Name: engineering and evolution of synthetic adeno-associated virus (aav) gene therapy vectors via dna family shuffling
Uploaded: 2012-04-02T12:00:00
Description: Watch this Scientific Journal Video about Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling at JoVE.com

החוקרים בתודה להכיר תמיכה יוצאת דופן של המעבדה שלהם, חברי הצוות ולעבוד לפי אשכול של אקסלנס CellNetworks באוניברסיטת היידלברג, כמו גם על ידי Chica והיינץ שאלר (CHS) קרן. אנו מעריכים כי אבולוציה מולקולרית AAV באמצעות DNA המשפחה גרירת רגליים הפך להיות פעיל מאוד בתחום מאז הפרסום הראשוני שלנו לפני שלוש שנים, ולכן מתנצל בפני כל כותבי פרסומים רלוונטיים שעבודתם לא ניתן לצטט כאן בגלל אילוצי מקום.

1. הכנת סטים פלסמיד קידוד AAV גנים capsid <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> כדי להקל על שגרת ההכנה של כמות מספקת של שונות AAV קפסיד (CAP) הגנים של ה-DNA לאחר גרירת רגליים, בתחילה subclone הגנים האלה לתוך עמוד השדרה פלסמיד משותף. חשוב לכלול רצפים זהים משני צדי של&gt;...

<ol>
	<li>Grimm, D., Kay, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+virus+evolution+to+vector+revolution:+use+of+naturally+occurring+serotypes+of+adeno-associated+virus+(AAV)+as+novel+vectors+for+human+gene+therapy.">From virus evolution to vector revolution: use of naturally occurring serotypes of adeno-associated virus (AAV) as novel vectors for human gene therapy.</a> Curr. Gene Ther. 3, 281-304 (2003).</li><li>Grimm, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+methods+for+gene+transfer+vectors+based+on+adeno-associated+virus+serotypes.">Production methods for gene transfer vectors based on adeno-associated virus serotypes.</a> Methods. 28, 146-157 (2002).</li><li>Grimm, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+gene+therapy+vector+evolution+via+multispecies+interbreeding+and+retargeting+of+adeno-associated+viruses.">In vitro and in vivo gene therapy vector evolution via multispecies interbreeding and retargeting of adeno-associated viruses.</a> J. Virol. 82, 5887-5911 (2008).</li><li>Muller, O. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Random+peptide+libraries+displayed+on+adeno-associated+virus+to+select+for+targeted+gene+therapy+vectors.">Random peptide libraries displayed on adeno-associated virus to select for targeted gene therapy vectors.</a> Nat. Biotechnol. 21, 1040-1046 (2003).</li><li>Perabo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+selection+of+viral+vectors+with+modified+tropism:+the+adeno-associated+virus+display.">In vitro selection of viral vectors with modified tropism: the adeno-associated virus display.</a> Mol. Ther. 8, 151-157 (2003).</li><li>Zolotukhin, S., Potter, M., Hauswirth, W. W., Guy, J., Muzyczka, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+"humanized"+green+fluorescent+protein+cDNA+adapted+for+high-level+expression+in+mammalian+cells.">A "humanized" green fluorescent protein cDNA adapted for high-level expression in mammalian cells.</a> J. Virol. 70, 4646-4654 (1996).</li><li>Wobus, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibodies+against+the+adeno-associated+virus+type+2+(AAV-2)+capsid:+epitope+mapping+and+identification+of+capsid+domains+involved+in+AAV-2-cell+interaction+and+neutralization+of+AAV-2+infection.">Monoclonal antibodies against the adeno-associated virus type 2 (AAV-2) capsid: epitope mapping and identification of capsid domains involved in AAV-2-cell interaction and neutralization of AAV-2 infection.</a> J. Virol. 74, 9281-9293 (2000).</li><li>Grimm, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fatality+in+mice+due+to+oversaturation+of+cellular+microRNA/short+hairpin+RNA+pathways.">Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways.</a> Nature. 441, 537-541 (2006).</li><li>Nakai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unrestricted+hepatocyte+transduction+with+adeno-associated+virus+serotype+8+vectors+in+mice.">Unrestricted hepatocyte transduction with adeno-associated virus serotype 8 vectors in mice.</a> J. Virol. 79, 214-224 (2005).</li><li>Koerber, J. T., Jang, J. H., Schaffer, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+shuffling+of+adeno-associated+virus+yields+functionally+diverse+viral+progeny.">DNA shuffling of adeno-associated virus yields functionally diverse viral progeny.</a> Mol. Ther. 16, 1703-1709 (2008).</li><li>Li, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+and+selection+of+shuffled+AAV+genomes:+a+new+strategy+for+producing+targeted+biological+nanoparticles.">Engineering and selection of shuffled AAV genomes: a new strategy for producing targeted biological nanoparticles.</a> Mol. Ther. 16, 1252-1260 (2008).</li><li>Ward, P., Walsh, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+AAV+Cap+sequences+alter+gene+transduction.">Chimeric AAV Cap sequences alter gene transduction.</a> Virology. 386, 237-248 (2009).</li><li>Yang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+myocardium+tropic+adeno-associated+virus+(AAV)+evolved+by+DNA+shuffling+and+in+vivo+selection.">A myocardium tropic adeno-associated virus (AAV) evolved by DNA shuffling and in vivo selection.</a> Proc. Natl. Acad. Sci. U.S.A. 106, 3946-3951 (2009).</li><li>Perabo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combinatorial+engineering+of+a+gene+therapy+vector:+directed+evolution+of+adeno-associated+virus.">Combinatorial engineering of a gene therapy vector: directed evolution of adeno-associated virus.</a> J. Gene. Med. 8, 155-162 (2006).</li><li>Maheshri, N., Koerber, J. T., Kaspar, B. K., Schaffer, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+adeno-associated+virus+yields+enhanced+gene+delivery+vectors.">Directed evolution of adeno-associated virus yields enhanced gene delivery vectors.</a> Nat. Biotechnol. 24, 198-204 (2006).</li><li>Wu, Z., Asokan, A., Samulski, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adeno-associated+virus+serotypes:+vector+toolkit+for+human+gene+therapy.">Adeno-associated virus serotypes: vector toolkit for human gene therapy.</a> Mol. Ther. 14, 316-327 (2006).</li><li>Kwon, I., Schaffer, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designer+gene+delivery+vectors:+molecular+engineering+and+evolution+of+adeno-associated+viral+vectors+for+enhanced+gene+transfer.">Designer gene delivery vectors: molecular engineering and evolution of adeno-associated viral vectors for enhanced gene transfer.</a> Pharm. Res. 25, 489-499 (2008).</li><li>Perabo, L., Huber, A., Marsch, S., Hallek, M., Buning, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Artificial+evolution+with+adeno-associated+viral+libraries.">Artificial evolution with adeno-associated viral libraries.</a> Comb. Chem. High. Throughput. Screen. 11, 118-126 (2008).</li><li>McCarty, D. M., Monahan, P. E., Samulski, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-complementary+recombinant+adeno-associated+virus+(scAAV)+vectors+promote+efficient+transduction+independently+of+DNA+synthesis.">Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis.</a> Gene Ther. 8, 1248-1254 (2001).</li></ol>

הנה, יש לנו התווה צעדים ניסיוניים חיוניים והנחיות AAV capsid הנדסת באמצעות DNA המשפחה גרירת רגליים ועל האבולוציה בתאים או בבעלי חיים. בעיקרו של דבר, פרוטוקולים אלה הן גרסאות סטנדרטיות של הנהלים שאנחנו דיווח לראשונה בתחום AAV בשנת 2008 3. בעוד גל של מחקרי מעקב על ידי אחרים ...

<table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> שם מגיב </td><td> חברה </td><td> מספר קטלוגי </td></tr><tr><td> אני DNase </td><td> Invitrogen </td><td> 18068-015 </td></tr><tr><td> Polyethylenimine (PEI) </td><td> Sigma-Aldrich </td><td> 408727 </td></tr><tr><td> הגבלת אנזימים </td><td> חוד </td><td> שונים </td></tr><tr><td> האנזים T4 DNA </td><td> חוד </td><td> M0202T </td></tr><tr><td> ג&#39;ל ערכת חילוץ </td><td> Qiagen </td><td> 28704 </td></tr><tr><td> Phusion II Kit פולימראז </td><td> Finnzymes (חוד) </td><td> F-540S </td></tr><tr><td> HotStar HiFi ערכת פולימראז </td><td> Qiagen </td><td> 202602 </td></tr><tr><td> DMSO </td><td> Finnzymes (חוד) </td><td> F-540S (חלק ערכת) </td></tr><tr><td> EDTA (25 מ&quot;מ) </td><td> Invitrogen </td><td> 18068-015 (חלק ערכת) </td></tr><tr><td> טריס </td><td> רוט </td><td> 4855.2 </td></tr><tr><td> Ampicilin מלח נתרן </td><td> רוט </td><td> K029.2 </td></tr><tr><td> dNTPs (10 מ&quot;מ, 100 μl) </td><td> Invitrogen </td><td> 18427013 </td></tr><tr><td> Iodixanol (OptiPrep) </td><td> ציר ה-Shield </td><td> 1114739 </td></tr><tr><td> Phenolred </td><td> מרק </td><td> 107241 </td></tr><tr><td> הפלסמיד הכנה מגה בערכה </td><td> Qiagen </td><td> 12181 </td></tr><tr><td> Ultracentrifuge </td><td> Beckman Coulter- </td><td> אופטימה L90K </td></tr><tr><td> חותם מהיר צנטריפוגות צינורות </td><td> Beckman Coulter- </td><td> 342414 </td></tr><tr><td> Electroporation היחידה </td><td> ביו רד </td><td> GenePulserXcell </td></tr><tr><td> תרמית Cycler </td><td> Eppendorf </td><td> Vapo הגנה </td></tr><tr><td> חימום בלוק </td><td> BIOER </td><td> MB-102 </td></tr><tr><td> מיקרוסקופ פלואורסצנטי </td><td> אולימפוס </td><td> IX81 </td></tr><tr><td> FACS Analyzer </td><td> Beckman Coulter- </td><td> Cytomics FC500 MLP </td></tr><tr><td> MegaX DH10B T1R תאים </td><td> Invitrogen </td><td> C640003 </td></tr><tr><td> Benzonase </td><td> מרק </td><td> 101695 </td></tr><tr><td> Adenovirus-5 </td><td> ATCC </td><td> VR-5 </td></tr><tr><td> pBlueScript II KS (+) פלסמיד </td><td> Stratagene </td><td> 212207 </td></tr><tr><td> cap5F (פאק באתר אני בצהוב, cap5 ספציפיים רצפים באותיות מודגשות): GACTCTTAATTAACAGGT ATGTCTTTTGTTGATCACCCTCC </td><td> IDTDNA </td><td> התאמה אישית פריימר </td></tr><tr><td> cap5R (ASC אני באתר בירוק, cap5 ספציפיים רצפים באותיות מודגשות): GTGAGGGCGCGCC TTAAAGGGGTCGGGTAAGGTATC </td><td> IDTDNA </td><td> התאמה אישית פריימר </td></tr></tbody></table>

engineering and evolution of synthetic adeno-associated virus (aav) gene therapy vectors via dna family shuffling

Adeno הקשורים נגיפיים (AAV) וקטורים מהווים חלק מכלי הרכב החזקים ביותר ומבטיח להעברת טיפולית הגן האנושי עקב שילוב ייחודי של תכונות מועילות 1. אלה כוללים את apathogenicity של וירוסים wildtype הבסיס לבין מתודולוגיות מתקדמות ביותר לייצור גבוהה titer טוהר גבוהה, וקליניים כיתה וקטורים רקומביננטי 2. יתרון נוסף של מערכת מסוימת AAV על וירוסים אחרים הוא הזמינות של עושר טבעי של קפסיד, השונים בנכסים חיוניים עדיין יכולים להיות מהונדסים בקלות באמצעות וקטורים 1,2 פרוטוקול נפוץ. יתר על כן, מספר קבוצות, כולל שלנו פיתחו לאחרונה אסטרטגיות להשתמש באותם וירוסים טבעי כתבניות ליצירת וקטורים סינתטיים אשר גם לשלב את הנכסים של קפסיד קלט מרובים, או אשר משפרים את המאפיינים של אחת לבודד. הטכנולוגיות המתאימות כדי להשיג מטרות אלה arה-DNA או המשפחה דשדוש 3, כלומר פיצול של גנים שונים AAV קפסיד ואחריו הרכבה מחדש שלהם מבוסס על homologies חלקי (בדרך כלל&gt; 80% עבור רוב קפסיד AAV), או להציג פפטיד 4,5, כלומר הכנסה של 7 חומצות אמינו בדרך כלל לתוך לולאה חשוף של capsid ויראלי שבו פפטיד אידיאלי מתווכת מחדש מיקוד לסוג התא הרצוי. להצלחה מקסימלית, שתי השיטות מיושמות באופן תפוקה גבוהה לפיה הפרוטוקולים הם עד בקנה מידה להניב ספריות של כ 1,000,000 קפסיד גרסאות שונות. שיבוט כל כך מורכב משילוב ייחודי של וירוסים הורים רבים (גישת ה-DNA של גרירת רגליים) או מכילה פפטיד ייחודי בתוך עמוד השדרה ויראלי זהה (גישת התצוגה פפטיד). השלב האחרון לאחר מכן הוא איטרטיבי מבחר של הספרייה כזה על תאים היעד על מנת להעשיר את capsids בודדים הממלאים את רוב או את כל הדרישות אידיאלי של תהליך הבחירה. זו האחרונה רצוי לסרקאינס לחץ חיובי, כגון גידול לסוג תא מסוים של עניין, עם סלקציה שלילית, לשם מניעת מופע של כל capsids מגיבים עם נוגדנים נגד AAV. שילוב זה מגדיל הסיכוי capsids סינתטיים ששרדו את הבחירה להתאים את הצרכים של היישום ניתן באופן סביר להניח שלא נמצאו כל AAV טבעי לבודד. כאן, אנו מתמקדים בשיטת ה-DNA המשפחה דשדוש כמו תיאורטית ו ניסיוני יותר מאתגר של שתי הטכנולוגיות. אנו מתארים ולהפגין בכל האמצעים החיוניים לייצור ובחירת גררה את רגליה ספריות AAV (איור 1), ולאחר מכן לדון את החסרונות ואת ההיבטים הקריטיים של הפרוטוקולים, כי אחד צריך להיות מודע כדי להצליח עם האבולוציה AAV מולקולרית.

Watch this Scientific Journal Video about Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling at JoVE.com

Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling

אנחנו מדגימים את הטכניקה הבסיסית מולקולרי מהנדס ולהתפתח סינתטיים Adeno הקשורים נגיפיים (AAV) טיפול וקטורים גנים באמצעות DNA המשפחה גרירת רגליים. יתר על כן, אנו מספקים הנחיות כלליות ודוגמאות נציג לבחירת וניתוח של capsids chimeric בודדים בעלי תכונות משופרות על תאים היעד בתרבות או בעכברים.

הנדסה האבולוציה של הנגיף Adeno הקשורים סינתטי (AAV) בריפוי גנטי באמצעות וקטור משפחת ה-DNA של גרירת רגליים

Adeno-associated viral (AAV) vectors represent some of the most potent and promising vehicles for therapeutic human gene transfer due to a unique ...

Research

JoVE Journal

Immunology and Infection

Engineering and Evolution of Synthetic Adeno-Associated Virus (AAV) Gene Therapy Vectors via DNA Family Shuffling

Generation of Recombinant Influenza Virus from Plasmid DNA

הדור של וירוס שפעת רקומביננטי מ-DNA פלסמיד

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Generation of Multivirus-specific T Cells to Prevent/treat Viral Infections after Allogeneic Hematopoietic Stem Cell Transplant

דור Multivirus ספציפיים תאים T כדי למנוע / לטפל זיהומים נגיפיים לאחר השתלת allogeneic תא גזע hematopoietic

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully ...

Separation of Single-stranded DNA, Double-stranded DNA and RNA from an Environmental Viral Community Using Hydroxyapatite Chromatography

ההפרדה של ה-DNA חד גדילי, פעמיים תקועים DNA ו-RNA מהקהילה ויראלי הסביבה באמצעות כרומטוגרפיה hydroxyapatite

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2.  Viruses modulate host cell abundance and diversity, ...

Production and Titering of Recombinant Adeno-associated Viral Vectors

ייצור Titering של Adeno הקשורים ווקטורים רקומביננטי ויראלי

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Expanding Cytotoxic T Lymphocytes from Umbilical Cord Blood that Target Cytomegalovirus, Epstein-Barr Virus, and Adenovirus

הרחבת לימפוציטים מסוג T ציטוטוקסיים מדם טבורים שציטומגלווירוס יעד, וירוס אפשטיין באר, וadenovirus

Virus infections after stem cell transplantation are among the most common causes of death, especially after cord blood (CB) transplantation (CBT) where ...

A Tetracycline-regulated Cell Line Produces High-titer Lentiviral Vectors that Specifically Target Dendritic Cells

שורת תאי טטרציקלין מוסדר מייצרת וקטורי lentiviral גבוה כייל שמתמקדים תאי דנדריטים

Lentiviral  vectors (LVs) are a powerful means of delivering genetic material to many types  of cells. Because of safety concerns associated with these ...

Cell-based Flow Cytometry Assay to Measure Cytotoxic Activity

Cytolytic activity of CD8+ T cells is rarely evaluated. We describe here a new cell-based assay to measure the capacity of antigen-specific CD8+ T cells ...

Propagation of Homalodisca coagulata virus-01 via Homalodisca vitripennis Cell Culture

Propagation of Homalodisca coagulata virus-01 via Homalodisca vitripennis Cell Culture

רביה של<em&gt; וירוס-01 coagulata Homalodisca</em&gt; דרך<em&gt; Homalodisca vitripennis</em&gt; תרבות תא

The glassy-winged sharpshooter (Homalodisca vitripennis) is a highly vagile and polyphagous insect found throughout the southwestern United States. These ...

A Simple and Efficient Approach to Construct Mutant Vaccinia Virus Vectors

גישה פשוטה ויעילה לבנות וקטורי וירוס Vaccinia Mutant

The CRISPR-associated endonuclease Cas9 can edit particular genomic loci directed by a single guide RNA (gRNA). The CRISPR/Cas9 system has been ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

הערכת היעילות והרעילות של RNAs מיקוד ייצור HIV-1 לשימוש ב ג&#39;ין או טיפול תרופתי

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...