Name: prediction of hiv-1 coreceptor usage (tropism) by sequence analysis using a genotypic approach
Uploaded: 2011-12-01T13:00:00
Duration: 7 min 6 s
Description: Watch this Scientific Journal Video about Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach at JoVE.com

저자는 Corus, MedSys 셀 입력, 체인 및 Resina 프로젝트에서 재정 지원을하고 있습니다.

프로토콜은 그림에 요약되어 있습니다. 4. 1. 혈액 샘플 수집 <ol><li> 임상 사이트에서 EDTA (에틸렌 다이아 민 테트라 초산) 튜브의 최소 3 ML의 피를 수집합니다. </li><li> 샘플은 4 ° C.에서 주일까지 저장 될 수있다 </li><li> 일반 우편으로 즉시 실험실로 가능한 한 EDTA (에틸렌 다이아 민 테트라 초산) - 혈액 샘플을 보낼 수 있습니다. </li></ol> 2. HIV RNA 및 / 또는 DNA의 분리 <ol><li> 마그나 순수 컴팩트 핵산 절연 I 키트 I와 마그나 순수 컴팩트 시스템을 사용하여, 1000 μl 전체 혈액, 혈청 또는 혈장에서 바이러스 성 RNA 및 / 또는 DNA를 구합니다. </li><li> 50 μl TE 버퍼에 얻은 RNA 나 DNA를 Elute. 또한, 다른 핵산 정화 절차를 사용할 수 있습니다. </li></ol> 3. 유럽​​ 표준안 지역의 증폭 플라즈마 RNA 또는 DNA proviral 하나의 유럽 표준안 지역 (도 2 및 4) 증폭. 환경을 단백질의 대부분을 포함하는 1245 BP-긴 제품 (NT 6556-7811 accordinHXB2에 대한 g)가 생성됩니다. <ol><li> RNA 샘플 : RT-PCR 반응 <ol><li> 바이러스 성 RNA는 RT 반응을 방해 할 수 있습니다 매우 복잡한 이차 구조 (그림 4) 제공합니다. 이 문제를 방지하려면 10 분 (이미 PCR 튜브 및 PCR 기계에서)에 대해 65 ° C에서 10 μl RNA를 배양 한 후 50 ° C.에 온도를 감소 </li><li> 프리 머 환경을-F와 환경을-R을 포함하여 PCR 마스터 믹스의 40 μl를 추가합니다. 하우스 - 시스템에서 RT-PCR을위한 마스터 믹스 : <table border="1"><tbody><tr><td></td><td> 볼륨 / 반응 (μl) </td><td> 최종 농도 </td></tr><tr><td> RNase 무료 H 2 O </td><td> 14.4 </td><td></td></tr><tr><td> 5 배 버퍼 (Qiagen OneStep RT-PCR 키트) </td><td> 10 </td><td> 1X </td></tr><tr><td> 5 배 Q-솔루션 </td><td> 10 </td><td> 1X </td></tr><tr><td> dNTP 믹스 (10 MM 각) </td> &lt;TD&gt; 2 </td><td> 각 dNTP 400 μM </td></tr><tr><td> Enzym - 믹스 (Qiagen OneStep RT-PCR 키트) </td><td> 이 </td><td></td></tr><tr><td> 프라이머 환경을-F (100 μM) </td><td> 0.3 </td><td> 0.6 μM </td></tr><tr><td> 프라이머 환경을-R (100 μM) </td><td> 0.3 </td><td> 0.6 μM </td></tr><tr><td> RNase 억제제 (RNasin) </td><td> 1 </td><td> 5 단위 / 반응 </td></tr></tbody></table> 환경을-F : 5&#39;-CAAAGCCTAAAGCCATGTGTAAA의 -3 &#39;(NT 6,556 → 6,586 HXB2에 따라) 환경을-R : 5&#39;-AGTGCTTCCTGCTGCTCCTAAGAACCC -3 &#39;(← 7,811 NT 7785) </li><li> 30 분 50 ° C에서 RT 반응을 실행합니다. </li><li> 다음과 같이 첫 번째 PCR을 실행합니다 : <table border="1"><tbody><tr><td> 95 ° C, 15 분 </td><td> 1 개 </td></tr><tr><td> 95 ° C, 30 초 50 ° C, 30 초 72 ° C, 2 분 </tD&gt; <td> 1 개 </td></tr><tr><td> 95 ° C, 30 초 56 ° C, 30 초 72 ° C, 2 분 </td><td> 38 X </td></tr><tr><td> 72 ° C, 10 분 4 ° C ∞ </td><td></td></tr></tbody></table></li></ol></li><li> DNA 샘플 : PCR 반응 proviral DNA 샘플를 들어, 초기 RT 반응이 필요하지 않습니다, 그리고 PCR 반응에 직접 시작할 수 있습니다. <ol><li> provial DNA의 10 μl로 PCR 마스터 믹스의 40 μl를 추가합니다. 하우스 - 시스템에서 PCR을위한 마스터 믹스 : <table border="1"><tbody><tr><td></td><td> 볼륨 / 반응 (μl) </td><td> 최종 농도 </td></tr><tr><td> RNase 무료 H 2 O </td><td> 15.4 </td><td></td></tr><tr><td> 5 배 버퍼 (HotStarTaq의 DNA 중합 효소) </td><td> 10 </td><td> 1X </td></tr><tr><td> 5 배 Q-솔루션 </td><td> 10 </td><td> 1X </td></tr><tr><td> dNTP 믹스 (10 MM 각) </td><td> 이 </td><td> 각 dNTP 400 μM </td></tr><tr><td> Enzym - 믹스 (HotStarTaq의 DNA 중합 효소) </td><td> 이 </td><td></td></tr><tr><td> 프라이머 환경을-F (100 μM) </td><td> 0.3 </td><td> 0.6 μM </td></tr><tr><td> 프라이머 환경을-R (100 μM) </td><td> 0.3 </td><td> 0.6 μM </td></tr></tbody></table> 환경을-F : 5&#39;-CAAAGCCTAAAGCCATGTGTAAA의 -3 &#39;(→ 6,586 NT 6556) 환경을-R : 5&#39;-AGTGCTTCCTGCTGCTCCTAAGAACCC -3 &#39;(← 7,811 NT 7785) </li><li> 이전 RNA 샘플 (단계 3.1.4)에 대한 설명으로 PCR 조건을 실행합니다. </li></ol></li></ol> 4. V3 지역의 증폭 : 중첩 된 PCR <ol><li> 중첩 된 PCR를 들어, 템플릿으로 첫 번째 PCR 반응 (아가로 오스 겔에서 이전 분석없이)에서 5 μl를 사용하여 PCR 매스의 95 μl를 추가합니다적이 섞는다. 중첩 - 인 - 하우스 PCR을위한 마스터 믹스 <table border="1"><tbody><tr><td></td><td> 볼륨 / 반응 (μl) </td><td> 최종 농도 </td></tr><tr><td> H 2 O </td><td> 61.9 </td><td></td></tr><tr><td> 10X PCR 버퍼 </td><td> 10 </td><td> 1X </td></tr><tr><td> 5 배 Q-솔루션 </td><td> 20 </td><td> 1X </td></tr><tr><td> dNTP 믹스 (10 MM 각) </td><td> 이 </td><td> 각 dNTP 200 μM </td></tr><tr><td> 프라이머 환경을-2F (100 μM) </td><td> 0.3 </td><td> 0.6 μM </td></tr><tr><td> 프라이머 환경을-2R (100 μM) </td><td> 0.3 </td><td> 0.6 μM </td></tr><tr><td> HotStarTaq의 DNA 중합 효소 </td><td> 0.5 </td><td> 2,5 단위 / 반응 </td></tr></tbody></table> 환경을 - 2 층 : 5&#39;-GTCCAAAGGTATCCTTTGAGCCAATTC -3 &#39;(NT 6,838 → 6,864) <strong&gt; 환경을-2R : 5&#39;-CACCACTCTTCTCTTTGCCTTGGTGGGTGC -3 &#39;(← 7,742 NT 7712) </li><li> 다음과 같이 PCR을 실행합니다 : <table border="0"><tbody><tr><td> 93 ° C, 15 분 </td><td> 1 개 </td></tr><tr><td> 95 ° C, 30 초 50 ° C, 30 초 72 ° C, 90 초 </td><td> 1 개 </td></tr><tr><td> 95 ° C, 30 초 56 ° C, 30 초 72 ° C, 90 초 </td><td> 43 X </td></tr><tr><td> 72 ° C, 10 분 4 ° C ∞ </td><td></td></tr></tbody></table></li><li> 1 % 아가로 오스 겔 (그림 4)에서 PCR 제품을 분석합니다. 예상 제품은 902 BP-깁니다. </li><li> 시퀀싱 샘플 정화. <ol><li> 공급 업체가 제공하는 프로토콜 솔루션 및 마이크로 열을 사용하여 Qiagen PCR-정화 키트 PCR 제품을 정화. 밴드 강도에 따라 30-100 μl PE 버퍼에 Elute. </li><li> 또는 샘플이 Exonuclease를 사용하여 정화 할 수 있습니다I 빠른 AP (열 알칼리성 인산 가수 분해 효소). 이러한 목적을 위해, 15 μl PCR 제품에 6 μl 엑소-AP 믹스를 추가하고 37 15 분 품다 ° C. <table border="1"><tbody><tr><td> 580 μl H 2 O </td></tr><tr><td> 66 μl 빠른 AP </td></tr><tr><td> 13.4 μl 엑소 I </td></tr></tbody></table></li></ol></li></ol> 5. V3의 amplicon의 순서 반응 <ol><li> 순서 반응은 다음과 프리 머 중 하나를 사용하여 PCR 반응으로 구성되어 있습니다 : 환경을-2 : 5&#39;-GTACAATGYACACATGGAATTAGGC -3 (→ 6,980 NT 6959) 환경을-5 : 5&#39;-AAAATTCCCCTCCACAATTA - 3 &#39;(← 7,371 NT 7352) 환경을-6 : 5&#39;-GGCCAGTAGTATCAACTCAAC - 3 &#39;(→ 7,000 NT 6979) 환경을-7 : 5&#39;-TGTCCACTGATGGGAGGGGC - 3 &#39;(← 7,549 NT 7530) 환경을-10 : 5 &#39;- GCAGAATAAAACAAATTATAAACATGTGGC - 3&#39;(← 7,507 NT 7478) 환경을-11 : 5 &#39;- TACATTGCTTTTCCTACTTTCTGCCAC - 3&#39;(← 7,664 NT 7638) 첫 번째 선택 프리 머은 다음과 같습니다 환경을-2, 환경을-6 또는 환경을-7, 환경을-11 </li><li> 템플릿으로 정화 V3의 amplicon에서 1 μl를 사용하여 PCR 마스터 믹스 9 μl를 추가합니다. 마스터 믹스를 순서 : <table border="1"><tbody><tr><td> 4 μl 순서 믹스 (HIV-Genotyping 키트) </td></tr><tr><td> 4 μl H 2 O </td></tr><tr><td> 1 μl 입문서 (100 pmol / μl) </td></tr></tbody></table></li><li> 다음과 같은 순서 반응을 실행합니다 : <table border="0"><tbody><tr><td> 96 ° C, 10 초 </td><td></td></tr><tr><td> 50 ° C, 10 초 </td><td> 36 X </td></tr><tr><td> 60 ° C, 45 초 </td><td></td></tr><tr><td> 4 ° C ∞ </td><td></td></tr></tbody></table></li></ol> 6. 시퀀싱 샘플 정화 시퀀스 usi 정화NG Sephadex G-50 극상의. <ol><li> Sephadex G-50 극상의와 &#39;열 로더 &quot;에 우물의 적절한 수를 입력합니다. 이상 설정하여 필터 판 MAHVN4510에 Sephadex를 전송합니다. </li><li> 필터 플레이트의 각도에 300 μl 밀리 Q H 2 O를 추가하고 2-8에서 최소한 3h을 위해 길러 ° C. </li><li> 910Xg 및 4-15 ° C.에서 5 분의 번호판을 원심 분리기 흐름을 통해 폐기하십시오. </li><li> 순서 제품 및 다음 악단 Sephadex 판에 pipet 순서에 10 μl H 2 O를 추가합니다. </li><li> 정화 제품을 얻으려면 5 분의 판을 원심 분리기. 910Xg 및 4-15에서 ° C와 흐름을 통해 수집합니다. </li></ol> 7. 시퀀서 ABI 프리즘 3130 XL에 정화 샘플을 시퀀스 <ol><li> 각 실행하기 전에 버퍼를 변경 폴리머 (POP7)의 볼륨을 확인합니다. 필요한 경우, 새로운 하나 기존의 폴리머 플라스크를 교체하십시오. </li><li> 18초의 주입 시간을 포함하여 저장된 실행 조건을 사용. </li><li> 이 기계에서, 16​​ 순서 샘플과 하나가 실행의 신호 데이터의 수집은 약 60 분 (36cm 모세관) 또는 150 분 (50cm 모세관)이 소요됩니다. </li></ol> 8. 순서 편집 <ol><li> 시퀀스 (그림 5) 정렬 및 편집하는 프로그램 Lasergene (DNA-스타)를 사용합니다. 다른 시퀀스 편집 프로그램을 사용할 수 있습니다. &quot;V3 - 연합의 B&quot;와 참조로 환경을 합의 순서를 사용합니다. </li><li> Lasergene이 가능하며, FASTA 파일로 저장 모든 원시 데이터를 사용하여 분석 샘플의 합의 순서를 만듭니다. FASTA 파일은 샘플의 이름과 염기 순서와 헤더를 포함하는 텍스트 파일입니다. </li></ol> 9. 데이터 해석 및 tropism 예측을 시퀀싱 <ol><li> 데이터 해석을 시퀀싱하는 것은 웹 기반 통역 시스템에 의해 수행되는 geno2pheno [coreceptor] ( <a href="http://coreceptor.bioinf.mpi-inf.mpg.de/index.php">http://coreceptor.bioinf.mpi-inf.mpg.de/</a>index.php). tropism 예측의 경우, 다른 FPR 설정을 선택할 수 있습니다. 기본 설정은 독일 - 오스트리아 치료 가이드 라인에 따라 수 있습니다. FPR ≥ 20 %, 바이러스는 R5로 분류 할 때 FPR ≥ 20 %, FPR &lt;12.5 %에 X4. </li><li> 서버에 FASTA 파일을 업로드합니다. 이 서버는, 아미노산으로 염기 순서를 변환 V3 - 연합의 B 순서로 정렬하고 하위 유형 분류를 생산하고 있습니다. 또한, 거짓 긍정적 인 속도 (FPR)으로 표현 (그림 4) coreceptor 사용량 예측을 생성합니다. </li></ol> 10. 대표 결과 geno2pheno [coreceptor] 출력 tropism의 등급 해석을 보여줍니다. coreceptor 사용 가능성에 따라, 통역 텍스트와 배경 색상이 가능한, 낮은 위험을 제안하고 마지막으로 빨간색으로, 노란색으로, MVC에 대한 안전 관리를 제안, 녹색 (&lt;20 %의 FPR)에서 다릅니다. 레드 제안 색MVC를 처방하지 들죠. 또한, 서버는 환자의 및 샘플 데이터를 채워 인쇄 할 수있는 PDF 보고서를 생성하고, 의사에게 보냈습니다. geno2pheno [coreceptor] 출력의 예는 그림에 묘사되어 있습니다. 6. <img alt="그림 1" src="/files/ftp_upload/3264/3264fig1.jpg" /> 그림. 1. HIV의 개략적 복제를 수행합니다. virion은 수용체와 세포 CD4에 바인딩해야하고 coreceptor로 CCR5 또는 CXCR4를 하나 할 수 있습니다. coreceptor CCR5는 Maraviroc과 같은 CCR5의 antagonists (MVC, Celsentri, Selzentry)로 차단 될 수 있습니다. 바이러스 및 세포 멤브레인의 융합 후, 바이러스 nucleocapsid는 세포질에 출시된다. nucleocapsid는 disassembles 및 바이러스 RNA 단지는 세포질에 해방이다. 바이러스 역 transcriptase (RT)는 다음 핵으로 옮겨와 HIV integrase에 의해 호스트 게놈에 통합되어 proviral DNA로 게놈 RNA를 transcribes. 세포 RN​​A polymerases traproviral 게놈에서 바이러스 게놈과 메신저 RNAs를 nscribe. 바이러스 성 단백질은 세포질에서 생산 및 세포 표면으로 이송됩니다. 세포에서 젊고, 비 전염성 virions와 같은 바이러스 입자의 꽃 봉오리. HIV 프로테아제는 전염성 입자를 생산 단백질을 cleaves. 단계 중 하나의 억제는 복제주기의 중단에 연결됩니다. 그들은 억제하는 antiretroviral 약물과 복제 단계는 빨간색으로 표시되어 있습니다. 바이러스 RNA와 DNA proviral (자료가 tropism 또는 저항 분석에 사용)은 녹색으로 표시됩니다. <img alt="그림 2" src="/files/ftp_upload/3264/3264fig2.jpg" /> 그림 2. HIV proviral 게놈은. HIV 입자는 서로 다른 구조 단백질과 주택 바이러스와 세포의 기원에서 모두 다양한 효소 및 단백질과 함께 내장되어 있습니다. 그림 쇼바이러스 게놈 내의 유전자의 위치가있어. 표면은 gp120과 gp41는 virion의 표면에 스파이크를 구성하고, 막 융합을 수행 할 수있는 인간의 세포에 문의 단백질. 그림의 아래 부분에서 PCR 증폭 제품 및 프로토콜에서 사용되는 프리 머이 표시됩니다. <img alt="그림 3" src="/files/ftp_upload/3264/3264fig3.jpg" /> 그림 3. 낮은 바이러스 부하 (VL) 환자의 비율 쾰른 (Cologne)의 바이러스학, 대학 (독일)의 연구소에서 약물 저항 또는 tropism 결정을위한 분석 측정. <img alt="그림 4" src="/files/ftp_upload/3264/3264fig4.jpg" /> 4 그림. 실험의 전체 구조 .. 하시기 바랍니다 <a href="http://www.jove.com/files/ftp_upload/3264/3264fig4_lg.jpg">여기를 클릭하십시오</a> 이 그림의 더 큰 버전을 볼 수 있습니다. <img alt="그림 5" src="/files/ftp_upload/3264/3264fig5.jpg" /> 그림 5. 순서는 Lasergene의 편집. V3의 amplicon은 적어도 앞으로 하나 하나 역 프라이머와 순서가 있습니다. Lasergene는 참조 시퀀스 &quot;V3 - 서스 B&quot;로 시퀀서에서 얻은과 환경을 &quot;. ABI&quot;파일을 alignes. Lasergene 모든 행 데이터 제공을 사용하여 합의 순서를 만듭니다. 그들은 샘플 합의 순서에 기여하지 않도록 참조 시퀀스는 (그리고 회색으로 표시됩니다) 표시 될 수 있습니다. <img alt="그림 6" src="/files/ftp_upload/3264/3264fig6.jpg" /> 6 그림. geno2pheno에 의해 생성 된 Tropism 예측 보고서 [coreceptor] tool.The 보고서 저장되고 컴퓨터에 완료 할 수 PDF 파일로 생성됩니다. 추가 데이터 등 우리가 환자의 이름, 혈액 추출 날짜 등을 수동으로 PDF 작가 프로그램을 사용하여 포함 할 수 있습니다. 특정 의견도 추가 할 수 있습니다. Thes전자 데이터는 사용자의 컴퓨터에 아닌 geno2pheno [coreceptor] 서버에만 있습니다. 하시기 바랍니다 <a href="http://www.jove.com/files/ftp_upload/3264/3264fig6_lg.jpg">여기를 클릭하십시오</a> 이 그림의 더 큰 버전을 볼 수 있습니다.

<ol>
	<li>Heger, E., Schuelter, E., Klimkait, T., Lengauer, T., Kaiser, R., Walter, H., Sierra, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=European+coreceptor+proficiency+panel+test.">European coreceptor proficiency panel test.</a> , (2011).</li><li>Lengauer, T., Sander, O., Sierra, S., Thielen, T., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioinformatic+prediction+of+HIV+coreceptor+usage.">Bioinformatic prediction of HIV coreceptor usage.</a> Nature Biotech. 25 (12), 1407-1410 (2007).</li><li>McGovern, R., Dong, W., Zhong, X., Knapp, D., Thielen, A., Chapman, D., Lewis, M., James, I., Valdez, H., Harrigan, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Population-based+Sequencing+of+the+V3-loop+Is+Comparable+to+the+Enhanced+Sensitivity+Trofile+Assay+in+Predicting+Virologic+Response+to+Maraviroc+of+Treatment-na+ve+Patients+in+the+MERIT+Trial.">Population-based Sequencing of the V3-loop Is Comparable to the Enhanced Sensitivity Trofile Assay in Predicting Virologic Response to Maraviroc of Treatment-na ve Patients in the MERIT Trial.</a> , (2010).</li><li>Reuter, S., Braken, P., Jensen, B., Sierra-Aragon, S., Oette, M., Balduin, M., Kaiser, R., Haussinger, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maraviroc+in+treatment-experienced+patients+with+HIV-1+infection+-+experience+from+routine+clinical+practice.">Maraviroc in treatment-experienced patients with HIV-1 infection - experience from routine clinical practice.</a> Eur. J. Med. Res. 15 (6), 231-237 (2010).</li><li>Recordon-Pinson, P., Soulie, C., Flandre, P., Descamps, D., Lazrek, M., Charpentier, C., Montes, B., Trabaud, M. A., Cottalorda, J., Schneider, V., Morand-Joubert, L., Tamalet, C., Desbois, D., Mace, M., Ferre, V., Vabret, A., Ruffault, A., Pallier, C., Raymond, S., Izopet, J., Reynes, J., Marcelin, A. G., Masquelier, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+genotypic+prediction+of+HIV-1+coreceptor+use+versus+a+phenotypic+assay+and+correlation+with+the+virological+response+to+maraviroc:+the+ANRS+GenoTropism+study.">Evaluation of the genotypic prediction of HIV-1 coreceptor use versus a phenotypic assay and correlation with the virological response to maraviroc: the ANRS GenoTropism study.</a> Antimicrob. Agents. Chemother. 54 (8), 3335-3340 (2010).</li><li>Swenson, L. C., Knapp, D., Harrigan, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+and+accuracy+of+the+geno2pheno+co-receptor+algorithm+for+predicting+HIV+tropism+for+single+and+triplicate+measurements+of+V3+genotype.">Calibration and accuracy of the geno2pheno co-receptor algorithm for predicting HIV tropism for single and triplicate measurements of V3 genotype.</a> , (2010).</li><li>Macartney, M. J., Cameron, J., Strang, A., Garc&#237;a, A., Booth, C., Marshall, N., Johnson, M., Geretti, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+a+genotypic+assay+for+the+prediction+of+HIV-1+coreceptor+tropism+and+guiding+the+use+of+CCR5+antagonists+in+clinical+practice.">Use of a genotypic assay for the prediction of HIV-1 coreceptor tropism and guiding the use of CCR5 antagonists in clinical practice.</a> , (2010).</li><li>Sierra, S., Thielen, A., Reuter, S., Jensen, B., Esser, S., F&#228;tkenheuer, G., Lengauer, T., Pfister, H., Sichtig, N., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tropism+determination+and+clinical+outcome+of+61+patients+under+MVC+treatment.">Tropism determination and clinical outcome of 61 patients under MVC treatment.</a> , (2010).</li><li>Obermeier, M., Carganico, A., Bieniek, B., Schleehauf, D., Dupke, S., Fischer, K., Freiwald, M., Neifer, S., Schuler, C., Mayr, C., Klausen, G., K&#246;ppe, S., &#252;&#252;nsche, T., Berg, T., Baumgarten, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tropism+testing+from+proviral+DNA+-+analysis+of+a+subgroup+from+the+Berlin+Maraviroc+cohort.">Tropism testing from proviral DNA - analysis of a subgroup from the Berlin Maraviroc cohort.</a> , (2010).</li><li>Vandekerckhove, L. P., Wensing, A. M., Kaiser, R., Brun-Vezinet, F., Clotet, B., De Luca, A., Dressler, S., Garcia, F., Geretti, A. M., Klimkait, T., Korn, K., Masquelier, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=European+guidelines+on+the+clinical+management+of+HIV-1+tropism+testing.">European guidelines on the clinical management of HIV-1 tropism testing.</a> Lancet Infect Dis. 11 (5), 394-407 (2011).</li><li>Walter, H., Eberle, J., M&#246;ller, H., Noah, C., Wolf, E., St rmer, M., Braun, P., Krn, K., D umer, M., Berg, T., Obermeier, M., Thielen, A., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Empfehlung+zur+Bestimmung+des+HIV-1-Korezeptor-Gebrauchs+(DAIG+Recommendations+for+the+HIV-1+tropism+testing).">Empfehlung zur Bestimmung des HIV-1-Korezeptor-Gebrauchs (DAIG Recommendations for the HIV-1 tropism testing).</a> , (2011).</li><li>Obermeier, M. J., Carganico, A., Dupke, S., Schranz, D., Cordes, C., Freiwald, M., Klausen, G., K&#246;ppe, S., Schuler, C., Mayr, C., Schleehauf, D., Berg, T., Krznaric, I., Baumgarten, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+application+of+genotypic+co-receptor+tropism+testing+from+viral+RNA+and+proviral+DNA:+week+24+analysis+of+the+Berlin+maraviroc+cohort.">Clinical application of genotypic co-receptor tropism testing from viral RNA and proviral DNA: week 24 analysis of the Berlin maraviroc cohort.</a> Journal of the International AIDS Society. 13, 129-129 (2010).</li><li>Toma, J., Frantzell, A., Hoh, R., Martin, J., Deeks, S., Petropoulos, C., Huang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determining+HIV-1+Co-receptor+Tropism+Using+PBMC+Proviral+DNA+Derived+from+Aviremic+Blood+Samples.">Determining HIV-1 Co-receptor Tropism Using PBMC Proviral DNA Derived from Aviremic Blood Samples.</a> , (2010).</li></ol>

이 비디오 문서는 바이브 의료와 GlaxoSmithKline에 의해 후원됩니다.

3-9 임상 연구에 도시 된 바와 같이 V3 순서는 신뢰할 수있는 바이러스 tropism 예측을 할 수 있습니다. 사실, genotypic 결정은 현재 유럽과 독일 오스트리아 가이드 라인 (10)에 고려된다. phenotypic 테스트에 비해뿐만 아니라, 짧은 매출 시간 (저항 테스트에 해당)이며,뿐만 아니라 비용입니다. 또한, genotypic 테스트의 주요 이점은 결과가 FPR로 등급이 있으며, 따라서 환자의 요구에 적응 할 수 있다는 것입니다. Trofile 결과는 반면에, 단순히 R5 또는 X4 보고서이며, 원시 데이터에 대한 액세스는 제공되지 않습니다. 오스트리아 - 독일어 가이드 라인을 각 환자의 요구에 11 컷 - 오프 구체적으로 FPR을 채택 할 수있는 동안 현재, 유럽 가이드 라인은, 20 % (10)의 FPR 컷 - 오프를하는 것이 좋습니다. 이 라인에서 antiretroviral 약물 옵션 광범위한 높은 FPR 컷 - 오프 (&gt; 20 %) 환자에 대한 recomm 아르종료되었습니다. 반대로,에 대한 제한된 치료 옵션으로 크게 사전 처리 환자, 낮은 FPR 컷 - 오프는 (&gt; 5 %) 사용할 수 있습니다. 치료 지침의이 종류는 현재 부분적으로 활성화 된 의약품이 감소 치료 옵션이있는 환자의 치료에 포함 할 수 있습니다 NRTIs, NNRTIs, 싸개, 그리고 INIs에 테스트 저항에 의해 진행됩니다. 또한, genotypically 유도 치료 변경의 증가 숫자는 임상 적으로 관련성이 높은 FPR 컷 오프는 지속적으로 bioinformaticians, virologists와 임상의 패널에 의해 조정되고 있습니다. genotypic tropism 테스트의 또 다른 중요한 이점은 매우 낮은 또는 탐지 바이러스 부하 (VL)과 임상 샘플을 분석의 가능성입니다. 이 경우에는, 플라즈마 RNA는 amplifiable하지 않을 때, proviral DNA는 순서가 될 수 있으며 신뢰할 수있는 예측 9,12에 사용됩니다. 참고, 낮은 또는 탐지 바이러스 부하 환자의 수는 급격히 최신 년 증가했다. , T 날짜를 기입하기rofile 분석은 VL 환자 &lt;1000 사본 / ML에서 샘플 분석을 할 수 있습니다. 그러나 예비 연구 proviral DNA도 Trofile 13에서 테스트 할 adecuate 할 수 있습니다 것으로 나타났습니다.

<table border="1"><tbody><tr><td> 시약의 이름 </td><td> 회사 </td><td> 카탈로그 번호 </td><td> 코멘트 </td></tr><tr><td> 마그나 순수 컴팩트 핵산 절연 키트 I </td><td> 로슈 진단 </td><td> 04 802 993 001 </td><td></td></tr><tr><td> 마그나 순수 컴팩트 시스템 </td><td> 로슈 진단 </td><td> 03731146001 </td><td></td></tr><tr><td> T3000 Thermocycler </td><td> Biometra </td><td> 050-723 </td><td></td></tr><tr><td> 한 단계 RT-PCR 키트 </td><td> Qiagen </td><td> 210215 </td><td></td></tr><tr><td> HotStarTaq 마스터 믹스 키트 </td><td> Qiagen </td><td> 203445 </td><td></td></tr><tr><td> QIAquick PCR 정화 키트 </td><td> Qiagen </td><td> 28,106 </td><td></td></tr><tr><td> Exonuclease I (엑소 I) </td><td> Fermentas </td><td> EN0582 </td><td></td></tr><tr><td> Thermosensitive 알카라인 인산 가수 분해 효소를 FastAP </td><td> Fermentas </td><td> EF0651 </td> &lt;TD&gt; </td></tr><tr><td> BigDye 터미네이터 v3.1 사이클 시퀀싱 키트 </td><td> 응용 Biosystems </td><td> 4337457 </td><td></td></tr><tr><td> Sephadex G-50 극상의 </td><td> GE 헬스 케어 </td><td> 17-0041-01 </td><td></td></tr><tr><td> ABI 프리즘 3130 XL 모세관 시퀀서 </td><td> 응용 Biosystems </td><td> 3130XL </td><td></td></tr></tbody></table>

prediction of hiv-1 coreceptor usage (tropism) by sequence analysis using a genotypic approach

Maraviroc은 (MVC) coreceptor의 antagonists의 클래스에서 처음 허가 된 antiretroviral 약물입니다. 그것은 인간의 면역 세포를 (그림 1) 감염하기 위해 HIV의 변종의 대다수에 의해 사용되는 호스트 coreceptor CCR5에 바인딩합니다. 다른 HIV의 분리는 다른 coreceptor, CXCR4를 사용합니다. 사용되는 수용체의 환경을 단백질 (그림 2)에 의해 바이러스에 결정됩니다. 사용 coreceptor에 따라 바이러스는 각각 R5 또는 X4로 분류됩니다. MVC는 억제 CCR5 수용체 대상 셀에 R5 바이러스의 항목에 바인딩합니다. 질병의 과정에서, X4 바이러스가 등장하고 R5 바이러스를 지나치게 자라다 수 있습니다. EMA와 FDA에 의해 요구로 coreceptor 사용 (또한 tropism이라고도 함)의 결정 따라서 이전에 MVC의 관리에 필수입니다. MVC 효율 동기를 부여 장점 및 1029에 대한 연구는이 sophi에 따라 고품질의 분석이다 모노그램, 샌프란시스코, 미국의 Trofile 분석을 수행 한sticated 재조합 테스트. 유럽​​ 의사가 아니라도 수반하는 저항 테스트를 제공하는 분산 형 전문 실험실, 작업하는 경향이 있기 때문에 일상이 테스트에 대한 동의는 미국 이외의 형편입니다. 이 연구소는 여러 품질 보증 평가, 2011 년 1 제시되는 마지막 공사를하고 있습니다. 지금은 몇 년 동안, 우리는 HIV 유럽 표준안-V3 유전자 지역 (V3) 2 서열 분석을 기반으로 tropism의 결정을 수행했습니다. 이 지역은 신뢰할 수있는 예측을 수행 할 충분한 정보를 운반한다. 짧은 회전율 시간 (저항 테스트에 해당), 비용 절감, 환자의 요구에 결과를 적응할 수 가능성이 매우 낮거나 심지어 감지 바이러스 부하 (VL과 임상 샘플을 분석 가능성 : coreceptor 사용의 genotypic 결정과 같은 이점을 제공합니다 ), 특히 이후 VL으로 분석 샘플의 수 &lt;1,000 부 / μl약 (그림 3) 지난 몇 년 동안 증가했다. tropism 테스트에 대한 주요 단계 (그림 4)이 동영상에서 시연 : 1. 혈액 샘플의 수집 2. 플라즈마 및 / 또는 HIV proviral DNA의 혈액 mononuclear 세포에서 HIV RNA의 분리 3. 유럽 ​​표준안 지역의 증폭 4. V3 지역의 증폭 5. V3의 amplicon의 순서 반응 6. 시퀀싱 샘플 정화 7. 정화 샘플을 시퀀스 8. 순서 편집 9. 데이터 해석 및 tropism 예측을 시퀀싱

Watch this Scientific Journal Video about Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach at JoVE.com

Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach

HIV-1의 coreceptor 사용의 예측은 antiretroviral 약물, 즉 coreceptor의 antagonists의 새로운 클래스의 관리가 필요합니다. 그것은의 서열 분석에 의해 수행 될 수<em&gt; 유럽 표준안</em인터넷 기반 통역 시스템을 통해&gt; 유전자 및 그 이후의 해석 (geno2pheno<sub&gt; [coreceptor]</sub&gt;).

Genotypic 접근 방법을 사용하여 시퀀스 분석에 의한 HIV-1 Coreceptor 사용 (Tropism)의 예측

Maraviroc (MVC) is the first licensed antiretroviral drug from the class of coreceptor antagonists. It binds to the host coreceptor CCR5, which is used by ...

<a class="grey_button" href="http://www.jove.com/video/4153"> Espa&ntilde;ol </a>

Research

JoVE Journal

Immunology and Infection

Prediction of HIV-1 Coreceptor Usage (Tropism) by Sequence Analysis using a Genotypic Approach

Assessment of Immunologically Relevant Dynamic Tertiary Structural Features of the HIV-1 V3 Loop Crown R2 Sequence by ab initio Folding

Assessment of Immunologically Relevant Dynamic Tertiary Structural Features of the HIV-1 V3 Loop Crown R2 Sequence by ab initio Folding

하여 HIV - 1 V3 루프 크라운 R2 시퀀스 Immunologically 관련 동적 차 구조 기능의 평가 순이 론적 접는

The antigenic diversity of HIV-1 has long been an obstacle to vaccine design, and this variability is especially pronounced in the V3 loop of the virus' ...

연구

면역학 및 감염병학

Specific Marking of HIV-1 Positive Cells using a Rev-dependent Lentiviral Vector Expressing the Green Fluorescent Protein

그린 형광 단백질을 표현 레브 종속 Lentiviral 벡터를 사용하여 HIV - 1 양성 세포의 특정 마킹

Most of HIV-responsive expression vectors are based on the HIV promoter, the long terminal repeat (LTR). While responsive to an early HIV protein, Tat, ...

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

V3의 HIV - 1 Tropism의 Genotypic 추론 사용 인구를 기반 시퀀싱

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Structure of HIV-1 Capsid Assemblies by Cryo-electron Microscopy and Iterative Helical Real-space Reconstruction

Cryo - 전자 현미경에 의해 HIV - 1 Capsid 어셈블리의 구조와 반복 나선형 실제 공간 재건

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein ...

In vitro Uncoating of HIV-1 Cores

In vitro Uncoating of HIV-1 Cores

HIV - 1 코어의 시험 관내 Uncoating에서

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

New Tools to Expand Regulatory T Cells from HIV-1-infected Individuals

새로운 도구는 HIV-1에 감염된 개인으로부터 규제 T 세포를 확장하려면

CD4+ Regulatory T cells (Tregs) are potent immune modulators and serve an important function in human immune homeostasis. Depletion of Tregs has led to ...

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

HIV-1 감염 CD4의 타고난 감지 평가<sup&gt; +</sup&gt;를 사용하여 형질 수지상 세포에 의한 T 세포<em&gt; 예 생체 내</em&gt; 공동 문화 시스템.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

셀 기반의 ELISA 분석을 사용하여 HIV-1 삼량 봉투 당 단백질의 구조적 평가

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals

HIV-1 양성 개인의 플라즈마에서 엑소 좀의 분리

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. ...

Visualization of HIV-1 Gag Binding to Giant Unilamellar Vesicle (GUV) Membranes

Visualization of HIV-1 Gag Binding to Giant Unilamellar Vesicle GUV Membranes

거대한 단일 층 소포 (GUV) 막 바인딩 HIV-1 개그의 시각화

The structural protein of HIV-1, Pr55Gag (or Gag), binds to the plasma membrane in cells during the virus assembly process. Membrane binding of Gag is an ...