic surfactant in PBS at room temperature for an additional 10 minutes. Then, centrifuge again, discard the supernatant, and perform the blocking with 5%nonfat dried milk in one milliliters of PBS at room temperature for one hour.Wash three times with one milliliter of PBS, and incubate the cells with anti-CD105, anti-CD44, anti-STRO-1, anti-CD90, anti-CD73, anti-beta-three-tubulin, anti-NFH, and anti-GAP43 monoclonal antibodies at room temperature for one hour. Next, centrifuge the cells again three consecutive times with one milliliter of PBS at six-minute intervals, and then incubate with anti-mouse PE or anti-rabbit CY5 monoclonal antibodies at room temperature for one additional hour. Use the secondary antibodies for gating the immune-positive cells, and analyze all samples with a flow cytometer.Culture 2 million cells per milliliter of the human dental pulp stem cells in six-well plates with two milliliters of the culture medium. At 21 and 28 days post-dental pulp separation or after an additional seven to 14 days with the neuronal culture medium, add one milliliter of the trypsin-EDTA at 37 degrees Celsius for three minutes to detach the cells. Then, centrifuge, discard the supernatant, and then fix the specimens with 4%paraformaldehyde in PBS at four degrees Celsius for 10 minutes.Next, centrifuge, discard the supernatant, and then permeabilize with 1%non-ionic surfactant in PBS at room temperature for 10 minutes. Remove the supernatant, and stain the cells with rabbit anti-PrP monoclonal antibody at room temperature for one hour. Finally, centrifuge, discard the supernatant, and then incubate with anti-rabbit CY5 monoclonal antibody at room temperature for an additional hour.Analyze all samples with a flow cytometer. After pulp separation, clusters of human dental pulp stem cells were expanded on the periphery. A comparison between the growth of these cells before and after the neuronal differentiation induced by EGF/bFGF showed significant changes in the cell morphology and neurites outgrowth.Untreated human dental pulp stem cells expressed multipotent mesenchymal stromal specific surface antigens, such as CD44, CD90, CD105, CD73, and STRO-1. After appropriate neuronal induction stimuli, these cells expressed specific neuronal markers, such as beta-three-tubulin, NFH, and GAP43. Untreated or treated cells did not express hematopoietic markers, such as CD14 and CD19.After 28 days, prion protein was precociously expressed in human dental pulp stem cells compared with the corresponding negative control, and its expression was increased after the neuronal differentiation process induced by EGF/bFGF. Western blot analysis showed that silencing the prion protein by sRNA before EGF/bFGF stimuli could affect the neuronal differentiation process of human dental pulp stem cells by preventing the expression of neuronal markers beta-three-tubulin and NHF. The most important thing is the choice of the enzyme to separate the cells from the pulp.In fact, if the enzyme is too aggressive, the cells could be damaged and their growth and differentiation capacity could be compromised. The dental pulp stem cells are an excellent experimental model which can be employed in vivo and in vitro studies in the regenerative medicine field. Since PrP plays a key role in neuronal differentiation process of dental pulp stem cells, this marker may be an excellent candidate as effective target in neurodegenerative diseases.The most important aspect to advise is the health condition of the patients, such as the absence of infectious diseases.

isolation-propagation-prion-protein-expression-during-neuronal

Research

JoVE Journal

Developmental Biology

7.2K Görüntüleme.  Sabina Universitas - Rieti University Hub. Diş posasından kök hücre elde etmek için standart bir yol kötü verimli, ve bu birkaç değişken bağlıdır. Protokolümüz, olguların %90'ında tedavi edilen dişlerden kök hücrenin başarılı bir şekilde izole edilmesine olanak sağladı. Birkaç hafta içinde çok sayıda hücre elde etmek en büyük avantajdır.Bu bize rejeneratif tıp hücre kullanmak ve bu yararlı aracı ile diğer bilim adamları sağlayan bir biyobanka oluşturmak için izin verir. Diş açma işl...