Name: engineering and evolution of synthetic adeno-associated virus (aav) gene therapy vectors via dna family shuffling
Uploaded: 2012-04-02T12:00:00
Description: Watch this Scientific Journal Video about Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling at JoVE.com

المؤلفين الامتنان الدعم المعلقة من مختبرهم، أعضاء الفريق والعمل الذي قامت به الكتلة من CellNetworks التميز في جامعة هايدلبرغ، وكذلك من تشيكا وهاينز شالر (CHS) الأساس. نحن نقدر أن تطور AAV الجزيئية عن طريق الحمض النووي عائلة خلط أصبح حقل نشط جدا منذ نشر موقفنا المبدئي منذ ثلاث سنوات وبالتالي الاعتذار لجميع الكتاب من المنشورات ذات الصلة العمل الذي لا يمكن ونقلت هنا بسبب ضيق المساحة.

1. إعداد مجموعات البلازميد ترميز AAV الجينات قفيصة <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> لتسهيل إعداد الروتيني للكميات كافية من مختلف الجينات AAV (CAP) قفيصة لخلط الحمض النووي لاحق، في البداية subclone هذه الجينات في العمود الفقري البلازميد مشترك. من المهم أن...

<ol>
	<li>Grimm, D., Kay, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+virus+evolution+to+vector+revolution:+use+of+naturally+occurring+serotypes+of+adeno-associated+virus+(AAV)+as+novel+vectors+for+human+gene+therapy.">From virus evolution to vector revolution: use of naturally occurring serotypes of adeno-associated virus (AAV) as novel vectors for human gene therapy.</a> Curr. Gene Ther. 3, 281-304 (2003).</li><li>Grimm, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+methods+for+gene+transfer+vectors+based+on+adeno-associated+virus+serotypes.">Production methods for gene transfer vectors based on adeno-associated virus serotypes.</a> Methods. 28, 146-157 (2002).</li><li>Grimm, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+gene+therapy+vector+evolution+via+multispecies+interbreeding+and+retargeting+of+adeno-associated+viruses.">In vitro and in vivo gene therapy vector evolution via multispecies interbreeding and retargeting of adeno-associated viruses.</a> J. Virol. 82, 5887-5911 (2008).</li><li>Muller, O. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Random+peptide+libraries+displayed+on+adeno-associated+virus+to+select+for+targeted+gene+therapy+vectors.">Random peptide libraries displayed on adeno-associated virus to select for targeted gene therapy vectors.</a> Nat. Biotechnol. 21, 1040-1046 (2003).</li><li>Perabo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+selection+of+viral+vectors+with+modified+tropism:+the+adeno-associated+virus+display.">In vitro selection of viral vectors with modified tropism: the adeno-associated virus display.</a> Mol. Ther. 8, 151-157 (2003).</li><li>Zolotukhin, S., Potter, M., Hauswirth, W. W., Guy, J., Muzyczka, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+"humanized"+green+fluorescent+protein+cDNA+adapted+for+high-level+expression+in+mammalian+cells.">A "humanized" green fluorescent protein cDNA adapted for high-level expression in mammalian cells.</a> J. Virol. 70, 4646-4654 (1996).</li><li>Wobus, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibodies+against+the+adeno-associated+virus+type+2+(AAV-2)+capsid:+epitope+mapping+and+identification+of+capsid+domains+involved+in+AAV-2-cell+interaction+and+neutralization+of+AAV-2+infection.">Monoclonal antibodies against the adeno-associated virus type 2 (AAV-2) capsid: epitope mapping and identification of capsid domains involved in AAV-2-cell interaction and neutralization of AAV-2 infection.</a> J. Virol. 74, 9281-9293 (2000).</li><li>Grimm, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fatality+in+mice+due+to+oversaturation+of+cellular+microRNA/short+hairpin+RNA+pathways.">Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways.</a> Nature. 441, 537-541 (2006).</li><li>Nakai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unrestricted+hepatocyte+transduction+with+adeno-associated+virus+serotype+8+vectors+in+mice.">Unrestricted hepatocyte transduction with adeno-associated virus serotype 8 vectors in mice.</a> J. Virol. 79, 214-224 (2005).</li><li>Koerber, J. T., Jang, J. H., Schaffer, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+shuffling+of+adeno-associated+virus+yields+functionally+diverse+viral+progeny.">DNA shuffling of adeno-associated virus yields functionally diverse viral progeny.</a> Mol. Ther. 16, 1703-1709 (2008).</li><li>Li, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+and+selection+of+shuffled+AAV+genomes:+a+new+strategy+for+producing+targeted+biological+nanoparticles.">Engineering and selection of shuffled AAV genomes: a new strategy for producing targeted biological nanoparticles.</a> Mol. Ther. 16, 1252-1260 (2008).</li><li>Ward, P., Walsh, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+AAV+Cap+sequences+alter+gene+transduction.">Chimeric AAV Cap sequences alter gene transduction.</a> Virology. 386, 237-248 (2009).</li><li>Yang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+myocardium+tropic+adeno-associated+virus+(AAV)+evolved+by+DNA+shuffling+and+in+vivo+selection.">A myocardium tropic adeno-associated virus (AAV) evolved by DNA shuffling and in vivo selection.</a> Proc. Natl. Acad. Sci. U.S.A. 106, 3946-3951 (2009).</li><li>Perabo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combinatorial+engineering+of+a+gene+therapy+vector:+directed+evolution+of+adeno-associated+virus.">Combinatorial engineering of a gene therapy vector: directed evolution of adeno-associated virus.</a> J. Gene. Med. 8, 155-162 (2006).</li><li>Maheshri, N., Koerber, J. T., Kaspar, B. K., Schaffer, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+adeno-associated+virus+yields+enhanced+gene+delivery+vectors.">Directed evolution of adeno-associated virus yields enhanced gene delivery vectors.</a> Nat. Biotechnol. 24, 198-204 (2006).</li><li>Wu, Z., Asokan, A., Samulski, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adeno-associated+virus+serotypes:+vector+toolkit+for+human+gene+therapy.">Adeno-associated virus serotypes: vector toolkit for human gene therapy.</a> Mol. Ther. 14, 316-327 (2006).</li><li>Kwon, I., Schaffer, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designer+gene+delivery+vectors:+molecular+engineering+and+evolution+of+adeno-associated+viral+vectors+for+enhanced+gene+transfer.">Designer gene delivery vectors: molecular engineering and evolution of adeno-associated viral vectors for enhanced gene transfer.</a> Pharm. Res. 25, 489-499 (2008).</li><li>Perabo, L., Huber, A., Marsch, S., Hallek, M., Buning, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Artificial+evolution+with+adeno-associated+viral+libraries.">Artificial evolution with adeno-associated viral libraries.</a> Comb. Chem. High. Throughput. Screen. 11, 118-126 (2008).</li><li>McCarty, D. M., Monahan, P. E., Samulski, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-complementary+recombinant+adeno-associated+virus+(scAAV)+vectors+promote+efficient+transduction+independently+of+DNA+synthesis.">Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis.</a> Gene Ther. 8, 1248-1254 (2001).</li></ol>

هنا، وقد أوجزنا الخطوات التجريبية الأساسية والمبادئ التوجيهية لAAV قفيصة الهندسية عن طريق الحمض النووي الأسرة وخلط للتطور في الخلايا أو في الحيوانات. في جوهره، وهذه البروتوكولات هي إصدارات موحدة من الإجراءات نحن لاول مرة في مجال AAV في 2008 3. في حين أن سلسلة من درا?...

<table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> اسم كاشف </td><td> شركة </td><td> فهرس العدد </td></tr><tr><td> أنا الدناز </td><td> إينفيتروجن </td><td> 18068-015 </td></tr><tr><td> Polyethylenimine (PEI) </td><td> سيغما الدريخ </td><td> 408727 </td></tr><tr><td> تقييد الانزيمات </td><td> NEB </td><td> مختلف </td></tr><tr><td> T4 الحمض النووي يغاز </td><td> NEB </td><td> M0202T </td></tr><tr><td> جل استخلاص عدة </td><td> QIAGEN </td><td> 28704 </td></tr><tr><td> Phusion كيت الثاني بوليميريز </td><td> Finnzymes (NEB) </td><td> F-540S </td></tr><tr><td> HotStar كيت ايفي بوليميريز </td><td> QIAGEN </td><td> 202602 </td></tr><tr><td> DMSO </td><td> Finnzymes (NEB) </td><td> F-540S (جزء من مجموعة) </td></tr><tr><td> EDTA (25 ملم) </td><td> إينفيتروجن </td><td> 18068-015 (جزء من مجموعة) </td></tr><tr><td> تريس </td><td> روث </td><td> 4855.2 </td></tr><tr><td> Ampicilin ملح الصوديوم </td><td> روث </td><td> K029.2 </td></tr><tr><td> dNTPs (10 ملم، و 100 ميكرولتر) </td><td> إينفيتروجن </td><td> 18427013 </td></tr><tr><td> Iodixanol (OptiPrep) </td><td> محور درع </td><td> 1114739 </td></tr><tr><td> Phenolred </td><td> ميرك </td><td> 107241 </td></tr><tr><td> البلازميد عدة الإعدادية ميجا </td><td> QIAGEN </td><td> 12181 </td></tr><tr><td> منبذة فائقة </td><td> بيكمان كولتر، </td><td> أوبتيما L90K </td></tr><tr><td> أنابيب الطرد المركزي السريعة الختم </td><td> بيكمان كولتر، </td><td> 342414 </td></tr><tr><td> Electroporation وحدة </td><td> الحيوي راد </td><td> GenePulserXcell </td></tr><tr><td> الحرارية cycler </td><td> إيبندورف </td><td> Vapo حمايه </td></tr><tr><td> تسخين كتلة </td><td> BIOER </td><td> MB-102 </td></tr><tr><td> مضان المجهر </td><td> أوليمبوس </td><td> IX81 </td></tr><tr><td> FACS محلل </td><td> بيكمان كولتر، </td><td> Cytomics FC500 MLP </td></tr><tr><td> MegaX DH10B الخلايا T1R </td><td> إينفيتروجن </td><td> C640003 </td></tr><tr><td> Benzonase </td><td> ميرك </td><td> 101695 </td></tr><tr><td> اتش-5 </td><td> ATCC </td><td> VR-5 </td></tr><tr><td> pBlueScript الثاني كانساس (+) البلازميد </td><td> Stratagene </td><td> 212207 </td></tr><tr><td> cap5F (PAC أنا في موقع أصفر متواليات cap5 محددة، في جريئة): GACTCTTAATTAACAGGT ATGTCTTTTGTTGATCACCCTCC </td><td> IDTDNA </td><td> عرف التمهيدي </td></tr><tr><td> cap5R (موقع أنا تصاعديا في الخضراء، cap5 محددة متواليات في جريئة): GTGAGGGCGCGCC TTAAAGGGGTCGGGTAAGGTATC </td><td> IDTDNA </td><td> عرف التمهيدي </td></tr></tbody></table>

engineering and evolution of synthetic adeno-associated virus (aav) gene therapy vectors via dna family shuffling

الغدة المرتبطة الفيروسية (AAV) النواقل وتمثل بعض من أكثر السيارات قوة واعدة لنقل الجينات العلاجية الإنسان نتيجة لمزيج فريد من الخصائص المفيدة 1. وتشمل هذه apathogenicity من الفيروسات wildtype الكامنة ومنهجيات متقدمة للغاية لإنتاج عالية عيار، نقاء عالية والسريرية الصف ناقلات المؤتلف 2. وثمة ميزة أخرى خاصة من خلال نظام AAV الفيروسات الأخرى هو توفر ثروة من الأنماط المصلية التي تحدث بشكل طبيعي والتي تختلف في الخصائص الأساسية حتى الآن يمكن أن تكون جميع هندسيا بسهولة كما ناقلات باستخدام 1،2 بروتوكول مشترك. وعلاوة على ذلك، قد وضعت عددا من المجموعات بما فيها منطقتنا مؤخرا استراتيجيات لاستخدام هذه الفيروسات الطبيعية كقوالب لإنشاء ناقلات الاصطناعية التي تجمع بين أي من أصول الأنماط المصلية مدخلات متعددة، أو التي تعزز خصائص عزل وحيد. التقنيات ذات الصلة لتحقيق هذه الأهداف ARه إما خلط الدنا العائلة 3، أي تجزئة مختلف الجينات قفيصة AAV يليه التجمع إعادة الخاصة بهم على أساس homologies جزئي (عادة&gt; 80٪ لمعظم الأنماط المصلية AAV)، أو عرض 4،5 الببتيد، إدخال أي من الأحماض الأمينية عادة من سبعة إلى حلقة المكشوفة من قفيصة الفيروسية حيث الببتيد يتوسط مثالي إعادة الاستهداف إلى نوع من الخلايا المطلوبة. لأقصى قدر من النجاح، وتطبق كل الأساليب بطريقة عالية الإنتاجية التي يتم من خلالها البروتوكولات تصل إلى تحجيم تسفر عن المكتبات من المتغيرات نحو مليون قفيصة متميزة. وتتألف ثم كل نسخة من مزيج فريد من الفيروسات العديدة الأبوية (DNA خلط نهج) أو يحتوي على الببتيد مميزة داخل العمود الفقري للفيروسات نفسها (الببتيد نهج العرض). الخطوة اللاحقة النهائي هو اختيار متكررة من مكتبة من هذا القبيل على الخلايا المستهدفة من أجل إثراء للفرد capsids الوفاء معظم أو من الناحية المثالية جميع متطلبات عملية الاختيار. ويفضل هذا الأخير مشطإيناس ضغط إيجابي، مثل النمو على نوع معين من الخلايا الفائدة، مع اختيار سلبي، للقضاء على سبيل المثال من جميع capsids التفاعل مع المضادة للAAV الأجسام المضادة. هذا المزيج الذي يزيد من احتمالات أن capsids الاصطناعية على قيد الحياة في اختيار تطابق احتياجات تطبيق معين بطريقة ربما لا يكون قد تم العثور عليها في أي AAV التي تحدث بشكل طبيعي عزل. هنا، ونحن نركز على الحمض النووي طريقة عائلة خلط كما نظريا وتجريبيا أكثر تحديا من التقنيات اثنين. وصفنا وشرح جميع الخطوات الضرورية لتوليد واختيار المكتبات AAV تعديلا (الشكل 1)، ومن ثم مناقشة المخاطر والجوانب الهامة من البروتوكولات التي يحتاج المرء أن يكون على علم لكي تنجح مع تطور AAV الجزيئية.

Watch this Scientific Journal Video about Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling at JoVE.com

Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling

علينا أن نبرهن التقنية الأساسية لهندسة جزيئيا وتتطور الغدة المرتبطة الفيروسية الاصطناعية العلاج الجيني (AAV) ناقلات عن طريق الحمض النووي عائلة خلط. وعلاوة على ذلك، ونحن نقدم مبادئ توجيهية عامة وأمثلة لاختيار ممثل وتحليل capsids خيالية فردية مع خصائص محسنة على الخلايا المستهدفة في الثقافة أو في الفئران.

الهندسة وتطور فيروس الغدة اسوشيتد الاصطناعية (AAV) المتجهات العلاج الجيني عن طريق الحمض النووي العائلة الخلط

Adeno-associated viral (AAV) vectors represent some of the most potent and promising vehicles for therapeutic human gene transfer due to a unique ...

Research

JoVE Journal

Immunology and Infection

Engineering and Evolution of Synthetic Adeno-Associated Virus (AAV) Gene Therapy Vectors via DNA Family Shuffling

Generation of Recombinant Influenza Virus from Plasmid DNA

توليد المؤتلف فيروسات الأنفلونزا من الحمض النووي البلازميد

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Generation of Multivirus-specific T Cells to Prevent/treat Viral Infections after Allogeneic Hematopoietic Stem Cell Transplant

توليد خلايا T - Multivirus محددة لمنع / علاج الالتهابات الفيروسية خيفي بعد زرع الخلايا الجذعية المكونة للدم

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully ...

Separation of Single-stranded DNA, Double-stranded DNA and RNA from an Environmental Viral Community Using Hydroxyapatite Chromatography

فصل واحدة الذين تقطعت بهم السبل الحمض النووي ، والحمض النووي المزدوج تقطعت بهم السبل ، والحمض النووي الريبي من جالية الفيروسية البيئة باستخدام الكروماتوغرافيا هيدروكسيباتيت

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2.  Viruses modulate host cell abundance and diversity, ...

Production and Titering of Recombinant Adeno-associated Viral Vectors

إنتاج وناقلات Titering الغدة المؤتلف المرتبطة الفيروسية

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Expanding Cytotoxic T Lymphocytes from Umbilical Cord Blood that Target Cytomegalovirus, Epstein-Barr Virus, and Adenovirus

توسيع الخلايا اللمفاوية T السامة للخلايا من دم الحبل السري أن الفيروس المضخم للخلايا الهدف، فيروس ابشتاين بار، واتش

Virus infections after stem cell transplantation are among the most common causes of death, especially after cord blood (CB) transplantation (CBT) where ...

A Tetracycline-regulated Cell Line Produces High-titer Lentiviral Vectors that Specifically Target Dendritic Cells

خط خلية التتراسيكلين التنظيم وتنتج ناقلات lentiviral عالي عيار التي تستهدف على وجه التحديد خلايا الجذعية

Lentiviral  vectors (LVs) are a powerful means of delivering genetic material to many types  of cells. Because of safety concerns associated with these ...

Cell-based Flow Cytometry Assay to Measure Cytotoxic Activity

Cytolytic activity of CD8+ T cells is rarely evaluated. We describe here a new cell-based assay to measure the capacity of antigen-specific CD8+ T cells ...

Propagation of Homalodisca coagulata virus-01 via Homalodisca vitripennis Cell Culture

Propagation of Homalodisca coagulata virus-01 via Homalodisca vitripennis Cell Culture

نشر<em&gt; Homalodisca coagulata فيروس-01</em&gt; عبر<em&gt; Homalodisca vitripennis</em&gt; الثقافة خلية

The glassy-winged sharpshooter (Homalodisca vitripennis) is a highly vagile and polyphagous insect found throughout the southwestern United States. These ...

A Simple and Efficient Approach to Construct Mutant Vaccinia Virus Vectors

مقاربة بسيطة وفعالة لبناء ناقلات الفيروسات المسخ الوقس

The CRISPR-associated endonuclease Cas9 can edit particular genomic loci directed by a single guide RNA (gRNA). The CRISPR/Cas9 system has been ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

تقييم فعالية وسمية الرنا استهداف HIV-1 الإنتاج للاستخدام في الجينات أو العلاج بالعقاقير

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...