Name: competitive genomic screens of barcoded yeast libraries
Uploaded: 2011-08-11T14:00:00
Duration: 11 min 59 s
Description: Watch this Scientific Journal Video about Competitive Genomic Screens of Barcoded Yeast Libraries at JoVE.com

Nous tenons à remercier Ron Davis, Adam Deutschbauer, et le laboratoire HIP HOP entière à l&#39;Université de Toronto pour des discussions et des conseils. Le CN est soutenu par des subventions de la National Human Genome Research Institute (Numéro de la subvention HG000205), RO1 HG003317, les IRSC RdP-84 305, et Société canadienne du cancer (# 020380). Jo a été soutenu par le Programme de formation de Stanford Genome (Numéro de la subvention T32 HG00044 du National Human Genome Research Institute) et le National Institutes of Health (numéro Grant P01 GH000205). GG est soutenu par le NHGRI HG003317 RO1 et la Société canadienne du cancer, Grant # 020380, TD et le Centre de séquençage Donnelly est soutenu en partie par des subventions de la Fondation canadienne pour l&#39;innovation pour les docteurs. Brenda Andrews et Jack Greenblatt. AMS est soutenu par l&#39;Université de Toronto Bourse ouverte.

<ol>
	<li>Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+profiling+of+the+Saccharomyces+cerevisiae+genome.">Functional profiling of the Saccharomyces cerevisiae genome.</a> Nature. 418, 387-391 (2002).</li><li>Baba, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Molecular systems biology. 2, 2006.0008-2006.0008 (2006).</li><li>Claus, H., Frosch, M., Vogel, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+hotspot+for+transformation+of+Neisseria+meningitidis+by+shuttle+mutagenesis+using+signature-tagged+transposons.">Identification of a hotspot for transformation of Neisseria meningitidis by shuttle mutagenesis using signature-tagged transposons.</a> Mol Gen Genet. 259, 363-371 (1998).</li><li>Hava, D. L., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+identification+of+serotype+4+Streptococcus+pneumoniae+virulence+factors.">Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors.</a> Molecular microbiology. 45, 1389-1406 (2002).</li><li>Costanzo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Genetic+Landscape+of+a+Cell.">The Genetic Landscape of a Cell.</a> Science. 327, 425-431 (2010).</li><li>Tong, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science. 294, 2364-2368 (2001).</li><li>Pan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+toolkit+for+functional+profiling+of+the+yeast+genome.">A robust toolkit for functional profiling of the yeast genome.</a> Molecular cell. 16, 487-496 (2004).</li><li>Schuldiner, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploration+of+the+Function+and+Organization+of+the+Yeast+Early+Secretory+Pathway+through+an+Epistatic+Miniarray+Profile.">Exploration of the Function and Organization of the Yeast Early Secretory Pathway through an Epistatic Miniarray Profile.</a> Cell. 123, 507-519 (2005).</li><li>Deutschbauer, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+haploinsufficiency+revealed+by+genome-wide+profiling+in+yeast.">Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast.</a> Genetics. 169, 1915-1925 (2005).</li><li>Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemogenomic+profiling:+identifying+the+functional+interactions+of+small+molecules+in+yeast.">Chemogenomic profiling: identifying the functional interactions of small molecules in yeast.</a> Proceedings of the National Academy of Sciences of the United States of America. 101, 793-798 (2004).</li><li>Lum, P. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovering+modes+of+action+for+therapeutic+compounds+using+a+genome-wide+screen+of+yeast+heterozygotes.">Discovering modes of action for therapeutic compounds using a genome-wide screen of yeast heterozygotes.</a> Cell. 116, 121-137 (2004).</li><li>Hillenmeyer, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+genomic+portrait+of+yeast:+uncovering+a+phenotype+for+all+genes.">The chemical genomic portrait of yeast: uncovering a phenotype for all genes.</a> Science. 320, 362-365 (2008).</li><li>Oh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+universal+TagModule+collection+for+parallel+genetic+analysis+of+microorganisms.">A universal TagModule collection for parallel genetic analysis of microorganisms.</a> Nucleic acids research. 38, e146-e146 (2010).</li><li>Oh, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+annotation+and+drug+target+discovery+in+Candida+albicans+with+a+tagged+transposon+mutant+collection.">Gene annotation and drug target discovery in Candida albicans with a tagged transposon mutant collection.</a> PLoS pathogens. 6, (2010).</li><li>Nislow, C., Giaever, G., Stark, I., Stansfields, M. J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+387.">Chapter 387.</a> Yeast Gene Analysis. , 387-414 (2007).</li><li>Pierce, S. E., Davis, R. W., Nislow, C., Giaever, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+barcoded+Saccharomyces+cerevisiae+gene-deletion+mutants+in+pooled+cultures.">Genome-wide analysis of barcoded Saccharomyces cerevisiae gene-deletion mutants in pooled cultures.</a> Nature protocols. 2, 2958-2974 (2007).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2001).</li><li>Smith, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+phenotyping+via+deep+barcode+sequencing.">Quantitative phenotyping via deep barcode sequencing.</a> Genome Res. , (2009).</li><li>Hamady, M., Walker, J. J., Harris, J. K., Gold, N. J., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Error-correcting+barcoded+primers+for+pyrosequencing+hundreds+of+samples+in+multiplex.">Error-correcting barcoded primers for pyrosequencing hundreds of samples in multiplex.</a> Nature. 5, 235-237 (2008).</li><li>Gresham, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=System-Level+Analysis+of+Genes+and+Functions+Affecting+Survival+During+Nutrient+Starvation+in+Saccharomyces+cerevisiae.">System-Level Analysis of Genes and Functions Affecting Survival During Nutrient Starvation in Saccharomyces cerevisiae.</a> Genetics. 187, 299-317 (2011).</li></ol>

Aucun conflit d&#39;intérêt déclaré.

Ici, nous avons présenté un protocole qui, avec une modification modeste, peut facilement être adapté à un large éventail de collections existantes des codes-barres collections de mutants de microorganismes différents pour créer des collections de mutants étiquetés. Nous soulignons que, bien que nous avons rapporté un protocole sur la mutagenèse transposon marqués pour la levure pathogène C. albicans, un protocole très similaire pourrait être adapté à une grande variété de champignons unicellulaires. Mise à jour, ce protocole fonctionne bien chez les bactéries 13, et actuellement les collections d&#39;un certain nombre d&#39;autres génomes fongiques et bactériennes sont en construction. A l&#39;heure actuelle, ce test fournit la seule complète, l&#39;ensemble du génome d&#39;écran impartiale pour les interactions gène-petite molécule. Une caractéristique particulièrement convaincante de l&#39;essai est qu&#39;aucune connaissance préalable du gène ou de petites molécules est nécessaire. En dépit de la portée et la puissance de ces tests, leur transférabilité à d&#39;autres laboratoires a été entravée par le peu d&#39;investissement initial et outils informatiques pour l&#39;analyse des résultats. Avec l&#39;adoption d&#39;une lecture séquence prochaine génération combinée avec des outils robustes pour l&#39;analyse, nous nous attendons à leur adoption à augmenter.

<table border="1"><tbody><tr><td> Antibiotiques </td><td> Numéros de fournisseur et le catalogue </td></tr><tr><td> Carbénicilline </td><td> Sigma, pièce # C1613 </td></tr><tr><td> Kanamycine </td><td> Sigma, pièce # K1876 </td></tr><tr><td> spectinomycine </td><td> Sigma, pièce # S0692 </td></tr><tr><td> Le chloramphénicol </td><td> Sigma, pièce # C0378 </td></tr><tr><td> DNA Clean-up et des kits de concentration </td><td></td></tr><tr><td> QIAprep Spin Miniprep Kit </td><td> Qiagen, pièce # 27106 </td></tr><tr><td> HiSpeed ​​Maxi Kit Plasmid </td><td> Qiagen, pièce # 12663 </td></tr><tr><td> QIAquick PCR Purification </td><td> Qiagen, pièce # 28106 </td></tr><tr><td> QIAquick Gel Extraction Kit </td><td> Qiagen, pièce # 28704 </td></tr><tr><td> PCR et des réactifs d&#39;électrophorèse </td><td></td></tr><tr><td> Taq DNA polymerase (Mg-libres) Tampon </td><td> New England Biolabs, pièce # M0320L </td></tr><tr><td> Mélanger une solution désoxynucléotides </td><td> New England Biolabs, pièce # N0447L </td></tr><tr><td> 25 mM MgCl 2 </td><td> Sigma, pièce # 63036 </td></tr><tr><td> Agarose, le colorant de charge et d&#39;acides nucléiques tache adapté à l&#39;électrophorèse sur gel </td><td> Divers </td></tr><tr><td> 10X tampon TAE </td><td> Sigma, pièce # T8280 </td></tr><tr><td> 1 Kb DNA Ladder plus </td><td> Invitrogen, pièce # 10787026 </td></tr><tr><td> YPD bouillon </td><td></td></tr><tr><td> 10 g d&#39;extrait de levure </td><td> Sigma, pièce # Y1625 </td></tr><tr><td> 20 g de peptone Bacto </td><td> BD Biosciences, pièce # 211677 </td></tr><tr><td> 20 g de dextrose </td><td> Sigma, pièce # D9434 </td></tr><tr><td> Labware </td><td></td></tr><tr><td> Pipettes multicanaux (1000, 200, et 20 pi) </td><td> Divers </td></tr><tr><td> Jetables réservoirs de pipetage </td><td> Divers </td></tr><tr><td> 15 et 50 ml tubes à centrifuger </td><td> Divers </td></tr><tr><td> 96 - et 384 puits profonds plaques à puits </td><td> Axygen scientifique, pièce # P-2ML-SQ-CS &amp; P-384240SQCS </td></tr><tr><td> 96 puits et 384 puits de PCR et le film d&#39;étanchéité </td><td> Divers </td></tr><tr><td> Plaque pour rouleaux d&#39;étanchéité plaques multi-puits </td><td> Sigma, pièce # R1275 </td></tr><tr><td> 30 ° C et 37 ° C en secouant incubateurs pour la culture des bactéries et de levures sur les assiettes et dans les tubes </td><td> Divers </td></tr><tr><td> In vitro transposon mutagenèse </td><td></td></tr><tr><td> EZ-Tn5 transposase </td><td> Biotechnologies Epicentre, pièce # TNP92110 </td></tr><tr><td> À haut débit de transformation </td><td></td></tr><tr><td> Seqprep 96 Kit HT Prep Plasmid </td><td> Edge Biosystems, pièce # 84359 </td></tr><tr><td> polyéthylène glycol, poids moléculaire 3350 </td><td> Divers </td></tr><tr><td> l&#39;acétate de lithium </td><td> Sigma, pièce # 517992 </td></tr><tr><td> Plaques de 6 puits, stériles </td><td> Corning, pièce # 3335 </td></tr><tr><td> 50 mg / ml d&#39;uridine </td><td> Sigma, pièce # U3750 </td></tr><tr><td> Solution de 100X tampon Tris-EDTA </td><td> Sigma, pièce # T9285 </td></tr><tr><td> 1X TE/0.1M LiOAc </td><td> Divers </td></tr><tr><td> Saumon testicule ADN </td><td> Sigma, pièce # 1626 </td></tr><tr><td> La croissance des collections code-barres </td><td></td></tr><tr><td> Plaques de 48 puits, et si de plus en plus les cultures en plaques </td><td> Greiner, pièce # M9437 </td></tr><tr><td> Sceaux plaque adhésive </td><td> ABgene, pièce # AB-0580 </td></tr><tr><td> 200 flacons de culture ml </td><td> Divers </td></tr><tr><td> Spectrophotomètre permettant d&#39;absorbance </td><td> Divers </td></tr><tr><td> À température contrôlée shaker pour flacons de 250 ml ou spectrophotomètre secouant </td><td> Divers </td></tr><tr><td> Microtube Safe-Lock, 2 ml </td><td> Eppendorf, pièce # 0030 120.094 </td></tr><tr><td> Hybridation équipements </td><td></td></tr><tr><td> 640 Four à hybridation </td><td> Affymetrix, pièce # 800138 </td></tr><tr><td> GeneChip fluidique station 450 </td><td> Affymetrix, pièce # 00-0079 </td></tr><tr><td> GeneArray Scanner 3000 </td><td> Affymetrix, pièce # 00-0212 </td></tr><tr><td> Bain d&#39;eau bouillante avec rack flottante </td><td> Divers </td></tr><tr><td> Hybridation des consommables </td><td></td></tr><tr><td> GenFlex Tag tableau 16K v2 </td><td> AffymEtrix, pièce # 511331 </td></tr><tr><td> Solution de Denhardt, concentré 50X </td><td> Sigma, pièce # D2532 </td></tr><tr><td> Streptavidine, la R-phycoérythrine conjugué (SAPE) </td><td> Invitrogen, pièce # S866 </td></tr><tr><td> Microtube Safe-Lock, 0,5 mL </td><td> Eppendorf, pièce # 0030 123.301 </td></tr><tr><td> Teeny Tough-Spots </td><td> Diversified Biotech, pièce # LTTM-1000 </td></tr><tr><td> EDTA 0,5 M </td><td> BioRad, pièce # 161-0729 </td></tr><tr><td> 10% de Tween </td><td> Sigma, pièce # T2700 </td></tr><tr><td> Monohydraté MES sans acide </td><td> Sigma, pièce # M5287 </td></tr><tr><td> Sel de sodium MES </td><td> Sigma, pièce # M5057 </td></tr><tr><td> 5 M de NaCl </td><td> Sigma, pièce # 71386 </td></tr><tr><td> 20X SSPE </td><td> Sigma, pièce # S2015 </td></tr><tr><td> Moléculaire de l&#39;eau de qualité de biologie </td><td> Sigma, pièce # W4502 </td></tr><tr><td> Primaires hybridation </td><td> Divers fournisseurs (dessalage standard) </td></tr><tr><td> Uptag </td><td> 5 &#39;GATGTCCACGAGGTCTCT 3&#39; </td></tr><tr><td> Buptagkanmx4 </td><td> 5 &#39;biotine-GTCGACCTGCAGCGTACG 3&#39; </td></tr><tr><td> Dntag </td><td> 5 &#39;CGGTGTCGGTCTCGTAG 3&#39; </td></tr><tr><td> Bdntagkanmx4 </td><td> 5 &#39;biotine-GAAAACGAGCTCGAATTCATCG 3&#39; </td></tr><tr><td> B213 </td><td> 5 &#39;biotine-CTGAACGGTAGCATCTTGAC 3&#39; </td></tr><tr><td> Uptagkanmx </td><td> 5 &#39;GTCGACCTGCAGCGTACG 3&#39; </td></tr><tr><td> Dntagkanmx </td><td> 5&#39;GAAAACGAGCTCGAATTCATCG 3 &#39; </td></tr><tr><td> Uptagcomp </td><td> 5&#39;AGAGACCTCGTGGACATC 3 &#39; </td></tr><tr><td> Dntagcomp </td><td> 5&#39;CTACGAGACCGACACCG 3 &#39; </td></tr><tr><td> Upkancomp </td><td> 5&#39;CGTACGCTGCAGGTCGAC 3 &#39; </td></tr><tr><td> Dnkancomp </td><td> 5&#39;CGATGAATTCGAGCTCGTTTTC 3 &#39; </td></tr><tr><td> Amorces de séquençage: Plate-forme Illumina </td><td> Divers fournisseurs </td></tr><tr><td> UpTag Forward (100uM) </td><td> 5 &#39;CAA GCA GAA GAC GGC CGA ATA GCT ATC CTT GCC T GAT GTC CAC GAG GTC TCT 3&#39; </td></tr><tr><td> UpTag inverse (100uM) </td><td> 5 &#39;AAT GCG GAT ACG CAC CAC GAC LOI CTT TCC CTA CAC GAC TGC CTT GCC ATC T NNNNN GTC GAC CTG ACG CGT ACG 3&#39; </td></tr><tr><td> DownTag Forward (100uM) </td><td> 5 &#39;CAA GCA GAA GAC GGC CGA ATA GCT ATC CTT GCC T GAA GAA CTC GAG AAC TTC ATC G 3&#39; </td></tr><tr><td> DownTag inverse (100uM) </td><td> 5 &#39;AAT GCG GAT ACG CAC CAC GAC LOI CTT TCC CTA CAC GAC TGC CTT GCC ATC T NNNNN CGG TGT CGG TCT CGT AG 3 ` </td></tr><tr><td> Lire 1 UP-tag suivants amorce (100uM) </td><td> 5 &#39;GTC GAC CTG ACG CGT ACG 3&#39; </td></tr><tr><td> Lire une BAS-tag amorce SEQ (100uM) </td><td> 5 &#39;TGT CGG CGG TCT CGT AG 3&#39; </td></tr><tr><td> Lire 2 amorce de séquençage Index (standard Illumina R1 amorce) (100uM) </td><td> 5 &#39;AC LOI CTT TCC CTA CAC GAC TGC CTT GCC ATC T 3&#39; </td></tr><tr><td> Réactifs de séquençage supplémentaires / Equipement </td><td></td></tr><tr><td> Qiagen MinElute 96 Kit UF purification de PCR </td><td> Qiagen, pièce # 29051 </td></tr><tr><td> Pompe à vide </td><td> Tout vendeur </td></tr><tr><td> Collecteur à vide Macherey-Nagel </td><td> Macherey-Nagel, pièce # 740 681 </td></tr><tr><td> Invitrogen Quant-iT ADNdb BR Assay Kit </td><td> Invitrogen, pièce # Q32853 </td></tr><tr><td> Invitrogen tubes de dosage Qubit </td><td> Invitrogen, pièce # Q32856 </td></tr><tr><td> 40% d&#39;acrylamide, plus de 1% N, N&#39;-méthylène-bis-acrylamide, 37.5:1 </td><td> Bio Rad, pièce # 161-0148 </td></tr><tr><td> Tris Base </td><td> Sigma, pièce # T1503-1KG </td></tr><tr><td> Acide borique </td><td> Sigma, pièce # B6768-500G </td></tr><tr><td> EDTA 0,5 M, pH 8,0 </td><td> Teknova, pièce # E0306 </td></tr><tr><td> Persulfate d&#39;ammonium </td><td> Sigma, pièce # A3678-25G </td></tr><tr><td> TEMED </td><td> Bioshop, pièce # TEM001.25 </td></tr><tr><td> Solution de bromure d&#39;éthidium </td><td> Bioshop, pièce # ETB444.10 </td></tr><tr><td> L&#39;acétate d&#39;ammonium 0,5 M </td><td> Teknova, pièce # A2000 </td></tr><tr><td> 10 mM acétate de magnésium tétrahydraté </td><td> Sigma, pièce # M0631-100G </td></tr><tr><td> 1mM EDTA, pH 8,0 </td><td> Voir EDTA 0,5 M, pH 8,0 </td></tr><tr><td> Éthanol </td><td> Divers </td></tr><tr><td> L&#39;acétate de sodium, pH 5,2 </td><td> Teknova, pièce # S0297 </td></tr><tr><td> Vitesse à vide </td><td> Divers </td></tr><tr><td> Single-Kit Lire Génération Cluster </td><td> Illumina, pièce # GD-300-1001 </td></tr><tr><td> 36c Séquencement v4 kit </td><td>Illumina, pièce # FC-104-4002 </td></tr><tr><td></td><td></td></tr></tbody></table> Recette de TBE 10X <table border="1"><tbody><tr><td> Montants </td><td> Réactifs </td></tr><tr><td> 108 grammes </td><td> Tris Base </td></tr><tr><td> 55 grammes </td><td> Acide borique </td></tr><tr><td> 40mL </td><td> EDTA 0,5 M (pH 8,0) </td></tr><tr><td colspan="2"> Ajouter dH 2 O pour marquer 1L </td></tr></tbody></table> 12% de gel de polyacrylamide recette <table border="1"><tbody><tr><td> Volumes </td><td> Réactifs </td></tr><tr><td> 5,8 ml </td><td> 40% d&#39;acrylamide, plus de 1% N, N&#39;-méthylène-bis-acrylamide, 37.5:1 </td></tr><tr><td> 12 ml </td><td> dH 2 O </td></tr><tr><td> 2 ml </td><td> TBE 10X </td></tr><tr><td> 140 ul </td><td> Persulfate d&#39;ammonium à 10% </td></tr><tr><td> Le volume total: 20ml </td><td></td></tr></tbody></table> Uptag mélange d&#39;amorces: Resuspendre Uptag et Buptagkanmx4 chacun dans ddH 2 O à 100 uM, puis mélanger dans un rapport 1:1 pour une concentration finale de 50 uM de chacun. Conserver à -20 ° C. Downtag mélange d&#39;amorces: Resuspendre Dntag et Bdntagkanmx4 chacun dans ddH 2 O à 100 uM, puis mélanger dans un rapport 1:1 pour une concentration finale de 50 uM de chacun. Conserver à -20 ° C. Oligonucléotides mixtes: Resuspendre chacun des huit suivantes oligos (standard dessalé) dans le trou DDH 2 O à 100 M: Uptag, Dntag, Uptagkanmx, Dntagkanmx, Uptagcomp, Dntagcomp, Upkancomp, Dnkancomp. Mélanger un volume égal de huit oligonucléotides pour une concentration finale de 12,5 uM de chacun. 12X MES stock: Pour 10 ml, dissoudre 0,7 g MES monohydrate d&#39;acide libre et 1,93 g de sel de sodium dans 8 ml MES de biologie moléculaire, l&#39;eau de qualité. Après en mélangeant bien, vérifier le pH et l&#39;ajuster si nécessaire à un pH 6.5 au 6.7. Ajouter l&#39;eau pour un volume total de 10 ml. Filtre stériliser et conserver à 4 ° C à l&#39;abri de la lumière (par exemple, envelopper le tube dans du papier). Remplacer si la solution devient visiblement jaune ou après 6 mois. Tampon d&#39;hybridation 2X: Pour 50 ml, mélanger 8,3 ml de 12X MES stock (à partir de 2.9.14), 17,7 ml de NaCl 5 M, 4,0 ml d&#39;EDTA 0,5 M, 0,1 ml de 10% de Tween 20 (vol / vol), et 19,9 ml filtrée ddH 2 O. Stériliser par filtration. Lavez A: Mélanger 300 ml 20X SSPE, 1 ml de Tween 10% (vol / vol), 699 ml ddH 2 O. Stériliser par filtration. Lavez B: Mélanger 150 ml 20X SSPE, 1 ml de Tween 10% (vol / vol), 849 ml ddH 2 O. Stériliser par filtration. Amorces de séquençage Barcode Dans les séquences des amorces UP-tag 5 &#39;de la queue (en gras) sont des séquences d&#39;Illumina adaptateur spécifique incorporé dans l&#39;apprêt F et R. La séquence variable (en italique) représente la balise indexation 5-mer utilisée dans le multiplexage / index de lecture. La queue du 3 &#39;(souligné) représente l&#39;amorce commune flanquant le code à barres uptag et est nécessaire pour amplifier le code-barres de la levure. Dans BAS-tag apprêt séquences 5 &#39;queue est identique à 5&#39; queue de l&#39;UP-tag amorces (Illumina séquence spécifique), cependant, la 3 &#39;de la queue (souligné) est remplacé par les amorces communs qui sont utilisés pour amplifier le BAS- tag codes à barres.

competitive genomic screens of barcoded yeast libraries

En vertu de progrès dans les technologies de prochaine génération de séquençage, nous avons accès à de nouvelles séquences du génome presque quotidiennement. Le tempo de ces avances est l&#39;accélération, en promettant une plus grande profondeur et la largeur. À la lumière de ces avancées extraordinaires, le besoin de méthodes rapides, parallèlement à définir la fonction des gènes devient de plus en plus important. Les collections de mutants de délétion du génome entier dans les levures et E. coli ont servi comme bêtes de somme pour la caractérisation fonctionnelle de la fonction des gènes, mais cette approche n&#39;est pas extensible, le courant de gènes de suppression des approches nécessitent chacune des milliers de gènes qui composent un génome à être supprimé et vérifiées. C&#39;est seulement après ce travail est terminé nous pouvons poursuivre le phénotypage à haut débit. Au cours des dix dernières années, notre laboratoire a affiné un portefeuille de la concurrence, miniaturisé et à haut débit l&#39;ensemble du génome des dosages qui peuvent être effectuées en parallèle. Cette parallélisation est possible en raison de l&#39;inclusion des «balises» de l&#39;ADN, ou «code-barres,&quot; dans chaque mutant, avec le code à barres servant de proxy pour la mutation et l&#39;on peut mesurer l&#39;abondance de codes à barres pour évaluer l&#39;aptitude de mutants. Dans cette étude, nous cherchons à combler le fossé entre la séquence d&#39;ADN et de code-barres collections de mutants. Pour ce faire, nous introduisons un transposon combinés des perturbations-barcoding approche qui ouvre de tests de codes à barres parallèles à nouveau séquencé, mais mal caractérisé les microbes. Pour illustrer cette approche, nous présentons une nouvelle collection de Candida albicans perturbations code-barres et décrire comment les deux basé sur un microréseau et la prochaine génération de plates-formes basées séquençage peut être utilisé pour collecter 10.000 - 1.000.000 gène-gène et gène-médicament interactions en une seule expérience.

Watch this Scientific Journal Video about Competitive Genomic Screens of Barcoded Yeast Libraries at JoVE.com

Competitive Genomic Screens of Barcoded Yeast Libraries

Nous avons développé complètes, impartiales échelle du génome écrans à comprendre gène-médicament et les interactions gènes-environnement. Méthodes de dépistage de ces collections de mutants sont présentées.

Écrans concurrentiel des bibliothèques génomiques de levure Barcoded

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily.  The tempo of these advances is ...

Research

JoVE Journal

Biology

Large-Scale Screens of Metagenomic Libraries

Grands écrans des banques métagénomiques

Metagenomic libraries archive large fragments of contiguous genomic sequences from microorganisms without requiring prior cultivation.  Generating a ...

Recherche

Biologie

Isolation of Genomic DNA from Mouse Tails

Isolement de l&#39;ADN génomique de souris Tails

Technical Demonstration of Whole Genome Array Comparative Genomic Hybridization

Démonstration technique de l&#39;hybridation tableau Whole Genome génomique comparative

Array comparative genomic hybridization (array CGH) is a method for detecting gains and losses of DNA segments or gene dosage in the genome 1.  Recent ...

Large Insert Environmental Genomic Library Production

Grand Insérer production bibliothèque génomique de l&#39;environnement

The vast majority of microbes in nature currently remain inaccessible to traditional cultivation methods. Over the past decade, culture-independent ...

Purification of Mitochondria from Yeast Cells

Purification des mitochondries de cellules de levure

Mitochondria are the main site of ATP production during aerobic metabolism in eukaryotic non-photosynthetic cells1. These complex organelles also play ...

Development of automated imaging and analysis for zebrafish chemical screens.

Développement de l&#39;imagerie automatisée et d&#39;analyse pour les écrans chimiques du poisson zèbre.

We demonstrate the application of image-based high-content screening (HCS) methodology to identify small molecules that can modulate the FGF/RAS/MAPK ...

Yeast Colony Embedding Method

Méthode d&#39;insertion de levure Colony

Patterning of  different cell types in embryos is a key mechanism in metazoan development. Communities of microorganisms, such as colonies and biofilms ...

Genomic MRI - a Public Resource for Studying Sequence Patterns within Genomic DNA

Genomic IRM - une ressource publique pour l&#39;étude des schémas de séquence dans l&#39;ADN génomique

Non-coding genomic regions in complex eukaryotes, including intergenic areas, introns, and untranslated segments of exons, are profoundly non-random in ...

Genomic Transformation of the Picoeukaryote Ostreococcus tauri

Genomic Transformation of the Picoeukaryote Ostreococcus tauri

Transformation génomique de la Picoeukaryote<em&gt; Ostreococcus tauri</em

Common problems hindering rapid progress in Plant Sciences include cellular, tissue and whole organism complexity, and notably the high level of genomic ...

Selective Capture of 5-hydroxymethylcytosine from Genomic DNA

Capture d&#39;sélectif de 5-hydroxyméthylcytosine partir de l&#39;ADN génomique

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene ...