نعترف الدكتور أمير أهاروني لدعمه وجينو دافيدوف ، Grimberg نعوم وتشن غوتمان للحصول على المشورة وتعليقاتهم.

1. الاستنساخ والتعبير عن الجينات ماما في E. القولونية وقد تتضخم متحولة mamAΔ41 الجينات باستخدام تفاعل البلمرة المتسلسل (PCR) من الحمض النووي الجينومي للmagneticum Magnetospirillum AMB - 1 ، مع الاشعال : 5&#39; - GCATTACGCATATGGACGACATCCGCCAGGTG - 3 ...

<ol>
	<li>Faivre, D., Schuler, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Magnetotactic+Bacteria+and+Magnetosomes.">Magnetotactic Bacteria and Magnetosomes.</a> Chem Rev. 108, 4875-4898 (2008).</li><li>D'Andrea, L. D., Regan, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TPR+proteins:+the+versatile+helix.">TPR proteins: the versatile helix.</a> Trends Biochem Sci. 28, 655-662 (2003).</li><li>Young, J. C., Barral, J. M., Hartl, U. l. r. i. c. h., F, . <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=More+than+folding:+localized+functions+of+cytosolic+chaperones.">More than folding: localized functions of cytosolic chaperones.</a> Trends Biochem Sci. 28, 541-547 (2003).</li><li>Brocard, C., Hartig, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peroxisome+targeting+signal+1:+is+it+really+a+simple+tripeptide?.">Peroxisome targeting signal 1: is it really a simple tripeptide?.</a> Biochim Biophys Acta. 1763, 1565-1573 (2006).</li><li>Fransen, M., Amery, L., Hartig, A., Brees, C., Rabijns, A., Mannaerts, G. P., Van Veldhoven, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+the+PTS1-+and+Rab8b-binding+properties+of+Pex5p+and+Pex5Rp/TRIP8b.">Comparison of the PTS1- and Rab8b-binding properties of Pex5p and Pex5Rp/TRIP8b.</a> Biochim Biophys Acta. 1783, 864-873 (2008).</li><li>Baker, M. J., Frazier, A. E., Gulbis, J. M., Ryan, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+protein-import+machinery:+correlating+structure+with+function.">Mitochondrial protein-import machinery: correlating structure with function.</a> Trends Cell Biol. 17, 456-464 (2007).</li><li>Mirus, O., Bionda, T., von Haeseler, A., Schleiff, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionarily+evolved+discriminators+in+the+3-TPR+domain+of+the+Toc64+family+involved+in+protein+translocation+at+the+outer+membrane+of+chloroplasts+and+mitochondria.">Evolutionarily evolved discriminators in the 3-TPR domain of the Toc64 family involved in protein translocation at the outer membrane of chloroplasts and mitochondria.</a> J Mol Model. 15, 971-982 (2009).</li><li>Gatsos, X., Perry, A. J., Anwari, K., Dolezal, P., Wolynec, P. P., Likic, V. A., Purcell, A. W., Buchanan, S. K., Lithgow, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+secretion+and+outer+membrane+assembly+in+Alphaproteobacteria.">Protein secretion and outer membrane assembly in Alphaproteobacteria.</a> FEMS Microbiol Rev. 32, 995-1009 (2008).</li><li>Tiwari, D., Singh, R. K., Goswami, K., Verma, S. K., Prakash, B., Nandicoori, V. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Key+residues+in+Mycobacterium+tuberculosis+protein+kinase+G+play+a+role+in+regulating+kinase+activity+and+survival+in+the+host.">Key residues in Mycobacterium tuberculosis protein kinase G play a role in regulating kinase activity and survival in the host.</a> J Biol Chem. 284, 27467-27479 (2009).</li><li>Edqvist, P. J., Broms, J. E., Betts, H. J., Forsberg, A., Pallen, M. J., Francis, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tetratricopeptide+repeats+in+the+type+III+secretion+chaperone,+LcrH:+their+role+in+substrate+binding+and+secretion.">Tetratricopeptide repeats in the type III secretion chaperone, LcrH: their role in substrate binding and secretion.</a> Mol Microbiol. 59, 31-44 (2006).</li><li>Grunberg, K., Muller, E. C., Otto, A., Reszka, R., Linder, D., Kube, M., Reinhardt, R., Schuler, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+and+proteomic+analysis+of+the+magnetosome+membrane+in+Magnetospirillum+gryphiswaldense.">Biochemical and proteomic analysis of the magnetosome membrane in Magnetospirillum gryphiswaldense.</a> Appl Environ Microbiol. 70, 1040-1050 (2004).</li><li>Komeili, A., Vali, H., Beveridge, T. J., Newman, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Magnetosome+vesicles+are+present+before+magnetite+formation,+and+MamA+is+required+for+their+activation.">Magnetosome vesicles are present before magnetite formation, and MamA is required for their activation.</a> Proc Natl Acad Sci USA. 101, 3839-3843 (2004).</li><li>Okuda, Y., Fukumori, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+and+characterization+of+a+magnetosome-associated+protein,+TPR-containing+MAM22,+in+Escherichia+coli.">Expression and characterization of a magnetosome-associated protein, TPR-containing MAM22, in Escherichia coli.</a> FEBS Lett. 491, 169-173 (2001).</li><li>Taoka, A., Asada, R., Sasaki, H., Anzawa, K., Wu, L. F., Fukumori, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+localizations+of+Mam22+and+Mam12+in+the+magnetosomes+of+Magnetospirillum+magnetotacticum.">Spatial localizations of Mam22 and Mam12 in the magnetosomes of Magnetospirillum magnetotacticum.</a> J Bacteriol. 188, 3805-3812 (2006).</li><li>Studier, F. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+by+auto-induction+in+high+density+shaking+cultures.">Protein production by auto-induction in high density shaking cultures.</a> Protein Expression and Purification. 41, 207-234 (2005).</li></ol>

تنقية البروتين هو خطوة رئيسية في أي البروتينات الحيوية أو الدراسات البنيوية. لأن كل من البروتين هي فريدة من نوعها مع سلوكها ، ويحتاج المرء لتحديد خصائصه وتعديلها وفقا لذلك تنقية. وينبغي تحليل البروتين الهدف كخطوة أولى نحو تنقية استخدام أدوات المعلوماتية الحيوية. يت?...

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">	
		
		<div>
		<table border="1">
		<thead>
		<tr>
		<th>Material Name</th>
		<th>Type</th>
		<th>Company</th>
		<th>Catalogue Number</th>
		<th>Comment</th>
		</tr>
		</thead>
		<tbody>
		
<tr>
<td>French Press</td>
<td>Equipment</td>
<td>Thermo scientific</td>
<td>FA-078A</td>
<td>&nbsp;</td>
<tr>
<td>Pressure cell</td>
<td>Equipment</td>
<td>Thermo scientific</td>
<td>FA-032</td>
<td>&nbsp;</td>
<tr>
<td>Ultra-centrifuge</td>
<td>Equipment</td>
<td>Sorvall</td>
<td>Discovery 90SE</td>
<td>&nbsp;</td>
<tr>
<td>Rottor</td>
<td>Equipment</td>
<td>Beckman</td>
<td>Ti60</td>
<td>&nbsp;</td>
<tr>
<td>Ultra-centrifuge tubes; PC-Bottle+Cap Assay 26.3ml</td>
<td>Equipment</td>
<td>Beckman</td>
<td>BC-355618</td>
<td>&nbsp;</td>
<tr>
<td>2.5cm diameter, Glass Econo-Column Chromatography Columns</td>
<td>Equipment</td>
<td>BioRad</td>
<td>737-2521</td>
<td>&nbsp;</td>
<tr>
<td>Ni-NTA His Bind resin</td>
<td>Equipment</td>
<td>Novagen</td>
<td>M0063428</td>
<td>&nbsp;</td>
<tr>
<td>Spectrophotometer</td>
<td>Equipment</td>
<td>Amersham Biosiences</td>
<td>Ultraspec 2100 pro</td>
<td>&nbsp;</td>
<tr>
<td>Quartz cuvette</td>
<td>Equipment</td>
<td>Hellma</td>
<td>104-QS</td>
<td>&nbsp;</td>
<tr>
<td>Fast Performance Liquid Chromatography- AKTA purifier 10</td>
<td>Equipment</td>
<td>GE Healthcare Biosciences</td>
<td>28-4062-64</td>
<td>&nbsp;</td>
<tr>
<td>Ion exchange column &#x2013; MonoQ 4.6/100 PE</td>
<td>Equipment</td>
<td>GE Healthcare Biosciences</td>
<td>10025543</td>
<td>&nbsp;</td>
<tr>
<td>Size exclusion pre-packed column-HiLoad 26/60 Superdex 200</td>
<td>Equipment</td>
<td>GE Healthcare Biosciences</td>
<td>17-1071-01</td>
<td>&nbsp;</td>
<tr>
<td>Centricon - Vivaspin15 &#x2013; 10,000 MWCO</td>
<td>Equipment</td>
<td>Sartorius Stedim Biotech GmbH</td>
<td>VS1501</td>
<td>&nbsp;</td>
<tr>
<td>Table centrifuge</td>
<td>Equipment</td>
<td>Thermo scientific</td>
<td>IEC CL30R</td>
<td>&nbsp;</td>
<tr>
<td>MALDI-TOF</td>
<td>Equipment</td>
<td>Bruker Daltonics</td>
<td>Reflex IV</td>
<td>&nbsp;</td>
<tr>
<td>Tris-HCl (hydrotymethyl) aminomethane</td>
<td>Reagent</td>
<td>BioLab</td>
<td>20092391</td>
<td>&nbsp;</td>
<tr>
<td>Sodium Chloride</td>
<td>Reagent</td>
<td>FRUTROM</td>
<td>235553470</td>
<td>&nbsp;</td>
<tr>
<td>Imidazole</td>
<td>Reagent</td>
<td>Alfa Aesar</td>
<td>288-32-4</td>
<td>&nbsp;</td>
<tr>
<td>EDTA free protease inhibitors cocktail</td>
<td>Reagent</td>
<td>Sigma</td>
<td>P-8849</td>
<td>&nbsp;</td>
<tr>
<td>Dnase I (Deoxyribonuclease I)</td>
<td>Reagent</td>
<td>Sigma</td>
<td>DN-25</td>
<td>&nbsp;</td>
<tr>
<td>Bovine Thrombin</td>
<td>Reagent</td>
<td>Fisher BioReagents</td>
<td>BP25432</td>
<td>&nbsp;</td>
<tr>
<td>Glycine</td>
<td>Reagent</td>
<td>BioLab</td>
<td>07132391</td>
<td>&nbsp;</td>
<tr>
<td>Soudim Dodecyl Sulfate (SDS)</td>
<td>Reagent</td>
<td>BioLab</td>
<td>19822391</td>
<td>&nbsp;</td>
<tr>
<td>Beta-mercaptoethanol</td>
<td>Reagent</td>
<td>Sigma</td>
<td>M-3148</td>
<td>&nbsp;</td>
<tr>
<td>InstantBlue</td>
<td>Reagent</td>
<td>Expedeon</td>
<td>1SB01L</td>
<td>&nbsp;</td>
<tr>
<td>PageRuler Prestained Protein Ladder</td>
<td>Reagent</td>
<td>Fermentas</td>
<td>SM0671</td>
<td>&nbsp;</td>		</tbody>
		</table>
		</div>

purification of the m. magneticum strain amb-1 magnetosome associated protein mama&delta;41

البكتيريا Magnetotactic تضم مجموعة متنوعة من الكائنات المجهرية المائية التي تكون قادرة على توجيه نفسها على امتداد الحقول المغنطيسية. ويعتقد أن هذا السلوك للمساعدة في بحثهم عن بيئات مناسبة<em&gt; (1)</em&gt;. وتمنح هذه القدرة التي magnetosome ، والتحت خلوية عضية التي تتكون من سلسلة التجميع خطية من الدهون قادرة على حويصلات كل biomineralize وأرفق ~ 50 نانومتر من الكريستال أو المغنتيت greigite. وثمة عنصر مبدأ magnetosome التي كانت معروضة لتكون هناك حاجة لتشكيل حويصلات الوظيفية ماما. ماما هو وفيرة للغاية magnetosome المرتبطة البروتين الذي هو واحد من البروتينات المرتبطة magnetosome تتميز معظم<em&gt; في الجسم الحي</em&gt;<em&gt; (2-6)</em&gt;. هذا المقال يركز على تنقية ماما ، والتي على الرغم من كونها درست<em&gt; في الجسم الحي</em&gt; ، لم يتم تحديد أي تفاصيل واضحة وظيفي أو هيكلي لذلك. واقترح أن تحليل المعلومات البيولوجية ماما هو تكرار رباعي tricopeptide (TPR) التي تحتوي على البروتين. TPR هو عزر الهيكلية موجودة كجزء من هذا القبيل أو تشكيل أكبر أضعاف في طائفة واسعة من البروتينات ، وأنها تخدم كنموذج للبروتين البروتين التفاعلات ويتوسط متعدد البروتين المجمعات<em&gt; (7)</em&gt;. ويشارك في TPRs المهام الحاسمة في العديد من عمليات الخلية حقيقية النواة عضية ومسارات كثيرة البكتيرية<em&gt; (14/08).</em&gt; ولكي نفهم ماما ، وهي فريدة من نوعها تحتوي على البروتين TPR ، مطلوب بروتين عالي النقاء ، كخطوة أولى. في هذه المقالة ، فإننا نقدم للبروتوكول لتنقية متحولة مستقرة الحذف ماما (MamAΔ41) من<em&gt; م. magneticum</em&gt; AMB - 1.

Watch this Scientific Journal Video about Purification of the M. magneticum Strain AMB-1 Magnetosome Associated Protein MamAÃŽâ€41 at JoVE.com

Purification of the M. magneticum Strain AMB-1 Magnetosome Associated Protein MamAÃƒÅ½Ã¢â‚¬Â41

ماما هي فريدة من نوعها Magnetosome البروتينات المرتبطة بها والتي كانت معروضة على المشاركة في تنشيط magnetosome. هنا نقدم بروتوكول تنقية ماما الحذف متحولة (MamAΔ41) من<em&gt; م. magneticum</em&gt; AMB - 1.

تنقية م. magneticum سلالة AMB - 1 بروتين المرتبطين Magnetosome MamAΔ41

Magnetotactic bacteria comprise a diverse group of aquatic microorganisms that are able to orientate themselves along geomagnetic fields. This behavior is ...

Research

JoVE Journal

Biology

Purification of the M. magneticum Strain AMB-1 Magnetosome Associated Protein MamA&Delta;41

Staining of Proteins in Gels with Coomassie G-250 without Organic Solvent and Acetic Acid

تلطيخ من البروتينات في الهلام مع Coomassie G - 250 دون عضوي حمض الخليك والمذيبات

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents ...

Using the GELFREE 8100 Fractionation System for Molecular Weight-Based Fractionation with Liquid Phase Recovery

باستخدام نظام التقطير GELFREE 8100 لتقطير الوزن الجزيئي وبناء مع مرحلة الانتعاش السائل

The GELFREE 8100 Fractionation System is a novel protein fractionation system designed to maximize protein recovery during molecular weight based ...

Purification of Progenitors from Skeletal Muscle

تنقية الأسلاف من الهيكل العظمي والعضلات

Skeletal muscle contains multiple progenitor populations of distinct embryonic origins and developmental potential. Myogenic progenitors, usually residing ...

Automated Hydrophobic Interaction Chromatography Column Selection for Use in Protein Purification

آلية التفاعل اللوني مسعور اختيار عمود للاستخدام في تنقية البروتين

In contrast to other chromatographic methods for purifying proteins (e.g. gel filtration, affinity, and ion exchange), hydrophobic interaction ...

Purification of Hsp104, a Protein Disaggregase

تنقية Hsp104 ، وهو بروتين Disaggregase

Hsp104 is a hexameric AAA+ protein1 from yeast, which couples ATP hydrolysis to protein disaggregation2-10 (Fig. 1). This activity imparts two key ...

Identification of Protein Interacting Partners Using Tandem Affinity Purification

تحديد الشركاء البروتين عن طريق التفاعل جنبا الى جنب الانجذاب تنقية

A critical and often limiting step in understanding the function of host and viral proteins is the identification of interacting cellular or viral protein ...

Expression and Purification of the Cystic Fibrosis Transmembrane Conductance Regulator Protein in Saccharomyces cerevisiae

Expression and Purification of the Cystic Fibrosis Transmembrane Conductance Regulator Protein in Saccharomyces cerevisiae

التعبير وتنقية عبر الغشاء التليف الكيسي بروتين منظم المواصلة في خميرة الخباز

The  cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride  channel, that when mutated, can give rise to cystic fibrosis in  ...

Budding Yeast Protein Extraction and Purification for the Study of Function, Interactions, and Post-translational Modifications

مهدها الخميرة استخراج البروتين وتنقية لدراسة وظيفة، والتفاعلات، والتعديلات بعد متعدية

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously ...

Identification of Post-translational Modifications of Plant Protein Complexes

تحديد التعديلات بعد متعدية من النباتات بروتين المجمعات

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to ...

Purification of the Cystic Fibrosis Transmembrane Conductance Regulator Protein Expressed in Saccharomyces cerevisiae

Purification of the Cystic Fibrosis Transmembrane Conductance Regulator Protein Expressed in Saccharomyces cerevisiae

تنقية التليف الكيسي عبر الغشاء المواصلة منظم البروتين المعبر عنه في<em&gt; خميرة الخباز</em

Defects in the cystic fibrosis transmembrane conductance regulator (CFTR) protein cause cystic fibrosis (CF), an autosomal recessive disease that ...